ID: 1019734708

View in Genome Browser
Species Human (GRCh38)
Location 7:2644966-2644988
Sequence CCCCAGCAGCTCCCAAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019734702_1019734708 7 Left 1019734702 7:2644936-2644958 CCAAGGGGGGGCCAGGCAGGGGA 0: 1
1: 0
2: 5
3: 61
4: 509
Right 1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG No data
1019734696_1019734708 16 Left 1019734696 7:2644927-2644949 CCTCTCATCCCAAGGGGGGGCCA 0: 1
1: 0
2: 1
3: 9
4: 118
Right 1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG No data
1019734689_1019734708 30 Left 1019734689 7:2644913-2644935 CCACTGTGGCTGAGCCTCTCATC 0: 1
1: 0
2: 1
3: 19
4: 291
Right 1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG No data
1019734703_1019734708 -4 Left 1019734703 7:2644947-2644969 CCAGGCAGGGGACCATCTGCCCC 0: 1
1: 0
2: 0
3: 22
4: 215
Right 1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG No data
1019734700_1019734708 8 Left 1019734700 7:2644935-2644957 CCCAAGGGGGGGCCAGGCAGGGG 0: 1
1: 0
2: 1
3: 43
4: 433
Right 1019734708 7:2644966-2644988 CCCCAGCAGCTCCCAAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019734708 Original CRISPR CCCCAGCAGCTCCCAAGGCT GGG Intronic
No off target data available for this crispr