ID: 1019738466

View in Genome Browser
Species Human (GRCh38)
Location 7:2661624-2661646
Sequence GCATCAGCAGGGCCCCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019738466 Original CRISPR GCATCAGCAGGGCCCCTGCA TGG (reversed) Intronic
900095692 1:939267-939289 GCAGCAGCAGCGCCTCTGCTGGG - Exonic
900156126 1:1203954-1203976 GCAGCAGCTGGGTCTCTGCAGGG + Exonic
900428685 1:2592126-2592148 GCAGCAGCAGGACCCCCACAGGG - Intronic
900816091 1:4847290-4847312 TCATCATCCTGGCCCCTGCAGGG - Intergenic
901129079 1:6950922-6950944 GCCTGAGCTGGGCTCCTGCAGGG + Intronic
901435591 1:9245566-9245588 GCATCAGCATGGAGCCTGCCAGG + Intronic
901459350 1:9382457-9382479 ACAGCAGCAGCTCCCCTGCAAGG - Intergenic
901878183 1:12179005-12179027 ACATCAGCAGGCCCCTTGGAGGG + Intronic
902845320 1:19105889-19105911 GCCTCACCAGGCCCCCAGCAGGG + Intronic
903690351 1:25168944-25168966 GCCTCAGCAGGGCCCCTTAGGGG + Intergenic
904338312 1:29812200-29812222 GGGGCAGCATGGCCCCTGCATGG + Intergenic
904852385 1:33468727-33468749 GCATCAGCAGGGGGTGTGCAGGG - Intergenic
904905637 1:33895545-33895567 GCAGCAGCAGGGCCACCCCACGG + Intronic
906046219 1:42832894-42832916 ACACCAGCAGGGCCTCTGCCAGG - Intronic
909718611 1:78739971-78739993 GCCTCAGTAGGGACTCTGCATGG - Intergenic
911983141 1:104590757-104590779 GCTTCATCAATGCCCCTGCAAGG - Intergenic
912856233 1:113170893-113170915 GCATCAGCAGCTCCTGTGCAAGG + Intergenic
918202674 1:182281815-182281837 GCATCATCAGCGCTCATGCAGGG + Intergenic
922956286 1:229603861-229603883 GAGACAGCAGGGCCACTGCAGGG + Intronic
923676540 1:236085331-236085353 GAATCAGCATGTGCCCTGCAAGG - Intergenic
924880146 1:248152267-248152289 GCATCAGCAGTGGCCCTGTAGGG + Intergenic
924883252 1:248186689-248186711 GCATCAGCAGTGGCCCTGTAGGG + Intergenic
1062966309 10:1610213-1610235 GCAGCCCCAGGGCCCCTACACGG + Intronic
1064738691 10:18410098-18410120 GCAGCTGCAGGGCCCTGGCAAGG - Intronic
1067879927 10:50034473-50034495 GGCTCAGCAGGGTTCCTGCAAGG - Intergenic
1067891957 10:50144907-50144929 GGCTCAGCAGGGTTCCTGCAAGG + Intergenic
1069753274 10:70758323-70758345 GCAACACCAGGGCCACTGAAAGG - Intronic
1069985567 10:72280639-72280661 TTCTCAGCTGGGCCCCTGCATGG - Intergenic
1070580569 10:77716077-77716099 GCATCAGCAGAGCCTCTACTGGG + Intergenic
1070758096 10:79005911-79005933 GTCCCAGCAGGGCCCCTGAAGGG - Intergenic
1070824499 10:79382879-79382901 CAATCAGCAGGGCCCCAGGAGGG - Exonic
1071803539 10:89091844-89091866 GTACCAGCAGAGCCTCTGCAGGG + Intergenic
1072691883 10:97577639-97577661 GCAAGAGCAGGGCCCCTGGAGGG - Intronic
1074533598 10:114313181-114313203 GCCTCACCAGGGTCCCTGCTGGG + Intronic
1076187754 10:128462198-128462220 GCATAAGCTGAGCTCCTGCAGGG + Intergenic
1077498304 11:2897315-2897337 GCACCACCAGGCCCCCCGCAGGG + Intronic
1078131324 11:8616572-8616594 GCATCTGCATGGCCCTCGCAGGG - Exonic
1080741013 11:35064333-35064355 AAATGAGCAGGGCCCCTGCTGGG + Intergenic
1083955055 11:65978418-65978440 GCCTCTGCTGGGGCCCTGCAGGG + Intronic
1084004532 11:66315966-66315988 GCATCAGCTGCAGCCCTGCAGGG - Exonic
1084562420 11:69912267-69912289 GCCCCAGCAGGGCCACAGCAGGG - Intergenic
1085202030 11:74707689-74707711 GCAGCAGCAGCCCCCCTGCACGG + Intronic
1085448012 11:76614352-76614374 TCTCCAGCAGGGACCCTGCATGG - Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1090788758 11:130070984-130071006 GCCACAGCAGGGCTCCTCCAAGG - Intronic
1090843058 11:130509241-130509263 GCACCACCAAGACCCCTGCAGGG - Intergenic
1092173583 12:6388390-6388412 GCATCAGCATGGTTCCTGCCAGG - Exonic
1094828049 12:34287353-34287375 GCCTTTGCAGAGCCCCTGCATGG + Intergenic
1095506667 12:42905874-42905896 CCATCAGCAGGGAACCTACAAGG + Intergenic
1103200829 12:119086626-119086648 GATGCAGCAGGGCCCCTTCATGG + Intronic
1103210694 12:119164253-119164275 GGATCTGCAGGAGCCCTGCAAGG + Intergenic
1104467104 12:128999554-128999576 GCCCCAGTGGGGCCCCTGCAGGG + Intergenic
1104780980 12:131420437-131420459 GCTTGAGCAGAGCCCCTGGACGG - Intergenic
1104784139 12:131438887-131438909 GCAGCAGCACAGCCCCTGCCAGG - Intergenic
1104849999 12:131868283-131868305 CCCTCAGCAGGGCCACAGCAGGG + Intergenic
1104850002 12:131868294-131868316 GCCACAGCAGGGCCACAGCAGGG + Intergenic
1104897574 12:132171827-132171849 GCAAGGGCAGGGGCCCTGCAGGG + Intergenic
1105708696 13:22984524-22984546 GCACCAGCAGCTCCCCTGCTTGG - Intergenic
1107420669 13:40243315-40243337 GCATCAGAAGGGCTGCAGCAAGG + Intergenic
1109152296 13:58860024-58860046 GCAACAGTCGGGACCCTGCAGGG - Intergenic
1110556720 13:76868471-76868493 ACAACAGCTGGGCCCCTGGATGG - Intergenic
1113040342 13:106098334-106098356 GAATGAGCAGGCCCCCTGAAAGG + Intergenic
1113848433 13:113404928-113404950 GCATCTGCAGGGACCCTGGGAGG - Intergenic
1114552806 14:23543612-23543634 GCATGGCCAGTGCCCCTGCATGG - Intronic
1115811640 14:37115426-37115448 ACATGAGGACGGCCCCTGCATGG + Intronic
1118471555 14:66079459-66079481 GCATCAGCAGGGGCGCAGGAGGG + Intergenic
1118731508 14:68670201-68670223 GCAACAGCAGGGCCCACGGACGG - Intronic
1121339546 14:93097089-93097111 GCACCAGCTGGGCACCTGCCAGG + Intronic
1122133302 14:99618633-99618655 GCATTGGCAGGGCCTCTGCCTGG + Intergenic
1122441015 14:101731812-101731834 GCAGCAGCCGCTCCCCTGCAAGG + Exonic
1122823725 14:104359681-104359703 GCACCATCTGGGCCTCTGCATGG - Intergenic
1123684536 15:22787345-22787367 GCACCAGCGAGGCCCCTGCGGGG - Intronic
1124593793 15:31077376-31077398 GCACCAGCAGGGCCTCCACAGGG - Intronic
1124636641 15:31369329-31369351 CCATCAGCAGGGCCTGTGCTGGG + Intronic
1128943385 15:71806416-71806438 GCATCCTCAGGGCCCTGGCAAGG - Intronic
1129872260 15:78948012-78948034 GCATCAGAAAAGCCCATGCATGG - Intronic
1130292353 15:82613988-82614010 GCATCAGCAAGGCCACTGCTTGG - Intronic
1132091907 15:98954060-98954082 GAATCAGCACGGCCCCAGCCCGG - Intronic
1132248369 15:100315236-100315258 GAAGCAGCAGTGCCCCTGCACGG - Intronic
1132568384 16:633498-633520 GCCCCGGCAGGGGCCCTGCACGG - Exonic
1132689541 16:1176424-1176446 GCAGCACCAGGGTCTCTGCATGG + Intronic
1132745209 16:1433591-1433613 GCCCCAGCAGAGCCCCTGGAGGG + Intergenic
1132892673 16:2211948-2211970 GCATCACCCGGGCCAATGCAAGG + Exonic
1134025680 16:10951253-10951275 GCATCTGCAGAGCTCCTGCTGGG + Intronic
1134814577 16:17195256-17195278 ACATCAGCAGTGCCACTGCTAGG + Intronic
1136395687 16:29991391-29991413 GCAGCAGCAGGGCTCCGCCACGG - Intronic
1136570210 16:31092348-31092370 GCTTCAACAGGTCCCCTCCAAGG + Intronic
1137632909 16:49960010-49960032 GCAGCAGCAGGGACTCTGAAGGG + Intergenic
1141429642 16:83965070-83965092 GCAACAGCCGGGCCACTGCCGGG + Exonic
1141463908 16:84194711-84194733 GCATCAGGACGTCACCTGCAGGG + Intronic
1141616652 16:85213706-85213728 GCATCAGGGGTGCCCTTGCAGGG + Intergenic
1141657221 16:85422692-85422714 GCACCTGCAGGGCCTCTGCCTGG - Intergenic
1142009799 16:87708060-87708082 GTATCAGAAGAGCCCCTGCCAGG - Exonic
1142172919 16:88632222-88632244 GCAGCTCCACGGCCCCTGCAGGG - Intergenic
1142265393 16:89062028-89062050 GGAGCAGCAGGGCCCCTGTGTGG - Intergenic
1142615934 17:1135129-1135151 GAAACAGCAGGGCCCCTGGAGGG + Intronic
1142979699 17:3664448-3664470 CCATCAGCAGGGCCGGTGCATGG - Intronic
1143164146 17:4889581-4889603 GCGTCAGCACTGCCCCTCCATGG - Intronic
1143721170 17:8810947-8810969 GCCCCAGCAGGGACTCTGCATGG + Intronic
1143731016 17:8882785-8882807 TAATCAGCAGGGCCCATGGATGG - Intronic
1146017395 17:29244978-29245000 GCCTCCGCAGGGGCCCTGAAGGG - Intergenic
1147953213 17:44118514-44118536 GCCTCAGCAGGGCTACTGCTGGG - Intronic
1148896179 17:50840457-50840479 GGCTTTGCAGGGCCCCTGCAGGG - Exonic
1149313755 17:55421077-55421099 GAACCAGCAAGGCCCCTACACGG + Intronic
1150135956 17:62695226-62695248 GCAACAGCAGGACCCATGGAAGG + Intergenic
1151353080 17:73543018-73543040 GCATAGGCAGGTCCCCTCCAGGG + Intronic
1152517233 17:80832686-80832708 GCATCACCGGGGGCTCTGCAGGG + Intronic
1152538679 17:80964078-80964100 TCCTCTGCAGGGCCCATGCATGG - Intronic
1153950886 18:10056764-10056786 GCATCAGCAGGGCCTGAGCCCGG + Intergenic
1155493558 18:26422119-26422141 GCTTGTCCAGGGCCCCTGCAGGG - Intergenic
1156459959 18:37316109-37316131 GCATGAGCAAGACCCCAGCATGG + Intronic
1157393170 18:47319996-47320018 GCATTAGCCTGGCTCCTGCAAGG + Intergenic
1157600505 18:48890256-48890278 GACACAGCAGGGCCCCAGCAGGG - Intergenic
1158069734 18:53456683-53456705 GCATCAGCACTGCCACTGCCTGG - Intronic
1160480829 18:79238414-79238436 GCATGTGCAGGGCCCCTGCCTGG + Intronic
1160741265 19:687143-687165 GCCTCAGCAGCCCCACTGCAGGG + Exonic
1160912645 19:1481974-1481996 CCAGCAGCAGGGCTCCTGCATGG - Exonic
1161138199 19:2633115-2633137 CCACCTGCAGGGCCCCTGCCAGG - Intronic
1162398719 19:10432204-10432226 GACTCCGCAGGACCCCTGCAGGG + Intronic
1164204660 19:23048140-23048162 CCCTTAGCAGGGCCCATGCAGGG - Intergenic
1165481561 19:36067556-36067578 GCAGCAGCTGGGCCCCTGAGAGG - Intronic
1166538795 19:43592517-43592539 CCAGCAGCAGTGCCCCTGCCTGG + Exonic
1168413602 19:56155395-56155417 GCATCAGCTCGGCCTCTGCCAGG - Intronic
1168639300 19:58020170-58020192 GCATCAGCTGCACCACTGCATGG + Intergenic
1168642396 19:58038907-58038929 TCCCCAGCAGGGCCCCAGCAAGG + Intronic
928181657 2:29072492-29072514 GCAGCAGGAGGGCCCCTGAGAGG - Exonic
932579971 2:72986765-72986787 GCATCTCCAGGGCCCCAGCCTGG + Intronic
933230577 2:79802465-79802487 GGATCATCAGGGCCCCAGGAAGG - Intronic
934948472 2:98559507-98559529 GCATCAGCAGGAGCCTTGAACGG - Intronic
935707278 2:105868100-105868122 GCATCTGTAGGGCTCCTGCATGG + Intronic
935707574 2:105870200-105870222 GCACCTGTAGGGCCCCTGCTTGG - Intronic
937966423 2:127514923-127514945 GGGTCAGCAGTGCCCCTGCTTGG - Intronic
938289955 2:130143831-130143853 GCTTCAGGAGGGCTCCAGCAAGG - Intronic
938466568 2:131529106-131529128 GCTTCAGGAGGGCTCCAGCAAGG + Intronic
943025236 2:182619854-182619876 GCAGCACAAGGGCCCTTGCAAGG - Intergenic
943441353 2:187931837-187931859 GAATCACCAGGGCTCCTGGAGGG + Intergenic
947324464 2:228959388-228959410 GCATCAGCAGGGCTGAAGCATGG - Intronic
947638737 2:231694134-231694156 GCCTCTGCACGGCCCCTCCATGG - Intergenic
947860999 2:233357175-233357197 GCAGCAGCTGTGCCCTTGCAAGG - Intronic
948575947 2:238949801-238949823 GCATCAGTTGGGCCCCTGGAAGG + Intergenic
1170609874 20:17903804-17903826 AGATTAGCATGGCCCCTGCAAGG + Intergenic
1170779268 20:19409251-19409273 GCAGGAGCAGAGGCCCTGCAGGG + Intronic
1171021333 20:21586842-21586864 GCTTGGGCAGGGCACCTGCAGGG + Intergenic
1171980004 20:31621056-31621078 TCAACATCAGGGCCTCTGCAAGG + Intergenic
1172351954 20:34250033-34250055 GTATCAGCTGGACCCCAGCATGG - Intronic
1172414119 20:34750226-34750248 GCATAAGCTGGGCCCTTGAAAGG + Exonic
1173463456 20:43262370-43262392 GCAACACCAGTGCCCGTGCAAGG + Intergenic
1174278995 20:49424871-49424893 ACAGGAGCAGGCCCCCTGCACGG + Intronic
1175281553 20:57807183-57807205 GCCTCAGCATGGACCCAGCAAGG - Intergenic
1175881768 20:62263358-62263380 ACAACAGCAGGGCCACTGCGGGG + Intronic
1175916572 20:62428644-62428666 CCACCAGCAGGGGCCCTGCCAGG - Intergenic
1175949420 20:62575303-62575325 GCATGAGGAGGGCCCCTCCAGGG + Intergenic
1176119328 20:63446929-63446951 GCCGCAGCAGGGCACCAGCATGG + Intronic
1176690719 21:9904954-9904976 GCATCTGCTGGGCTTCTGCAGGG + Intergenic
1176722811 21:10405559-10405581 GCATTAGCAGCGCCCTTGCACGG + Intergenic
1178846370 21:36177178-36177200 ACATCATCAGAGCCCCAGCATGG - Intronic
1179013543 21:37574972-37574994 GCATCTGCAGGGGTCCTGCTGGG - Intergenic
1179148033 21:38786059-38786081 GAATCTGCAGCGCCCCTGCCTGG - Intergenic
1179721966 21:43321291-43321313 GCATCAGAAGGGCCCCTGGGAGG - Intergenic
1180303978 22:11058301-11058323 GCATTAGCAGCGCCCCTGCACGG + Intergenic
1181014511 22:20061486-20061508 GGCACAGCAGGGCCTCTGCATGG + Intronic
1181473691 22:23156067-23156089 GCAGCAGCGGGGTCCCTGCCGGG + Intronic
1181578944 22:23816270-23816292 GCAGCAGCAGGGCCTCAACAAGG - Intronic
1182396051 22:30036604-30036626 GCATCAGCAGGGCCCTCTGAGGG - Intergenic
1182503821 22:30767848-30767870 GCCTCATCACGGGCCCTGCAGGG + Intronic
1183732167 22:39624587-39624609 GTATCTGCAGGGCCCTTCCAGGG - Intronic
1184091801 22:42296732-42296754 GCATCAGCAGGGCCCCCTTGTGG - Intronic
1184562683 22:45272565-45272587 CCACCAGCACGGCCCCAGCAGGG - Intergenic
1184599005 22:45531744-45531766 GCCTCACCAGGGCCCCTCCTTGG - Intronic
1185003817 22:48263439-48263461 GCATCAGCTGGGCCGCAGGATGG + Intergenic
1185091618 22:48778756-48778778 CCAGGAGCAGGGCCACTGCACGG + Intronic
949356141 3:3182507-3182529 GCATTATAAGGGCCACTGCAAGG - Intergenic
953886604 3:46717743-46717765 GCAGCAGCAGGGCACCGGCGCGG + Exonic
954121545 3:48503108-48503130 TCATCAGCATGGCCCGTGCCTGG + Intronic
956460603 3:69467818-69467840 GCAGCAGAAGGTCCCCTGCTAGG - Intronic
962241769 3:133756244-133756266 ACATCAGCAGGGCTCCTGCAGGG - Intronic
962846646 3:139279462-139279484 TCATCAGCAGGGCCACCCCATGG - Intronic
964558232 3:157964352-157964374 TCATCAGCATGGCTGCTGCAGGG + Intergenic
964979474 3:162661501-162661523 GCATCAGCTGGACCACTGGAGGG + Intergenic
966557718 3:181282697-181282719 CCATCATCAGAGCCCCTGGATGG + Intergenic
968486352 4:864855-864877 GCATCAGCAGCACCCCCGAAGGG - Intronic
968910153 4:3473398-3473420 GCATCAGCAGGCAGTCTGCAAGG - Exonic
969032494 4:4226164-4226186 GGGTCAGTAGGGCCACTGCATGG + Intronic
977291384 4:95168565-95168587 GCACCAGAAGGGTCCCTCCAAGG + Exonic
980467601 4:133205065-133205087 GGATAAGCAGGGCCTGTGCATGG + Intronic
984582574 4:181527029-181527051 GCTTCAGCAGGGTGGCTGCAAGG - Intergenic
985873514 5:2577682-2577704 GCATCAGCAGAGGCCCCTCAAGG - Intergenic
985876921 5:2606961-2606983 GCAGCACCAGGGACCCTGCAGGG + Intergenic
985904646 5:2823740-2823762 GGGTCAGCAGAGCCACTGCACGG - Intergenic
988724198 5:33909531-33909553 ACATCAGCAGTGTGCCTGCAGGG + Intergenic
989606151 5:43246163-43246185 ACCTCAGCAGAGCCCCTGCAAGG + Intronic
992325226 5:75653935-75653957 GGAGGAGCTGGGCCCCTGCAAGG + Intronic
995076249 5:107987582-107987604 GCATGAGCAGGGCTCATGCCAGG - Intronic
995798129 5:115962653-115962675 CCAGCAGCAGGGCCACTGCGCGG - Exonic
1001989418 5:176104003-176104025 ACATGAGCAGGCCCCTTGCACGG - Intronic
1002227454 5:177734135-177734157 ACATGAGCAGGCCCCTTGCACGG + Intronic
1002571140 5:180140008-180140030 CCTTCAGAAAGGCCCCTGCATGG - Intronic
1004300149 6:14450236-14450258 GCATCAACACGCTCCCTGCAGGG + Intergenic
1005860808 6:29898503-29898525 GCAGCAGTAGGACCCCTGCCAGG + Intergenic
1006305566 6:33216240-33216262 GCATCACCAGGGCCACATCAGGG + Intergenic
1007601951 6:43087700-43087722 GCCTCAGCAAGGGCCCTCCAAGG - Intronic
1008196253 6:48524968-48524990 GCATCAGCTGGGTGGCTGCAAGG + Intergenic
1008232211 6:48996680-48996702 GCAGCAGGAGAGTCCCTGCAAGG + Intergenic
1012341690 6:98133447-98133469 GCATCCTCAGGTACCCTGCAGGG + Intergenic
1014291745 6:119566166-119566188 GGCTCAGCAGGGCCCTGGCATGG + Intergenic
1019104732 6:169659111-169659133 GGCTCAGCAGTGCCCCAGCATGG - Exonic
1019327187 7:444254-444276 TCCCCAGCAGAGCCCCTGCAGGG - Intergenic
1019592491 7:1842719-1842741 TCCTCACCTGGGCCCCTGCAAGG + Intronic
1019620354 7:1988760-1988782 GCACACGCAGGGCCCCTGGAAGG - Intronic
1019738466 7:2661624-2661646 GCATCAGCAGGGCCCCTGCATGG - Intronic
1019921798 7:4167950-4167972 GCATCAGCAGGGCGGCTCCATGG - Intronic
1021762291 7:23913584-23913606 GCCTCAGCAGGGACTCTGTATGG - Intergenic
1022190844 7:28015818-28015840 GCATGGGCAGGTCCCCTTCATGG - Intronic
1023609124 7:41956509-41956531 GCATGAGCAGAGCCCCAGGACGG + Intergenic
1026149093 7:67772936-67772958 GCATCAGATGGGACCCTGCCTGG - Intergenic
1028694431 7:93692471-93692493 GCTTCAACAGGGGCTCTGCATGG - Intronic
1029187167 7:98747524-98747546 GCATCTGCAGGGCTCCTTCAAGG + Intergenic
1029737331 7:102472130-102472152 GCATCTGCAGCGCACCTGCTGGG - Intronic
1034501034 7:151451301-151451323 GCACCAGCTGGGCCTCAGCAGGG + Intergenic
1034533520 7:151712451-151712473 GCCAGAGCAAGGCCCCTGCAGGG - Intronic
1034894576 7:154868164-154868186 TCAGCAGCAGGTGCCCTGCAAGG + Intronic
1036295109 8:7528889-7528911 GCATCAGCAGGGCTCTGGGAGGG - Intergenic
1036327454 8:7792102-7792124 GCATCAGCAGGGCTCTGGGAGGG + Intergenic
1036507454 8:9368482-9368504 GCATTAGAAGGGCCCTTCCAAGG + Intergenic
1036705538 8:11043534-11043556 GCAGCTGCAGAGCCCCTGGAGGG + Intronic
1038125550 8:24669123-24669145 GCCTCAGCAGAGCCCGTGAATGG - Intergenic
1039493803 8:37966334-37966356 GCGCCAGCAGGGCCCCGGCTAGG + Exonic
1044436540 8:92170933-92170955 GCAGCAGCAGGGAGGCTGCAAGG + Intergenic
1047619027 8:126587542-126587564 GGATCAGCAGGAGCCATGCACGG - Intergenic
1049104834 8:140605629-140605651 TCATCAGCTGGGTCCCAGCATGG - Intronic
1049665939 8:143842618-143842640 GCATCAGCCTGACCTCTGCAGGG + Intergenic
1049783328 8:144438923-144438945 GCAGGAGCAGGGTCCCAGCAGGG - Intronic
1051029709 9:12658938-12658960 GCATGATCAGGGGCCCTGGAAGG - Intergenic
1054983552 9:71235136-71235158 GCATTAGCAAAGGCCCTGCAGGG - Intronic
1055422749 9:76161299-76161321 CCCTCAGCAGGCCGCCTGCAGGG + Intronic
1056219651 9:84438412-84438434 GCAGCAGCAGGGCCCAAGAAAGG - Intergenic
1056752835 9:89364353-89364375 CCATCACCAGGGCCACAGCATGG + Intronic
1060202982 9:121662889-121662911 GCATCTGCAGGGCCCATTCCAGG - Intronic
1061036006 9:128114734-128114756 GCGTGAGCAGTGCCCCTGCGAGG - Intergenic
1061243110 9:129385807-129385829 GTATCAGCTGGGCCCATTCAGGG + Intergenic
1061333948 9:129916935-129916957 GCATCAGCAGACACCCTCCACGG - Intronic
1061757735 9:132827087-132827109 GCGCCCACAGGGCCCCTGCATGG - Intronic
1062188433 9:135231095-135231117 GCATGAGGGGGGCTCCTGCAGGG - Intergenic
1062265128 9:135683476-135683498 GGGACAGCAGGCCCCCTGCAGGG + Intergenic
1185632812 X:1527929-1527951 GAATGAGCAGGGTCCCTGTAGGG - Intronic
1186500814 X:10049001-10049023 GAATGTGCAGGGCCACTGCACGG - Intronic
1187733435 X:22279866-22279888 GTCTCAGCTGGGCTCCTGCATGG - Intergenic
1190879693 X:54483530-54483552 GCTTCCCCATGGCCCCTGCAGGG - Intronic
1193801925 X:85946721-85946743 GCCTCAGTAGGGACTCTGCATGG - Intronic
1195557689 X:106245880-106245902 GCATCAGCAGGGCCCAGCCAGGG - Intergenic
1196541331 X:116911917-116911939 GCATCAGCAGATCCACTGCTAGG - Intergenic
1199975605 X:152893408-152893430 GCAGCAGCAGGGCCCCTGGGGGG + Intergenic
1200121632 X:153793947-153793969 GCCTCAGAAGGGCTCCTTCAAGG + Exonic
1200234020 X:154459644-154459666 GCACCACCATGTCCCCTGCAGGG - Intronic
1201721937 Y:17108727-17108749 GCCTCACCAGGGGCCCTGCTTGG + Intergenic