ID: 1019742180

View in Genome Browser
Species Human (GRCh38)
Location 7:2680440-2680462
Sequence GCCCAGACATGCAGCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019742173_1019742180 14 Left 1019742173 7:2680403-2680425 CCCGGATCCTGCAGGGCTTCTCC 0: 1
1: 0
2: 2
3: 26
4: 305
Right 1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG No data
1019742172_1019742180 15 Left 1019742172 7:2680402-2680424 CCCCGGATCCTGCAGGGCTTCTC 0: 1
1: 0
2: 1
3: 12
4: 147
Right 1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG No data
1019742168_1019742180 24 Left 1019742168 7:2680393-2680415 CCCGGGAGACCCCGGATCCTGCA 0: 1
1: 0
2: 0
3: 8
4: 161
Right 1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG No data
1019742174_1019742180 13 Left 1019742174 7:2680404-2680426 CCGGATCCTGCAGGGCTTCTCCA 0: 1
1: 1
2: 1
3: 26
4: 207
Right 1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG No data
1019742178_1019742180 -7 Left 1019742178 7:2680424-2680446 CCAGGTGTTTCCAGGAGCCCAGA 0: 1
1: 0
2: 2
3: 33
4: 270
Right 1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG No data
1019742169_1019742180 23 Left 1019742169 7:2680394-2680416 CCGGGAGACCCCGGATCCTGCAG 0: 1
1: 0
2: 3
3: 15
4: 207
Right 1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG No data
1019742176_1019742180 7 Left 1019742176 7:2680410-2680432 CCTGCAGGGCTTCTCCAGGTGTT 0: 1
1: 0
2: 0
3: 18
4: 202
Right 1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG No data
1019742167_1019742180 25 Left 1019742167 7:2680392-2680414 CCCCGGGAGACCCCGGATCCTGC 0: 1
1: 0
2: 2
3: 12
4: 110
Right 1019742180 7:2680440-2680462 GCCCAGACATGCAGCCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019742180 Original CRISPR GCCCAGACATGCAGCCGCCC TGG Intronic
No off target data available for this crispr