ID: 1019738413

View in Genome Browser
Species Human (GRCh38)
Location 7:2661432-2661454
Sequence GGGCAGCCCCCGAACTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 131}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019738413_1019738425 26 Left 1019738413 7:2661432-2661454 CCTGGAGAGTTCGGGGGCTGCCC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1019738425 7:2661481-2661503 GCGCAGGGGCCCCCAGCCAGCGG 0: 1
1: 0
2: 0
3: 45
4: 357
1019738413_1019738420 10 Left 1019738413 7:2661432-2661454 CCTGGAGAGTTCGGGGGCTGCCC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1019738420 7:2661465-2661487 CTCAGCCAGACCTAGAGCGCAGG 0: 1
1: 0
2: 2
3: 12
4: 126
1019738413_1019738421 11 Left 1019738413 7:2661432-2661454 CCTGGAGAGTTCGGGGGCTGCCC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1019738421 7:2661466-2661488 TCAGCCAGACCTAGAGCGCAGGG 0: 1
1: 0
2: 0
3: 15
4: 92
1019738413_1019738422 12 Left 1019738413 7:2661432-2661454 CCTGGAGAGTTCGGGGGCTGCCC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1019738422 7:2661467-2661489 CAGCCAGACCTAGAGCGCAGGGG 0: 1
1: 0
2: 1
3: 17
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019738413 Original CRISPR GGGCAGCCCCCGAACTCTCC AGG (reversed) Intronic
900406582 1:2495589-2495611 GGGGAGGCCCCGCACACTCCTGG + Intronic
900572732 1:3366898-3366920 GTGCAGCCCCCTCACTCCCCGGG - Intronic
900591472 1:3462151-3462173 GGGCAGCTCCCGCTCTCTGCTGG + Intronic
906356937 1:45115260-45115282 GGGCAGCCCCCGCCCCCGCCCGG - Intronic
907240083 1:53076349-53076371 GTCCAGCCCCCAAACTGTCCTGG - Intronic
907938132 1:59061022-59061044 GAGGAGCCCCCGATCTCCCCAGG - Intergenic
920790621 1:209086706-209086728 GGGCAGCCTCCCATCTCTCAAGG - Intergenic
921934817 1:220786822-220786844 GGGCAGCTCCTGAACCCTTCCGG - Exonic
1065110415 10:22435689-22435711 GGGCAGCACCTGACCCCTCCCGG + Intronic
1065821802 10:29532645-29532667 GGGCAGCTCCAGCTCTCTCCTGG + Exonic
1065898068 10:30182018-30182040 GGGCAGACACCCAGCTCTCCTGG - Intergenic
1067808891 10:49411902-49411924 GGGCAGAACCTAAACTCTCCTGG - Intergenic
1072553182 10:96494390-96494412 GGGCAGCCCCCTGACCTTCCTGG + Intronic
1073199732 10:101725566-101725588 GGGCAGCCCCACATCTCTACTGG + Intergenic
1074591830 10:114821598-114821620 GGGCAGCCACCGCCCTCTCCCGG - Intergenic
1076146419 10:128126023-128126045 GGGGACCCCCCGAGCTCTGCGGG - Intronic
1076247943 10:128962143-128962165 GGGCAGCCCCAGACCTCCCAAGG + Intergenic
1077016357 11:400655-400677 AAGCAGCCCACGACCTCTCCCGG - Exonic
1077461460 11:2712829-2712851 GTCCAGCCCCCAAACTCTCTAGG - Intronic
1077551089 11:3200634-3200656 AGGAAGCCCCCCGACTCTCCAGG + Intergenic
1081840976 11:46201208-46201230 GGGAAGTCCTAGAACTCTCCTGG - Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083934060 11:65861147-65861169 GTGGAGCCTCCGTACTCTCCTGG + Intronic
1084195785 11:67523177-67523199 GGGCAGCCCCCAACCCCGCCCGG + Intronic
1084478233 11:69400910-69400932 GGGCCGCCCCTGCCCTCTCCTGG + Intergenic
1084534479 11:69748579-69748601 GGGCAGAGCCCGAACTCCTCAGG + Intergenic
1089332350 11:117698833-117698855 GGGCTGCCAGTGAACTCTCCTGG - Intronic
1091823481 12:3492717-3492739 GGGCAGCCCCCTTACCTTCCTGG + Intronic
1092240597 12:6833839-6833861 TGGCAGCCCCCAGACCCTCCAGG - Intronic
1095440751 12:42237580-42237602 GGGCAGGCCCGGGACTCACCGGG + Exonic
1095684409 12:45016375-45016397 GTGGTGCCCCTGAACTCTCCTGG + Exonic
1101210786 12:102533579-102533601 GGCCAGCCAGCCAACTCTCCAGG + Intergenic
1101432222 12:104636109-104636131 GATCAGCCACTGAACTCTCCAGG - Intronic
1104586815 12:130054213-130054235 GGGTAGCTCCCCACCTCTCCAGG - Intergenic
1104970634 12:132529152-132529174 CTGCAGCCCCCGAAATTTCCAGG + Intronic
1105893390 13:24698336-24698358 TCGCAGCCCCCTAACTCTCACGG + Intronic
1107833704 13:44396954-44396976 AGGCAGCCCCAGAACTTTGCTGG + Intronic
1111230593 13:85340740-85340762 GGGCAGCCCCCGCCCCCGCCTGG - Intergenic
1112579306 13:100664573-100664595 TGGCTTCCCCCGAACTCTGCAGG + Intronic
1115217241 14:31026009-31026031 CGGCAGGCCCCGAGCTGTCCCGG - Exonic
1117546661 14:56798625-56798647 GGGCAGACGCCGGACTCCCCAGG - Intergenic
1120436893 14:84493795-84493817 GAGCAGCCCCCGAGCACTTCTGG + Intergenic
1122415793 14:101548929-101548951 GGGCAGCACCCCACCTGTCCTGG + Intergenic
1124264415 15:28220400-28220422 AGGCAGCCCACAAACTGTCCAGG - Intronic
1132630323 16:914209-914231 GGGCAGTCCCTGACCCCTCCTGG + Intronic
1132871417 16:2117281-2117303 GGGCAGCCTCCGGACACTCCTGG - Intronic
1134521111 16:14919613-14919635 GGGCAGCCTCCGGACACTCCTGG + Intronic
1134550460 16:15136359-15136381 GGGCAGCCTCCGGACACTCCTGG - Intronic
1134708787 16:16318264-16318286 GGGCAGCCTCCGGACACTCCTGG + Intergenic
1134716001 16:16358298-16358320 GGGCAGCCTCCGGACACTCCTGG + Intergenic
1134950818 16:18350381-18350403 GGGCAGCCTCCGGACACTCCTGG - Intergenic
1134958755 16:18393861-18393883 GGGCAGCCTCCGGACACTCCTGG - Intergenic
1136220205 16:28823520-28823542 CGGCTGCCCCCGGCCTCTCCTGG - Exonic
1136702594 16:32157579-32157601 AGGCAGCCCACAAACTGTCCAGG - Intergenic
1137439050 16:48483142-48483164 GGGCTGCCCCCCACCCCTCCTGG + Intergenic
1137772785 16:51030421-51030443 GGGGAGGCCAAGAACTCTCCTGG - Intergenic
1142429004 16:90016428-90016450 TGGCAGCCCCCAAGGTCTCCAGG + Intronic
1203067462 16_KI270728v1_random:1032142-1032164 AGGCAGCCCACAAACTGTCCAGG + Intergenic
1142760078 17:2036898-2036920 GTGCAGCCCAGGATCTCTCCAGG - Exonic
1146009321 17:29180733-29180755 AGGCAGGCACCGAACTCTGCAGG + Intergenic
1147915155 17:43881426-43881448 GGGCACCCCCGCATCTCTCCAGG - Intronic
1148130080 17:45257105-45257127 GGGCCTCCCCCGAGCCCTCCAGG - Intronic
1151954555 17:77373884-77373906 AGGCTGCCTCGGAACTCTCCAGG + Intronic
1152104096 17:78318866-78318888 GGGCAGCCCCGTAAGTGTCCAGG + Intergenic
1152209512 17:78995546-78995568 GGGCAGCACCCGCACTCCCCTGG - Intronic
1160706421 19:532204-532226 GGGCGGGCCCCGAAGCCTCCTGG + Intronic
1160784275 19:892462-892484 GGGGACCCCACGTACTCTCCAGG + Intronic
1160890200 19:1373748-1373770 GCGCAGCCACCGACGTCTCCCGG + Intronic
1160892080 19:1384271-1384293 AGGCAGGCCCCGCTCTCTCCAGG - Intronic
1161520291 19:4720035-4720057 AGGCAGCCCCCCAAGCCTCCGGG + Intronic
1162794132 19:13078026-13078048 GAGCAGCCCAAGGACTCTCCAGG + Intronic
1163455670 19:17404467-17404489 GGGCAGCAGCCAAACTCCCCAGG - Intronic
1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG + Intronic
1166050365 19:40255555-40255577 GGGAAGCCCCCCAACCCCCCAGG - Intronic
1167463861 19:49640057-49640079 GGGCCGCCCCCGCCCTGTCCCGG + Exonic
1168277070 19:55284318-55284340 CGGCTGCCCCCCACCTCTCCGGG - Exonic
926082720 2:10001180-10001202 GGGCTCCCCCCGTACTCTTCAGG - Exonic
927888179 2:26731085-26731107 GGGCAGCCCCCGGACTCCAAAGG + Exonic
928722149 2:34133139-34133161 GGGCTGCCCCCCACCTCCCCCGG + Intergenic
931256027 2:60573649-60573671 ATGCAGCCCCCAAACTCACCAGG - Intergenic
932082058 2:68724262-68724284 GGACTGGCCCTGAACTCTCCAGG + Intronic
933808461 2:86017175-86017197 TTTCAGCCCCAGAACTCTCCTGG - Intergenic
934927031 2:98389205-98389227 GGGCTGCCTCAGAACTATCCAGG + Intronic
937335338 2:121058942-121058964 GAGCAGCCCCCGCCCTCCCCCGG + Intergenic
946456045 2:219826933-219826955 GAGCAGCCCCCAAACACTGCAGG + Intergenic
946890606 2:224272216-224272238 AGGGAGACCCAGAACTCTCCAGG + Intergenic
947620905 2:231590514-231590536 GGGCAGCCACCATTCTCTCCAGG + Intergenic
948178040 2:235959537-235959559 GGCCAGGCCCTGACCTCTCCTGG - Intronic
948505297 2:238423899-238423921 GGGCAGCCCGCTGACCCTCCAGG - Intergenic
1171866108 20:30488459-30488481 AGGCAGACCCCAAACCCTCCGGG + Intergenic
1172031909 20:31988279-31988301 GAGCAGCCCCCAAACTCTGGGGG + Intronic
1175366684 20:58460904-58460926 GGGAGGCCCCCGACTTCTCCAGG - Exonic
1175717658 20:61266154-61266176 GGGAAGCACCCAAACTCTCAAGG - Intronic
1176994864 21:15543713-15543735 GGGCATCCCCTGAATTCTGCCGG - Intergenic
1178915704 21:36704670-36704692 GGGCGGCGTCCGAACTCCCCAGG + Intronic
1179482764 21:41688993-41689015 GGGCAGCCTCCTAACTGTCAGGG + Intergenic
1179500052 21:41802982-41803004 GGGCAGCCCCAGCACTGCCCTGG + Intronic
1179998585 21:44985088-44985110 GGGCCGGCCCTGAAGTCTCCCGG + Intergenic
1180891381 22:19291571-19291593 GGGCAGCCCCCCAGCCCGCCGGG + Intronic
1180989101 22:19923417-19923439 GGGCAGCTCTCGACCTGTCCTGG + Intronic
1183732406 22:39626024-39626046 GGGCTGCCCCTGAGCTCCCCAGG - Intronic
1185059658 22:48599664-48599686 TGGCAGCTCCCAAACCCTCCAGG - Intronic
1185180505 22:49358163-49358185 GAGCAGACCCCCAACTCCCCCGG + Intergenic
1185384236 22:50524465-50524487 GGGCAGCCCAGGCACTGTCCTGG - Intronic
954265663 3:49469139-49469161 AGGGAGCCCCAGAGCTCTCCGGG + Intronic
955116571 3:56011069-56011091 GGGCAGGACCCAAACCCTCCAGG + Intronic
961463161 3:127065840-127065862 GGCCTGCCCCAGAACTCTCCCGG - Intergenic
966932354 3:184684127-184684149 GGGCAGCCCTGAAACTCCCCTGG - Intronic
968666251 4:1823803-1823825 GGGCAGCCCCCCAACCCTGCTGG + Intronic
970962979 4:21895028-21895050 GGAAAGCCCCCCAACTCACCTGG - Intronic
980043594 4:127965383-127965405 GGACACGCCCCGAGCTCTCCTGG - Exonic
981641260 4:146945937-146945959 GGGCAGCTCCCAGACTCTTCGGG + Intergenic
984778874 4:183505922-183505944 GGGGCGCCCGCGAACTTTCCCGG - Intronic
985894623 5:2740922-2740944 CGGCAGCCCCCCGACTCCCCAGG + Intergenic
986396717 5:7337973-7337995 GGGCCTCCCCCTAACTCTGCAGG - Intergenic
987079920 5:14417470-14417492 GGGCAGCCCCAGAACACAGCGGG + Intronic
1002096623 5:176835069-176835091 GGGCAACCCCTGCACTCTGCAGG + Intronic
1002439605 5:179257460-179257482 GAGCAGCCCCTGGACTCCCCGGG - Intronic
1003889159 6:10548554-10548576 GGGCAGCCCCCTCCCACTCCTGG + Intronic
1006255476 6:32829222-32829244 GGGCAGCCCCAGTTCCCTCCTGG - Intronic
1010784047 6:79979109-79979131 GGGCAGTCCCAGAACTAACCTGG - Intergenic
1011608647 6:89129142-89129164 TGGCAGCCCCCTGACTCTGCAGG - Intergenic
1011930114 6:92701074-92701096 GGGCAGCCACCCAACACTGCTGG + Intergenic
1012231878 6:96769277-96769299 TGGCAGCCCCCAATCTCTTCTGG - Intergenic
1012474313 6:99603838-99603860 GGGCCGCCCCCTAACGCTGCCGG + Intergenic
1015440325 6:133240907-133240929 GGGCAGCCCCCGGAATTGCCTGG - Intronic
1018720665 6:166569521-166569543 GGGCCGCCCTGGAAATCTCCAGG + Intronic
1019356577 7:583031-583053 TGGCAGCCCCCGGACCCTCCTGG - Intronic
1019616642 7:1965946-1965968 GGGATGCCCCCCAACTCTCCAGG - Intronic
1019738413 7:2661432-2661454 GGGCAGCCCCCGAACTCTCCAGG - Intronic
1026478575 7:70759533-70759555 GGGAAGACCCCAACCTCTCCAGG - Intronic
1026829771 7:73603484-73603506 GGGCAGCCCCCACCCCCTCCCGG + Intronic
1029892034 7:103940611-103940633 GGCCAGCCCTGGAACTCTACTGG - Intronic
1049217078 8:141413161-141413183 AGGGAGGCCCTGAACTCTCCGGG + Intronic
1049265738 8:141666986-141667008 AGTCAGCCCCCGATCTCTCTGGG - Intergenic
1053753477 9:41279278-41279300 CGGCAGCCACCCAAATCTCCAGG - Intergenic
1054258999 9:62843641-62843663 CGGCAGCCACCCAAATCTCCAGG - Intergenic
1054332778 9:63776399-63776421 CGGCAGCCACCCAAATCTCCAGG + Intergenic
1056135087 9:83623228-83623250 GGGCGCCCCCCGCCCTCTCCCGG - Intronic
1060106003 9:120873936-120873958 GGGTAGCCCCCAACCTCCCCAGG - Intronic
1060202783 9:121661439-121661461 GAGCAGCCTCTGAACTCTCCTGG + Intronic
1060921756 9:127425190-127425212 GGCCTGCCCCCAAACTTTCCCGG - Intronic
1061873547 9:133533032-133533054 GCACAGTCCCCGAGCTCTCCTGG - Intronic
1062354791 9:136156874-136156896 TGGCCTCCCCCGAACTCACCAGG + Intergenic
1062362386 9:136193951-136193973 GGGACGACCCCGAACTCTCCGGG - Intergenic
1062385990 9:136311770-136311792 GCGCAGCCCCAGCACTCACCAGG + Intergenic
1062446931 9:136599043-136599065 GGGCAGGCCCGGGACACTCCTGG - Intergenic