ID: 1019737540

View in Genome Browser
Species Human (GRCh38)
Location 7:2658163-2658185
Sequence GCACACGGCCGAGCCAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019737536_1019737540 -2 Left 1019737536 7:2658142-2658164 CCACAGTCCCACATGGAGTGTGC 0: 1
1: 0
2: 0
3: 13
4: 188
Right 1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 84
1019737535_1019737540 -1 Left 1019737535 7:2658141-2658163 CCCACAGTCCCACATGGAGTGTG 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 84
1019737534_1019737540 3 Left 1019737534 7:2658137-2658159 CCTGCCCACAGTCCCACATGGAG 0: 1
1: 0
2: 4
3: 31
4: 276
Right 1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 84
1019737539_1019737540 -10 Left 1019737539 7:2658150-2658172 CCACATGGAGTGTGCACACGGCC 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 84
1019737538_1019737540 -9 Left 1019737538 7:2658149-2658171 CCCACATGGAGTGTGCACACGGC 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 84
1019737532_1019737540 11 Left 1019737532 7:2658129-2658151 CCAGGTGACCTGCCCACAGTCCC 0: 1
1: 0
2: 2
3: 28
4: 317
Right 1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG 0: 1
1: 0
2: 0
3: 5
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019737540 Original CRISPR GCACACGGCCGAGCCAGAAC TGG Intronic
901003919 1:6162553-6162575 GGACTCGGCCAAGCCAGAGCAGG + Intronic
902414790 1:16232260-16232282 GCACACGGACGTGCCCGAGCGGG - Exonic
906669375 1:47643533-47643555 ACACACGGCATAGCCAGCACGGG - Intergenic
909367653 1:74846564-74846586 GCAGAAGGCCAAGCCAGAGCAGG + Intergenic
909728631 1:78867203-78867225 GCACAGGGCAGAGCCAGAAGGGG + Intergenic
920983076 1:210856550-210856572 GCACATGGCAGAGACAGAGCTGG - Intronic
1064955142 10:20900280-20900302 GGACATGGCAGAGCCAGACCTGG - Intronic
1067274178 10:44819722-44819744 GCAGATGGCCAAGCCAGAACCGG - Intergenic
1070155037 10:73828000-73828022 GCACACGCACGTGGCAGAACAGG + Intronic
1072804254 10:98414796-98414818 CCACACAGCAGAGCCAGCACCGG + Intronic
1074913949 10:117938012-117938034 GGACACAGCCAAGCCATAACAGG - Intergenic
1076919310 10:133443072-133443094 GCACACAGCAGATCCAGACCCGG + Intergenic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1079455276 11:20630979-20631001 GCTCACTGCAGAGTCAGAACTGG + Intronic
1081908846 11:46687176-46687198 CCGCACGGCCCAGCCAGAATGGG - Intronic
1082782578 11:57299309-57299331 GAAGATGGCCGAGCCACAACAGG + Intergenic
1084409193 11:68996747-68996769 GCTCAGGCCAGAGCCAGAACAGG - Intergenic
1084550003 11:69835461-69835483 GCCCTCGGCCGTGCCAGATCGGG - Intergenic
1085121815 11:73972276-73972298 GCACACTGGGGATCCAGAACAGG - Intergenic
1086420869 11:86635901-86635923 TCAAATGGCAGAGCCAGAACTGG + Intronic
1089110845 11:116054736-116054758 CCACACTGCCCACCCAGAACTGG - Intergenic
1096630308 12:52922226-52922248 GCAAATGGGAGAGCCAGAACTGG + Intronic
1101736824 12:107469371-107469393 GCAGAGGGCAGAGCCAGACCAGG - Intronic
1102191778 12:110994198-110994220 GCAAGGGGCAGAGCCAGAACTGG + Intergenic
1102438735 12:112945656-112945678 GAAGATGGCTGAGCCAGAACTGG - Intronic
1102826475 12:115951436-115951458 GCACACGTCAGTGCCAGAACAGG - Intergenic
1117500011 14:56342189-56342211 GAACACGGTGGGGCCAGAACTGG - Intergenic
1118454354 14:65931206-65931228 GGACGTGGCCGACCCAGAACTGG + Intergenic
1123421306 15:20139551-20139573 GCACAGGGCCAAGGCAGGACAGG + Intergenic
1123530532 15:21146091-21146113 GCACAGGGCCAAGGCAGGACAGG + Intergenic
1124707504 15:31977875-31977897 GCTCACGGCAGAGTCAGGACTGG - Intergenic
1128089046 15:64906565-64906587 TCACACAGCCGAGCTAGGACTGG + Intronic
1132641439 16:980313-980335 GCTCTCGGCCGGGCCAGAACAGG + Intronic
1132677373 16:1126373-1126395 TCATACGGCCGGGCCAGAGCTGG + Intergenic
1132977199 16:2716690-2716712 GCATACGGCAGAGCCAGCCCTGG - Intronic
1133053783 16:3134706-3134728 GCACATGGCCTAGCCACAAGTGG - Intronic
1136625342 16:31458801-31458823 GCAGTCGGCCGCGCCAGAAGAGG - Intronic
1147533094 17:41298594-41298616 GCAGACGGGGGAGCCAGAAGGGG - Intergenic
1148850393 17:50551766-50551788 GCACCTGGCAGAGCCAGGACTGG - Intronic
1149477263 17:56973594-56973616 GCCCACTGCCTAGACAGAACCGG + Intergenic
1160672736 19:373911-373933 GCACACGGCGGAGACAGCCCTGG + Intronic
1161475193 19:4480777-4480799 GCACAGGGCAGAGCCAGGCCTGG - Intronic
1162970425 19:14177823-14177845 GGACACAGCCGAGCCAGAGGTGG - Intronic
1163154462 19:15432464-15432486 GCCCAAGGCCGAGCCGGAGCCGG - Intronic
1166326302 19:42053184-42053206 GCACCCGGCACAGCCAGGACTGG - Intronic
1166800016 19:45450997-45451019 GCACAGGGCGCAGCCAGGACCGG + Intronic
925298460 2:2793354-2793376 GAACACGGCTGAGCGAGGACAGG - Intergenic
938468014 2:131535552-131535574 GCACACAGCAGAGCCAGGGCTGG - Intergenic
941927013 2:170905981-170906003 GGACACTGCAGAGCCAGCACGGG + Intergenic
948469146 2:238166300-238166322 TCACACAGCAGAGCCAGAAATGG + Intronic
1168746796 20:250145-250167 GCACATGGCATAGCCAGAGCAGG - Intergenic
1168802932 20:654886-654908 CCACCGGGCCCAGCCAGAACTGG - Intronic
1169314295 20:4575630-4575652 GCACAGAGCAGAGACAGAACTGG + Intergenic
1169923802 20:10761971-10761993 GCACACGGACAAGCCTGAACAGG + Intergenic
1171804337 20:29661957-29661979 GCCCAGGACTGAGCCAGAACAGG - Intergenic
1171839713 20:30194465-30194487 GCCCAGGACTGAGCCAGAACAGG + Intergenic
1174368631 20:50071467-50071489 GTGCAGGCCCGAGCCAGAACGGG + Intergenic
1175808681 20:61845730-61845752 GCACACGGCCCTGACAGCACGGG - Intronic
1175853131 20:62104429-62104451 GCACATGGCCAGGCCAGGACTGG + Intergenic
1180971867 22:19820121-19820143 GCACACGGCCCAGGCAGGATGGG + Intronic
1185172405 22:49301659-49301681 GCACACGGCCCGGCCTGACCAGG + Intergenic
950920476 3:16689159-16689181 GAACAAGGCTGAGACAGAACAGG + Intergenic
960011609 3:112840345-112840367 GCAGAAGGCAAAGCCAGAACAGG + Intronic
962411772 3:135147070-135147092 GCAAATGGCAGAGCCAGAATAGG + Intronic
968291025 3:197539955-197539977 GCTCACTGCCTAGACAGAACCGG - Intronic
968966956 4:3773598-3773620 GGGCACGGCCAAGCCAGAGCAGG - Intergenic
969364372 4:6685673-6685695 GCACATGGCTGAGCCAGACTTGG + Intergenic
974088272 4:57284042-57284064 GCACATTGCAGAGCCAGCACAGG + Intergenic
974993972 4:69129412-69129434 GCACATGGGGGAGCCAGAAAGGG - Intronic
976095586 4:81505339-81505361 TCACAGGGCAGAGTCAGAACCGG - Intronic
981185354 4:141795582-141795604 GCTCAGGGCAGAGTCAGAACTGG - Intergenic
982068508 4:151674994-151675016 GCACACGGCAGACCCTGAGCAGG + Intronic
982133263 4:152248658-152248680 GCCCACGGAGGAGCCTGAACTGG - Intergenic
984102303 4:175500052-175500074 GCACTGGGAGGAGCCAGAACTGG - Intergenic
984484600 4:180352383-180352405 GCACAAGGCAAAGCCGGAACAGG + Intergenic
1004156216 6:13170707-13170729 GAACACGATGGAGCCAGAACTGG - Intronic
1007386097 6:41521136-41521158 GCAAGGGGCAGAGCCAGAACTGG - Intergenic
1014833509 6:126130454-126130476 GCAGGCTGCCCAGCCAGAACGGG + Intergenic
1018948061 6:168359606-168359628 GCAGCCTCCCGAGCCAGAACAGG - Intergenic
1019530493 7:1500593-1500615 GGACACAGCGGAGCCAGGACTGG - Intronic
1019737540 7:2658163-2658185 GCACACGGCCGAGCCAGAACTGG + Intronic
1023112872 7:36831685-36831707 GAACAGGGCAGGGCCAGAACAGG + Intergenic
1030114204 7:106050710-106050732 GCACAAAGCCGAGACAGAGCAGG + Intergenic
1035522320 8:284701-284723 GCACAGGTCCCAGCCAGCACCGG - Intergenic
1038677922 8:29640318-29640340 ACACGTGGCAGAGCCAGAACTGG + Intergenic
1048872867 8:138813216-138813238 GGACACAGCCAAGCCAGATCAGG - Intronic
1053317473 9:37064138-37064160 GCACATGGCCCAGCCAGTATTGG - Intergenic
1185473411 X:398717-398739 GCGCACAGCAGAGTCAGAACTGG + Intergenic
1190681681 X:52831440-52831462 GCACATGGCCAGGCCAGCACTGG + Intergenic
1196188592 X:112771546-112771568 GCCCATGGCCAACCCAGAACTGG - Intergenic