ID: 1019739521

View in Genome Browser
Species Human (GRCh38)
Location 7:2665795-2665817
Sequence GGCTCAGGAAGAGCTCGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019739521_1019739536 24 Left 1019739521 7:2665795-2665817 CCGGGCCGAGCTCTTCCTGAGCC No data
Right 1019739536 7:2665842-2665864 TTCCAGAAGCAGCATGGAGGCGG No data
1019739521_1019739533 18 Left 1019739521 7:2665795-2665817 CCGGGCCGAGCTCTTCCTGAGCC No data
Right 1019739533 7:2665836-2665858 CCGTCCTTCCAGAAGCAGCATGG No data
1019739521_1019739537 25 Left 1019739521 7:2665795-2665817 CCGGGCCGAGCTCTTCCTGAGCC No data
Right 1019739537 7:2665843-2665865 TCCAGAAGCAGCATGGAGGCGGG No data
1019739521_1019739534 21 Left 1019739521 7:2665795-2665817 CCGGGCCGAGCTCTTCCTGAGCC No data
Right 1019739534 7:2665839-2665861 TCCTTCCAGAAGCAGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019739521 Original CRISPR GGCTCAGGAAGAGCTCGGCC CGG (reversed) Intergenic
No off target data available for this crispr