ID: 1019742562

View in Genome Browser
Species Human (GRCh38)
Location 7:2682140-2682162
Sequence CAGGCTGGGCACAGGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1169
Summary {0: 1, 1: 0, 2: 13, 3: 140, 4: 1015}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019742554_1019742562 1 Left 1019742554 7:2682116-2682138 CCAGAAGCTCAAAGGGCGGCCTC 0: 1
1: 0
2: 0
3: 11
4: 88
Right 1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG 0: 1
1: 0
2: 13
3: 140
4: 1015
1019742550_1019742562 18 Left 1019742550 7:2682099-2682121 CCGACGTGAATACTAATCCAGAA 0: 1
1: 0
2: 0
3: 7
4: 66
Right 1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG 0: 1
1: 0
2: 13
3: 140
4: 1015
1019742549_1019742562 19 Left 1019742549 7:2682098-2682120 CCCGACGTGAATACTAATCCAGA 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG 0: 1
1: 0
2: 13
3: 140
4: 1015

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019742562 Original CRISPR CAGGCTGGGCACAGGGAGGC TGG Intronic
900156386 1:1204914-1204936 CAGGCTGGGCACATGAGAGCTGG - Intronic
900167075 1:1248105-1248127 GAGGCTGGACTGAGGGAGGCTGG + Intergenic
900167092 1:1248171-1248193 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167158 1:1248368-1248390 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167176 1:1248434-1248456 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167218 1:1248566-1248588 GAGGCTGGACCAAGGGAGGCTGG + Intergenic
900167236 1:1248632-1248654 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167301 1:1248830-1248852 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167389 1:1249094-1249116 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167413 1:1249160-1249182 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167437 1:1249226-1249248 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167461 1:1249292-1249314 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167485 1:1249358-1249380 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167509 1:1249424-1249446 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167533 1:1249490-1249512 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900167557 1:1249556-1249578 GAGGCTGGACCGAGGGAGGCTGG + Intergenic
900242357 1:1623241-1623263 CAGTCTGGCACCAGGGAGGCCGG - Intronic
900367525 1:2317360-2317382 CAGGAGGGGCACAGGGAGGTAGG + Intergenic
900367533 1:2317379-2317401 TAGGAGGGGCACAGGGAGGTGGG + Intergenic
900370339 1:2329432-2329454 CAGGGAGGGCACTGGGAAGCTGG - Intronic
900478239 1:2886181-2886203 CAGGCTGGGGACAGGGCTCCAGG + Intergenic
900507337 1:3036329-3036351 CTGGCTGGGCACATGGAGTGAGG + Intergenic
900520940 1:3105242-3105264 AAGTTTGGGCCCAGGGAGGCTGG - Intronic
900599993 1:3498823-3498845 CAGGCTGGGGCCAGGGAAGAGGG + Exonic
900650945 1:3729846-3729868 ATGGTTGGGGACAGGGAGGCTGG + Intronic
900823970 1:4911582-4911604 CAAGCAGGGCCCAGGGAGGCAGG + Intergenic
900854074 1:5166726-5166748 CAGCCTGGGCACAGGTCGTCAGG - Intergenic
900860194 1:5223394-5223416 CTGGCAGGACACAGGGAGGGAGG + Intergenic
901001958 1:6153317-6153339 CAGGCTGGGCAGACAGGGGCGGG + Intronic
901049054 1:6417141-6417163 CCCTCTGGGCACAGGGAGGTGGG + Exonic
901052010 1:6429998-6430020 CAGGCTGGGCTCACGCAGGAGGG + Intronic
901127443 1:6939569-6939591 CAGGCTGGAGACAGAGAGGACGG - Intronic
901490621 1:9594659-9594681 GAGGCTGGGCCCTGGGAAGCAGG - Intronic
901667569 1:10835369-10835391 GAGGCCGGGCAAGGGGAGGCGGG + Intergenic
901780942 1:11594120-11594142 CAGGCTGGGAGCAGGGAACCAGG + Intergenic
901807604 1:11748222-11748244 CAGTCTGGGGGCAGGGATGCCGG - Intronic
901843043 1:11965601-11965623 CAGGGTGGGCACATAGGGGCTGG + Intronic
901872267 1:12145059-12145081 AAAGCTGTGCCCAGGGAGGCAGG - Intergenic
901877455 1:12175096-12175118 CGGGCTGTGGACAGGGAGGGGGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902232397 1:15036302-15036324 CAGGCTAGGCAGAGGGAGCTGGG - Intronic
902232407 1:15036330-15036352 CAGGCAGGGCAGGGGGAGCCGGG - Intronic
902408272 1:16198434-16198456 CAGGCTGGACACAGGAATGGGGG - Exonic
902639408 1:17756975-17756997 CAGGCCGGGCACAGGCATGGTGG + Intronic
902681619 1:18047762-18047784 CAGGGTGCCCACATGGAGGCAGG - Intergenic
902704648 1:18196200-18196222 GAGGCTGGAGGCAGGGAGGCCGG + Intronic
902834630 1:19038624-19038646 TGGGCGGGGGACAGGGAGGCTGG - Intergenic
903367593 1:22814720-22814742 GAGGTAGGGCCCAGGGAGGCGGG + Intronic
903540253 1:24092720-24092742 CTGGCTGGAGCCAGGGAGGCTGG - Intronic
903541033 1:24096448-24096470 ACGGGTGGGCAGAGGGAGGCAGG + Intronic
903670411 1:25031992-25032014 TAGGATGGGCAGTGGGAGGCTGG + Intergenic
904335962 1:29798281-29798303 CAGGCTGGGGAAGAGGAGGCAGG - Intergenic
904391799 1:30190907-30190929 CAGGATGGGCACCAGGAGGCAGG + Intergenic
904921866 1:34014214-34014236 CAGAGTGGGAACAGGGAGACTGG - Intronic
905202086 1:36322345-36322367 CCTGCTGGGCACAGGCACGCTGG - Exonic
905268519 1:36771443-36771465 CAGGCTGGGGGCGTGGAGGCTGG - Intergenic
905328303 1:37174132-37174154 GAGGCTGGGGACTGGCAGGCAGG + Intergenic
905518120 1:38577408-38577430 CAGGCTGGGGTCAAGGAGGTAGG - Intergenic
905651039 1:39657164-39657186 GAGGCTGGTCCCAGGGAGGAAGG - Intergenic
905688999 1:39928953-39928975 CTGGCTGGGCACAGGGTGCCTGG - Intergenic
905882623 1:41474657-41474679 CAGGCTGGGAACTGGGGGACGGG - Intergenic
906201711 1:43964707-43964729 CAGGCTGGGGGCACTGAGGCAGG - Intronic
906399821 1:45496676-45496698 CAGGCTGGTCACAGGCAGGGAGG - Intronic
906525393 1:46490519-46490541 CAGGCTGGGAACTGGGCTGCCGG - Intergenic
906671977 1:47662713-47662735 CAGGGTAGGCAGAGTGAGGCTGG - Intergenic
906689684 1:47784414-47784436 GGGGCTGGGCAGAGGGAGGAGGG + Intronic
906692557 1:47802185-47802207 CTGGCTGGGCACAGGCACGGTGG - Intronic
907304387 1:53505684-53505706 CAGGGTGGGCACAGGGCTTCTGG + Intergenic
907305934 1:53513228-53513250 CAGGCTGGGGAGGGGGAGCCCGG - Intronic
907405605 1:54251761-54251783 CAGGGTGGGCCTAGGGTGGCTGG - Intronic
907441573 1:54481754-54481776 CAGGCTGGGCAGAGACAGGGTGG + Intergenic
907919049 1:58895994-58896016 CAGGATGGGCACAGGGCTGGGGG + Intergenic
909036970 1:70604408-70604430 CAGTCAGGGCACAGGGATGGTGG - Intergenic
910374318 1:86552524-86552546 AAGGCTGGGCAGCGGGCGGCAGG + Intronic
911195470 1:94990209-94990231 CAGTCAGGGGACAGGAAGGCCGG + Intronic
912386144 1:109272205-109272227 CAGGCTGGGAAGAAGGAGGGTGG - Intronic
912490150 1:110058237-110058259 CAGGCAGGGGACAGGCTGGCTGG + Intronic
912559066 1:110537376-110537398 GAGGCTGGGCACAGGTAGCAAGG + Intergenic
913535576 1:119768947-119768969 GAGGCGGGGCTTAGGGAGGCAGG - Intergenic
915512085 1:156392000-156392022 CAGGCAGGGGACAGCGAAGCAGG - Intergenic
915943733 1:160135323-160135345 CAGGCAGGGACCGGGGAGGCAGG + Intronic
916007775 1:160677725-160677747 CAGGCTGGGCTCAGGGTGGGGGG + Intergenic
916344749 1:163775276-163775298 GGGGCTGGGGAGAGGGAGGCTGG + Intergenic
916572289 1:166038452-166038474 TAATCTGGACACAGGGAGGCAGG + Intergenic
916742443 1:167658181-167658203 GAGGCTGGACACAGGGAGGGGGG - Intronic
916983282 1:170163043-170163065 CAAGCTGACCACAGGGATGCTGG + Intronic
918298703 1:183182649-183182671 CAGGCTGGGCACAGTGGTTCAGG + Intergenic
918918199 1:190671584-190671606 CAGGCTGGGAAAGAGGAGGCAGG + Intergenic
919148448 1:193664317-193664339 CAGACATGGCACAGGGATGCAGG + Intergenic
919814304 1:201428064-201428086 CAGGTTTGGCAGAGGGTGGCGGG - Intronic
919814878 1:201431081-201431103 CAGGCTGGGCACAGGGTGGAGGG - Intergenic
919925234 1:202188685-202188707 CAGCCTGGGCCCAGGGAGGGAGG - Intergenic
920195847 1:204226565-204226587 CAGTCTGGCCACAAGGAAGCAGG - Intronic
920347725 1:205317450-205317472 CAGGCTGGGCAGAGTGGGGGTGG + Intronic
920381526 1:205537171-205537193 CAGGAAGGGCCCAGGGATGCAGG - Intergenic
920500940 1:206485136-206485158 CAGCCTGGGCACTGGTGGGCAGG - Intronic
920703063 1:208232232-208232254 CCGGCTGGGGAGAGGGAGACTGG - Intronic
920852225 1:209635864-209635886 GAGGCAGGGCCCAGGGAGCCTGG - Intronic
920927300 1:210354035-210354057 CAGGCTGTTCTCAGGAAGGCTGG + Intronic
921024072 1:211260635-211260657 CCGGCTGCGCACAGGTCGGCAGG - Intronic
921940180 1:220830938-220830960 CAAGCTGGAGAGAGGGAGGCTGG - Intergenic
922169897 1:223145144-223145166 GAGGCTGGGGACTGGGAGGTTGG - Intergenic
922333656 1:224600656-224600678 GGGGCTGGGCACAGAGGGGCAGG - Intronic
922698402 1:227743445-227743467 GAGGCGGGGCTCAGGGAGGCTGG - Intronic
922826927 1:228528143-228528165 CAGCCTGGGCACAGTGGTGCTGG + Intergenic
923055937 1:230426044-230426066 CCGGCCGGGCACGGGGCGGCGGG - Intergenic
923087764 1:230714179-230714201 CAGCCTGTGCACAGGCAGCCTGG - Exonic
923190093 1:231611927-231611949 CCAGCTGGGCACAGGGAGCTGGG + Intronic
923211657 1:231808918-231808940 CAGGGAGGGCACAGAGAGTCGGG + Intronic
923296676 1:232601142-232601164 CAGGCTGGGCCCTGGGACACAGG + Intergenic
924624746 1:245688812-245688834 GCGGCTGGGCGCAGGGACGCGGG + Intronic
1062995201 10:1859061-1859083 CAGTCAGGGCACAGAGGGGCGGG + Intergenic
1063115438 10:3068590-3068612 GAGGCTGGGCCCACGGACGCGGG + Intronic
1063173640 10:3532703-3532725 CAGGGTGGGGACAGGCAGGTGGG - Intergenic
1063193493 10:3719044-3719066 CTGGTTGGGTTCAGGGAGGCTGG + Intergenic
1063331408 10:5163466-5163488 CACACTGGTCACAGGGAGGTAGG - Intergenic
1063428598 10:5968335-5968357 CAGGCTGGGGGCAGGGTGGGAGG + Intronic
1063877967 10:10499596-10499618 CTGGCTGGGCACAGTGACTCAGG + Intergenic
1063883551 10:10554601-10554623 CAGGGTCACCACAGGGAGGCTGG - Intergenic
1064140969 10:12790032-12790054 CAGGCCAGGAACAGGGAGTCAGG + Intronic
1064230936 10:13528927-13528949 CAGGCTGAGCCCAGGCGGGCCGG - Intronic
1064240203 10:13620561-13620583 CAGGCTGGGAACAGGCATGAAGG - Intronic
1065111207 10:22441850-22441872 CAGGCGGGGGTCAGGGAGGATGG + Intronic
1066261882 10:33737315-33737337 CAGGCTGGGCACAGTGTCTCAGG + Intergenic
1066656348 10:37702229-37702251 CTGGCTGAGGACAGGGAGGAGGG - Intergenic
1066659947 10:37728824-37728846 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1066758874 10:38736648-38736670 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1067044587 10:42977197-42977219 AATGCTGGGCACAGGCAGGCAGG + Intergenic
1067046573 10:42988628-42988650 CAGGCTGGGCCCAGGGTGGATGG - Intergenic
1067182250 10:43997148-43997170 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
1067466583 10:46503575-46503597 CAGGATGGGCAGAGGCTGGCAGG - Intergenic
1067497941 10:46775700-46775722 CACGCTGGGCACGAGCAGGCAGG + Intergenic
1067596707 10:47564714-47564736 CACGCTGGGCACGAGCAGGCAGG - Intergenic
1067620605 10:47881030-47881052 CAGGATGGGCAGAGGCTGGCAGG + Intergenic
1067686983 10:48471618-48471640 CTGGCTGGGCATCTGGAGGCTGG - Intronic
1067738494 10:48877756-48877778 CAGGCTGGGGACCAGGTGGCAGG + Intronic
1067783135 10:49223451-49223473 GAGGCTGGAGACAGGGTGGCTGG + Intergenic
1067790282 10:49282680-49282702 CAGCCTGGACCCAGAGAGGCAGG + Intergenic
1067804564 10:49384059-49384081 CGGGTTGGGCAGAGGCAGGCTGG - Intronic
1067829940 10:49605779-49605801 CAGGCTGGCCAAGGGCAGGCAGG + Intergenic
1069160309 10:65084413-65084435 CAGGCTGGCCACAAGGCTGCAGG + Intergenic
1069605738 10:69737597-69737619 CAGGCTGGGCACAGGGTGGGCGG - Intergenic
1069744462 10:70706336-70706358 CAGGCCTGTCACAGGAAGGCTGG - Intronic
1069903313 10:71718306-71718328 TTGGCTGGGCGCAGGGAGCCAGG - Intronic
1070140051 10:73732276-73732298 CACGCTAGGCACGGGCAGGCAGG - Intergenic
1070248397 10:74752690-74752712 CAGGATGGGCAGTGGGAGGCTGG - Intergenic
1070341082 10:75499027-75499049 CAGGCTGGGAACCTGGAGGCAGG + Intronic
1070812602 10:79305876-79305898 GTGGCTGGGCACAGGGCAGCTGG - Intronic
1071229174 10:83564955-83564977 CAGGCTCGGCTCAGGGCAGCGGG + Intergenic
1071288706 10:84172732-84172754 CAGACTGGCAAAAGGGAGGCCGG - Intergenic
1071482931 10:86078697-86078719 CTGGCTGGGCAATGGGAGCCAGG + Intronic
1071503489 10:86219435-86219457 TAGGCTGGGCAGAGTGAGGGAGG - Intronic
1072437960 10:95430831-95430853 AGGGCTGGGCTCAGGGATGCAGG + Intronic
1072735369 10:97875603-97875625 GGCCCTGGGCACAGGGAGGCAGG + Intronic
1072788646 10:98301897-98301919 CAGGGAGGTCACTGGGAGGCCGG + Intergenic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1072810215 10:98455771-98455793 CTGGCTGGGCACAGAGTGGCTGG + Intergenic
1073125341 10:101145837-101145859 CGGCCTGGGCACAGTGAGGCTGG - Intergenic
1073489677 10:103844662-103844684 CAGGCTGGGGAAGGGGAGGGAGG + Intronic
1073490700 10:103851346-103851368 CAGGCGGGTCACTGTGAGGCAGG - Intronic
1074867802 10:117555049-117555071 GAGGCTGGGGACACTGAGGCGGG + Intergenic
1075399474 10:122150631-122150653 GAGGCAGGGCCCAGGGAGGTGGG + Intronic
1075636978 10:124035975-124035997 CTGTCTGGGCACAGAGAGGTGGG - Intronic
1075658272 10:124175808-124175830 CAGGCTGGGGGAGGGGAGGCTGG - Intergenic
1075724271 10:124603623-124603645 CAGGTTGGGCAAGGGGAGGGCGG + Intronic
1075873172 10:125785967-125785989 CAGGAAGGACACAAGGAGGCTGG + Intronic
1075969151 10:126638151-126638173 TAGACTGGGCCTAGGGAGGCAGG - Intronic
1076040310 10:127241887-127241909 CATGCTGGGCATAGGCAGACTGG + Intronic
1076149914 10:128153518-128153540 GAGGCTGGGGACATGGTGGCAGG - Intergenic
1076692478 10:132230829-132230851 CAGGAGGGGCAGAGGGAGCCTGG - Intronic
1076702793 10:132282940-132282962 GAGGCTGGGGTCGGGGAGGCTGG + Intronic
1076805795 10:132858287-132858309 CAGGTTGGGGGCAGGGAGGTGGG + Intronic
1076818007 10:132924103-132924125 GAGCCTGGGCCCAGGGTGGCTGG - Intronic
1076826785 10:132973379-132973401 CAGGCTGGGCAGGGGCAGACTGG + Intergenic
1076857039 10:133122427-133122449 CAGGCTGGGCACGGGGCCGAGGG + Intronic
1076859401 10:133133549-133133571 CAGCGTGTGCCCAGGGAGGCAGG + Intergenic
1076905707 10:133359749-133359771 CATGCTGGCCCCAGGGAGCCTGG - Intergenic
1076980931 11:204328-204350 GAGGCTGGGGACAAGGAGGATGG + Exonic
1077164174 11:1127654-1127676 TAGCGTGGGCTCAGGGAGGCAGG - Intergenic
1077185380 11:1233377-1233399 CAGGCTGGGGAGAGTGGGGCAGG + Intronic
1077194593 11:1272772-1272794 CAGGCCGGGCCCAGGGATCCGGG + Intergenic
1077227601 11:1445173-1445195 CGGGCTGGGCACAGGGAGAGTGG + Intronic
1077227794 11:1445933-1445955 CAGCCAGGGCCCAGGGAGGGAGG - Intronic
1077250579 11:1558949-1558971 CACGCTGGGCACAGGCAGGCAGG + Exonic
1077278321 11:1728425-1728447 GAGGCTGGGCACGGAGAGGAGGG - Intergenic
1077281109 11:1746688-1746710 GAGGCTGGGCAGAGGCTGGCTGG - Intronic
1077298548 11:1837088-1837110 CAGGTGGGCCACCGGGAGGCAGG + Exonic
1077299984 11:1842315-1842337 GAGGCTGGGCACGGGGAGCGTGG + Intergenic
1077305017 11:1865065-1865087 AGAGCTGGGCACAGGGGGGCAGG + Intronic
1077316425 11:1921293-1921315 CGGGCTGGGCACAGCAGGGCGGG + Intronic
1077344212 11:2038978-2039000 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1077357981 11:2127417-2127439 GAGGCTGGGCCCAGTGAAGCAGG + Intergenic
1077368595 11:2171287-2171309 CAGCTGGGGCAGAGGGAGGCAGG + Intronic
1077369444 11:2174622-2174644 CGGGCTGGGAGCGGGGAGGCTGG - Intergenic
1077491637 11:2863335-2863357 CAGGCTGGGCAGAGTGAGGGAGG + Intergenic
1077555820 11:3225550-3225572 CAGGCTGGGCAGGGGCAGGTGGG + Intergenic
1078031145 11:7752583-7752605 CAGGATGGGCACACAGAGGTTGG - Intergenic
1078446602 11:11409492-11409514 CTGGCTGAGCACAGGAAGGCTGG - Intronic
1078566028 11:12415021-12415043 CAGCCTGGGCACTGGTGGGCTGG + Intronic
1078986720 11:16605217-16605239 CCGGCTGGGCTCAGGGACGCGGG + Intronic
1079009167 11:16814401-16814423 CAGGCTGTACAGAGGTAGGCAGG - Intronic
1079172885 11:18112916-18112938 CAGGCTGGGCACCCCTAGGCTGG + Intronic
1079186830 11:18245679-18245701 CAGGCTGGGCACCCCTAGGCTGG + Intronic
1079190012 11:18269541-18269563 CAGGCTGGGCACCCCTAGGCTGG - Intronic
1080427357 11:32168449-32168471 CAGGCTGAGCAAAGCCAGGCTGG + Intergenic
1080614709 11:33935818-33935840 CTGGCTGGGCACAGCTCGGCAGG + Intergenic
1080637895 11:34139501-34139523 CCGGGTGGGGACAGGGAGGAGGG + Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1081862472 11:46341200-46341222 AAGGCTGGGCAGAGGGAGGGAGG - Intronic
1081964872 11:47163426-47163448 AAGGATGGGCAGAGGGAGCCAGG - Intronic
1082711533 11:56559221-56559243 GAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1083712646 11:64558716-64558738 CAAGGTGGGCAGTGGGAGGCAGG - Intronic
1083856172 11:65394131-65394153 GAGGCTGGGCACAAGGGGCCAGG - Intronic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1083996793 11:66276902-66276924 CTGGCAGGGCAGAGGGCGGCAGG - Exonic
1084008936 11:66337166-66337188 CAGGCTGGGGAGGGGGAGGTGGG - Intergenic
1084147854 11:67274614-67274636 CAGGCTGTGCACTGGGAGACTGG - Intronic
1084153203 11:67300783-67300805 CAGCCTGGGCCCAGGGAGGAGGG + Intronic
1084266732 11:68008856-68008878 CAGGCAGGGGACAGGGTGACAGG - Intronic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1084363466 11:68683890-68683912 GTCGCTGGGCACAGGGAGCCGGG + Intronic
1084410558 11:69003935-69003957 ATGTCTGGGCACTGGGAGGCTGG + Intergenic
1084582096 11:70030344-70030366 CAGTCTGGGCTCAAGGAGTCCGG - Intergenic
1084608674 11:70187055-70187077 CAGGCTGGGAAGAGGGAGATGGG + Intronic
1084650271 11:70485519-70485541 CAGGCTGGGCACTGCCCGGCGGG + Intronic
1085048177 11:73365330-73365352 TAGGGTGGGCCAAGGGAGGCAGG + Intronic
1085052920 11:73388971-73388993 CAGGCAGAGCCCGGGGAGGCCGG - Intronic
1085408476 11:76277889-76277911 ATGGGTGGGCTCAGGGAGGCAGG + Intergenic
1085519148 11:77128070-77128092 CTGGCTGCCGACAGGGAGGCGGG - Intergenic
1085546504 11:77323238-77323260 AAGGCTTGGCACAATGAGGCTGG + Exonic
1086218608 11:84413596-84413618 CAGTCTGGGAACAGGTAGGTTGG - Intronic
1086337394 11:85812666-85812688 AAGACTGGGCACAGAGAGGCAGG + Intergenic
1086490410 11:87353378-87353400 TAGGCTGGGTGCAGGGAGGCAGG - Intergenic
1088483638 11:110320328-110320350 AAAGCTGGGCCCAGGGAGTCAGG - Intergenic
1088735207 11:112723072-112723094 CAGGCAAGGCAGAGAGAGGCAGG + Intergenic
1089180994 11:116582778-116582800 CAGGCGGATCCCAGGGAGGCAGG + Intergenic
1089230232 11:116967819-116967841 CCTGATGGGCACAGGGAGGCTGG - Intronic
1089497863 11:118916751-118916773 CAGGCACGGCACAGGGAATCCGG + Intronic
1089524460 11:119087882-119087904 CAGCCTGGCCACAGGAAGGGTGG - Intronic
1089651962 11:119920407-119920429 CAGGCTGGGCTGAGGGCTGCTGG - Intergenic
1089755290 11:120681746-120681768 CAGGCTGGGAACAGGCAGGAAGG + Intronic
1090331039 11:125932482-125932504 CCGCCTGAGCCCAGGGAGGCAGG + Intergenic
1090351374 11:126110617-126110639 CAGGCTTTGCTCAGGGAGGCTGG - Intergenic
1090403914 11:126466122-126466144 CACGCTGGGTGCAGGGAGGAGGG - Intronic
1090610642 11:128467552-128467574 GAGGCTGGGCACAGGGATAAGGG - Intronic
1090668519 11:128930646-128930668 GAGGCTGGGGTTAGGGAGGCCGG + Intergenic
1090668591 11:128930811-128930833 GAGGCTGGGGTTAGGGAGGCCGG + Intergenic
1090668626 11:128930888-128930910 GAGGCTGGGGTTAGGGAGGCCGG + Intergenic
1090794775 11:130125253-130125275 CACTCTGGTCCCAGGGAGGCTGG + Intronic
1090868155 11:130720429-130720451 CACACTGGGCACTGGGAGCCAGG - Intergenic
1090983834 11:131748556-131748578 GTGGATGGGCACAGGGAGGAGGG - Intronic
1091282410 11:134389656-134389678 ACGGGTGGGCACAGTGAGGCTGG - Exonic
1091306296 11:134538400-134538422 ATGGCAGGGCAGAGGGAGGCAGG + Intergenic
1202827198 11_KI270721v1_random:94167-94189 CATGGAGGGCACAGGGAGGAGGG + Intergenic
1091545287 12:1497620-1497642 TAGGCTGGGGACAGGGATGAAGG - Intergenic
1091568624 12:1665129-1665151 CAGGGCTGGCACAGGGAAGCTGG - Intergenic
1091637095 12:2205335-2205357 TAGCCTGGGTACAGGGAGGAGGG + Intronic
1091785589 12:3241765-3241787 GCGGCTGGGCACAGCGAGCCTGG + Intronic
1091930121 12:4389315-4389337 CTGGGTGGGGACAGCGAGGCTGG - Intergenic
1092242024 12:6841078-6841100 CAGGCAGGGCTCAGGCAGGCTGG + Intronic
1092276776 12:7067489-7067511 GAGGATGGCCACAGAGAGGCTGG + Intronic
1092493947 12:8973024-8973046 CCAGCTGGGCTGAGGGAGGCTGG + Intronic
1092558918 12:9588867-9588889 CAGGCTGTTCACATGGTGGCTGG - Intergenic
1093413683 12:18896069-18896091 CCGGCTGGAGCCAGGGAGGCTGG - Intergenic
1094011496 12:25814868-25814890 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1094018756 12:25891866-25891888 CAGGCTGGGCACAGTGTTTCAGG - Intergenic
1094346012 12:29469873-29469895 CAAGATGGGGTCAGGGAGGCAGG + Intronic
1094351484 12:29530707-29530729 CAGGCTGGCCACTTGCAGGCTGG - Intronic
1094443624 12:30506556-30506578 CAGCCTGTGCACTGGGAGGATGG + Intergenic
1095213362 12:39520497-39520519 CTGGCTGGGCACAGGGGCTCAGG + Intergenic
1095419585 12:42011425-42011447 AAGGATGGGGTCAGGGAGGCAGG - Intergenic
1096075997 12:48805139-48805161 CAGGCTGGGAGCTGGGAGGCAGG + Intergenic
1096228550 12:49884623-49884645 CAGGCTGGGCACAGGACACCTGG + Intronic
1096473183 12:51891323-51891345 CAGGCTGGGAACAGGTAATCAGG + Exonic
1096495802 12:52038496-52038518 CAGGCTGGGCAGAGGTTGGTAGG + Intronic
1096620428 12:52861206-52861228 CATGCTGGGCACAGCCAGGCAGG + Intergenic
1096693026 12:53332854-53332876 CGGGCTGGGCAGAGGGAGAGGGG - Intronic
1097153531 12:56996330-56996352 CAGGCTTGGCTCAGGGTGGGGGG - Exonic
1097225524 12:57475068-57475090 CAGGCCTGGCACAGGCAGCCAGG - Intronic
1097326531 12:58283651-58283673 AAGAGTGGACACAGGGAGGCTGG - Intergenic
1097872098 12:64610400-64610422 GGGGCGGGGCCCAGGGAGGCGGG + Intergenic
1098247183 12:68532131-68532153 CAGATTGGGGAGAGGGAGGCAGG + Intergenic
1099226144 12:79971853-79971875 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
1100121633 12:91375354-91375376 CAGGAAGGGTTCAGGGAGGCTGG + Intergenic
1100574627 12:95878769-95878791 CAGGGTGGGTGCAGGTAGGCAGG - Intronic
1100878801 12:98993448-98993470 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1101376719 12:104177798-104177820 CAGAAGAGGCACAGGGAGGCAGG - Intergenic
1101412503 12:104481198-104481220 CAGGCAGGCCTCAGTGAGGCGGG - Intronic
1101782076 12:107845584-107845606 GAGGCTGGGGACAGGGCGGTAGG + Intergenic
1101898031 12:108770316-108770338 CAGGCTGGGCACAGAAGGCCAGG + Intergenic
1101898081 12:108770465-108770487 CAGGCTGGGCACAGAAGGCCAGG + Intergenic
1101908168 12:108843372-108843394 CAAACTGGGCACTGTGAGGCAGG + Intronic
1102198025 12:111038020-111038042 CAGGATGAGCAAAGAGAGGCCGG + Intronic
1102440771 12:112962685-112962707 TAGGCTGGGGGCAGAGAGGCAGG - Exonic
1102570740 12:113825596-113825618 CAGGCCTGGCCCAGGAAGGCAGG - Intronic
1102639692 12:114355910-114355932 TAGGCTGGGCACAGGCTCGCTGG + Exonic
1102739348 12:115193101-115193123 GGGGCTAGGCACAGGGAGGTGGG + Intergenic
1102991386 12:117318733-117318755 TGTGCTGGGCACAGGGAGGCGGG + Intronic
1103716354 12:122947585-122947607 CAGGCTGGGTTCAGACAGGCAGG - Intronic
1103926650 12:124427134-124427156 CCAGCTGGGCCCAGGGAGCCCGG + Intronic
1103948225 12:124538701-124538723 CAGGCTGGGCGCAGCGAGGTGGG + Intronic
1104569102 12:129909459-129909481 CAGGCCCAGCCCAGGGAGGCCGG + Intergenic
1104648595 12:130514620-130514642 GGAGCTGGGCACAGGGAGGTCGG - Intronic
1104756435 12:131272525-131272547 GAGCCTGGGCGCAGGGAGGCAGG + Intergenic
1104809466 12:131611739-131611761 GAGCCAGGGCACAGGGAGCCTGG - Intergenic
1104913132 12:132249891-132249913 CACGCGGGGCACAGGGGTGCAGG + Intronic
1104971498 12:132532830-132532852 CATGCCTGGGACAGGGAGGCTGG + Intronic
1104977520 12:132558876-132558898 CTGGCAGCACACAGGGAGGCCGG - Intronic
1105274449 13:18906429-18906451 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1105279122 13:18952988-18953010 CAGGATGGGCTCCAGGAGGCAGG + Intergenic
1105299008 13:19116826-19116848 CACGCTGGCCACTGGGTGGCAGG + Intergenic
1106100338 13:26689854-26689876 CAGACTGAGCTCTGGGAGGCAGG + Intergenic
1106500967 13:30328309-30328331 CAGTCTGGTAACAGGAAGGCAGG + Intergenic
1106643853 13:31612361-31612383 CAGGCTGGGAAAAGGAAAGCAGG - Intergenic
1107406360 13:40117736-40117758 CTGCCTGGGGAGAGGGAGGCAGG + Intergenic
1107542389 13:41403265-41403287 CAAGCCAGGCACAGAGAGGCAGG + Intergenic
1108688900 13:52845738-52845760 CAGGCTGGGGGAAGGGAGACTGG - Intronic
1108933270 13:55858767-55858789 AAGGATGGGCACAAGGATGCAGG - Intergenic
1110635833 13:77766237-77766259 GAGGCTGGGCCCAGAGTGGCTGG + Intergenic
1112004925 13:95245793-95245815 CACGGTGGGCAGTGGGAGGCAGG - Intronic
1112134655 13:96563604-96563626 AAGGCTGGTCACAGTGGGGCAGG + Intronic
1113373897 13:109746151-109746173 AAGGCAGGGCACAGGGAGGCTGG - Intergenic
1113382517 13:109816977-109816999 GAGGCTGGGGACAGTGGGGCAGG + Intergenic
1113403573 13:110018133-110018155 CATGCTGGGCACAGAGCGGGTGG - Intergenic
1113689265 13:112301225-112301247 CAGGATGGGCCCAGGTAAGCAGG + Intergenic
1113689590 13:112303027-112303049 CAGGATGGGCCCAGGTAAGCAGG + Intergenic
1113751798 13:112781595-112781617 CAGCCTGGGGACAGGGCGCCCGG - Intronic
1113767938 13:112892676-112892698 GAGGCTGGGCTCAGGGAAGGAGG - Intergenic
1113890957 13:113735420-113735442 CAGGCTGGCACCACGGAGGCAGG - Exonic
1113947354 13:114051639-114051661 CAGTGTGGGCACAGGAAGGGCGG - Intronic
1114280294 14:21187973-21187995 CAGGCCGGTCAAAGGGACGCCGG + Intergenic
1114416452 14:22548043-22548065 CAGTCTGAGCAAAGGCAGGCAGG - Intergenic
1114443553 14:22770504-22770526 CAGGCTGGGCACAGGAAGGTTGG - Exonic
1114562352 14:23602596-23602618 CAGGCTGTGGACAGGAAGGATGG + Intergenic
1114643183 14:24238281-24238303 CTGGCTGGGCACAGTGAGTCAGG + Exonic
1117245986 14:53887196-53887218 CAGGCATGACTCAGGGAGGCCGG - Intergenic
1118594450 14:67424921-67424943 AAGGCTGGTCCCTGGGAGGCAGG + Intergenic
1118594555 14:67425692-67425714 GAGGCTGGTCCCTGGGAGGCAGG - Intergenic
1119109949 14:71962285-71962307 GTGGCTGGGCAGAGGGAGGCCGG + Intronic
1119164508 14:72480918-72480940 AGGGCTGGGGACAGCGAGGCTGG + Intronic
1119255254 14:73190064-73190086 CAGGCTGTGCAGAGGAAGGCAGG + Intronic
1119546365 14:75474819-75474841 AAGGTTGGGAAGAGGGAGGCAGG - Intergenic
1119659755 14:76441868-76441890 CATTCTGGGGACAGTGAGGCAGG - Intronic
1119675523 14:76550751-76550773 CAGGCTGGGAAAAGGGCAGCAGG - Intergenic
1119965040 14:78905175-78905197 CAGGCTGGGCAAAGGAAAGGAGG - Intronic
1120502258 14:85311047-85311069 GAGGCTGGGAACAGAGAGGTTGG + Intergenic
1120708663 14:87771246-87771268 CAGGCTGTGCACAGGTGGCCTGG + Intergenic
1120823062 14:88930790-88930812 CAGGCTGGCCACAGTAAGGATGG + Intergenic
1121039121 14:90730517-90730539 AAGGCTGGGGACACGGAAGCGGG + Intronic
1121523230 14:94600372-94600394 CAGGCTGGGCACAGGTCAGCTGG + Intronic
1121823948 14:96995129-96995151 CAGGCTGGGCAGTGGGATGGAGG + Intergenic
1121916037 14:97837646-97837668 CAGACAGGGAACAGGGAGGCAGG - Intergenic
1122066315 14:99176298-99176320 CAGGCAGGGCACTGGGATCCCGG - Intronic
1122129311 14:99595940-99595962 CAGCCTTGGCACAGAGTGGCAGG - Intronic
1122279103 14:100610715-100610737 AAGGCAGGGCCCAGGGAGCCAGG + Intergenic
1122371800 14:101233199-101233221 CTGGGTGGGCTTAGGGAGGCGGG - Intergenic
1122502629 14:102211445-102211467 CACGATGGGCACAGGGTGGATGG - Intronic
1122542208 14:102504914-102504936 CAGGCAGGACACAGGCTGGCGGG - Exonic
1122717959 14:103706713-103706735 CTGGCTGAGCACAGCGATGCCGG - Intronic
1122719958 14:103716231-103716253 CAGGGCGGGCGCCGGGAGGCGGG + Intronic
1122768467 14:104086528-104086550 TGGGCTGGGCACAGGAAGGATGG + Intronic
1122774928 14:104112921-104112943 CAGCCTGGGCAAAGGCAGGGTGG - Exonic
1122805895 14:104256833-104256855 GAGTCTGGGCTCTGGGAGGCTGG + Intergenic
1122929309 14:104926118-104926140 CAGGCTGGGCGCTGGGACCCAGG - Intronic
1122978429 14:105180698-105180720 GAGGCCGGGCGCAGGGAGGTAGG - Intronic
1123043992 14:105502669-105502691 CAGGCAGGGCAGCGAGAGGCCGG - Intergenic
1123059396 14:105587635-105587657 ATGGCTGGGCACAGCCAGGCAGG + Intergenic
1123062826 14:105601932-105601954 CAGGCTGGGCTCAGGAAGGGGGG + Intergenic
1123110458 14:105864733-105864755 GTGGCTGGGGACAGGGACGCCGG - Intergenic
1202904297 14_GL000194v1_random:59616-59638 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1124109357 15:26772608-26772630 CGGCCTGGGCGGAGGGAGGCGGG - Intronic
1125599480 15:40907421-40907443 CAGGCTGGGCATCCCGAGGCTGG + Intergenic
1125617202 15:41025431-41025453 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1125677309 15:41509336-41509358 CAGGAGGGGCTCAGGCAGGCAGG - Intronic
1125721985 15:41849581-41849603 CAGGAAGGGCACAGGGAGCCTGG + Intronic
1125828150 15:42693101-42693123 CTGGCTGGGAGCTGGGAGGCAGG - Exonic
1127845495 15:62866811-62866833 TTGGCTGGGCCCAGGGACGCAGG - Intergenic
1127871311 15:63076210-63076232 CCGGCTGGGCACAGGGGGGCCGG + Intergenic
1127902764 15:63353437-63353459 CAGACCTGGCAAAGGGAGGCCGG - Intronic
1128087225 15:64894625-64894647 CAGCCTGGGCAAAGGCAGGGAGG + Intronic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128159666 15:65415342-65415364 CAGCCTGGGCTCTGGCAGGCAGG + Intronic
1128217493 15:65944543-65944565 CAGGCTGGGCCCAGCCAGGATGG + Intronic
1128344955 15:66847824-66847846 CAGGCTAGGCCAGGGGAGGCAGG + Intergenic
1128604790 15:69028460-69028482 CAGGCTGGGCTCAGGAGGCCGGG - Intronic
1129052979 15:72797553-72797575 CAGGCTTGGCACTGGGAGGGCGG + Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1129739157 15:77981630-77981652 CAGCCTGGGCCACGGGAGGCAGG - Intergenic
1129743456 15:78001547-78001569 CAGGCTGCTCTCAAGGAGGCAGG + Intronic
1129867687 15:78921988-78922010 CAGGCTGGGCACAGAGGTGAGGG + Exonic
1129932848 15:79426636-79426658 AAGGCTGGTCCCAGGGAGCCAGG - Intronic
1130655536 15:85789780-85789802 CAGGCTGGGCTTAGGGGAGCAGG - Intronic
1130847905 15:87764654-87764676 CAGGCTGCGCTAAGGGAGACTGG - Intergenic
1130996045 15:88904821-88904843 AAGGCGGGGCACAGGAGGGCAGG + Intronic
1132018091 15:98336970-98336992 CAGGCTGTGGACTGGGAGGCAGG - Intergenic
1132091360 15:98950222-98950244 CAGGCTGGGCCCACAGTGGCGGG + Intronic
1132393749 15:101457448-101457470 CAGCCTGCGCCCTGGGAGGCTGG - Intronic
1132405904 15:101541766-101541788 CTGGCAGGGCACCAGGAGGCAGG + Intergenic
1132462572 16:62715-62737 CAGGGTGGACACAGGCAGGAAGG + Intronic
1132543474 16:522297-522319 GGGCCTGGGCACAGAGAGGCAGG - Exonic
1132664072 16:1073666-1073688 CAGGCTGGGGACAGCGGGTCGGG - Intergenic
1132670006 16:1098665-1098687 CAGCCTGGGAACACGGAGCCAGG - Intergenic
1132703564 16:1231748-1231770 CAGGCTGGTCCCAGGCAGGGTGG - Intergenic
1132704946 16:1239613-1239635 CAGGCTGGTCCCAGGCAGGGTGG + Intergenic
1132707953 16:1254647-1254669 CAGGCTGGTCCCAGGCAGGGTGG + Intergenic
1132760870 16:1508090-1508112 CCGGAGGGGCCCAGGGAGGCGGG - Intronic
1132804869 16:1770824-1770846 CAGGCTGAACAGGGGGAGGCCGG + Intronic
1132836133 16:1954355-1954377 CAGGCTGAGCCCACAGAGGCAGG - Intronic
1133046303 16:3090124-3090146 CACTCTGCGCACAGGAAGGCGGG + Exonic
1133220430 16:4317112-4317134 CAGCCTGGCCAGAGGGTGGCCGG + Intronic
1133297687 16:4762879-4762901 ACGGCTGGGCAGAGGGAGGGAGG - Intronic
1133302438 16:4790853-4790875 CAGGCAGGGCCCAGGGTGGCAGG + Intronic
1133309546 16:4835202-4835224 GAGGCTGGGTAGTGGGAGGCAGG - Intronic
1133320205 16:4909060-4909082 CAGGCAGAGGCCAGGGAGGCAGG + Intronic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134085066 16:11350675-11350697 CAGGCAGGGCTCAGGGCTGCAGG - Exonic
1134095443 16:11415591-11415613 CATGCAGGGCACAAGGAGACAGG + Intronic
1135415376 16:22264719-22264741 CAGGCTGGTTCCAGGGAGGAGGG + Intronic
1136071547 16:27790715-27790737 CAGGCTGGACACAGGCTGGCAGG - Exonic
1136173510 16:28502513-28502535 GAGTCTGGGCACATGGAGGAAGG - Intronic
1136250974 16:29004861-29004883 CAGGCTGGGGAAGGGAAGGCAGG - Intergenic
1136553260 16:30992969-30992991 CAGACAGGGCAGAGGGTGGCAGG + Intronic
1136718913 16:32304205-32304227 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1136723934 16:32342561-32342583 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1136773003 16:32857753-32857775 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1136837286 16:33510469-33510491 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1136842262 16:33548605-33548627 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1136862046 16:33710337-33710359 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1136897612 16:34003766-34003788 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1137262607 16:46843820-46843842 CAACCTGGGCACAGGGCTGCAGG - Intergenic
1137369940 16:47895885-47895907 GAGGCTGGGGAGAGGGAGACAGG + Intergenic
1137435058 16:48448136-48448158 CAAGCTGAACACAGGGAGGTGGG - Intronic
1137553439 16:49455700-49455722 AACGCTGGGGAGAGGGAGGCAGG + Intergenic
1137603931 16:49774724-49774746 CAGTCTGGGCAAGGGGAGGAGGG + Intronic
1137604820 16:49780392-49780414 CAGGCGGAGCACAGGGGTGCTGG + Intronic
1137773965 16:51040676-51040698 CAGGCAGGGAGGAGGGAGGCAGG + Intergenic
1138377898 16:56579237-56579259 AAGGCTGGGCACAGAGAAGGGGG - Intergenic
1138430124 16:56963148-56963170 CAGGCTGGGGGTAGGGAGGCGGG + Intronic
1138609472 16:58111220-58111242 CATGCTAAGCACAGGGAAGCAGG + Intergenic
1138647864 16:58438336-58438358 AGGGCTGTGCACAGGGAGTCTGG - Intergenic
1139583168 16:67885036-67885058 CAGGCTGGGCATAGGGTGTGTGG + Intronic
1140112881 16:72018594-72018616 CAGGAGGGCCACAGGGAGGGAGG - Intronic
1140127783 16:72132464-72132486 CTTCCTGGCCACAGGGAGGCAGG - Intronic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1141468366 16:84222009-84222031 CAGGCTGGACACAGTCAGCCTGG + Exonic
1141625603 16:85259530-85259552 CAGCCAGGGCACAGAGAGGGTGG + Intergenic
1141632505 16:85296056-85296078 CAGGCTGAGAACCAGGAGGCCGG + Intergenic
1141700548 16:85640191-85640213 CGGGCTGGTGACAAGGAGGCGGG - Intronic
1141770289 16:86085604-86085626 CAGGGTGGTCACTGGGAGCCTGG - Intergenic
1141831782 16:86513116-86513138 CAGGCGGGTCACAGGGACCCTGG + Exonic
1142110789 16:88329961-88329983 CACTCTGGGCACAGGGTGCCTGG + Intergenic
1142118438 16:88373494-88373516 CAGGTGGGGCACAGGCAGGGTGG - Intergenic
1142245798 16:88969541-88969563 CAGGCTGGGGTCAGCGTGGCCGG + Intronic
1142288570 16:89182089-89182111 CAGGCTGGGGGAGGGGAGGCTGG - Intronic
1142288592 16:89182134-89182156 CAGGCTGGGGGAGGGGAGGCTGG - Intronic
1142288607 16:89182164-89182186 CAGGCTGGGGGAGGGGAGGCTGG - Intronic
1142288629 16:89182209-89182231 CAGGCTGGGGGAGGGGAGGCTGG - Intronic
1203002497 16_KI270728v1_random:175204-175226 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203007518 16_KI270728v1_random:213566-213588 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203075428 16_KI270728v1_random:1119863-1119885 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203123538 16_KI270728v1_random:1558520-1558542 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203134102 16_KI270728v1_random:1711610-1711632 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1203147462 16_KI270728v1_random:1810748-1810770 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1203152427 16_KI270728v1_random:1848902-1848924 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1142588337 17:988304-988326 CAGGCTGGGAAAGGGAAGGCAGG + Intergenic
1142604635 17:1074677-1074699 AAGGCTGGAGGCAGGGAGGCTGG + Intronic
1143102709 17:4513150-4513172 CAGGCTGGGCCCTGCAAGGCGGG + Intronic
1143552068 17:7636436-7636458 CAGGCTGGGGAAAGAGAGGTTGG - Intergenic
1144101626 17:11946801-11946823 CAGGTTGAGCATAGGGAGACAGG + Intronic
1144517447 17:15928457-15928479 GAGGCTGAGCATGGGGAGGCTGG + Intergenic
1144671053 17:17132736-17132758 CATCCTGGGGTCAGGGAGGCAGG + Intronic
1144782911 17:17816830-17816852 GTGGCTAGGCACAGGGAGGACGG + Intronic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1145001779 17:19310343-19310365 CAGGGTGGGCGCAGGGATGCAGG + Intronic
1145035886 17:19540287-19540309 CAGGTGGCCCACAGGGAGGCAGG + Intronic
1145241292 17:21242252-21242274 CAGGCTGCACCCAGGAAGGCTGG + Exonic
1145272087 17:21410156-21410178 TAGGCTGGGCACAGGCAGCCAGG - Intronic
1145310294 17:21697618-21697640 TAGGCTGGGCACAGGCAGCCAGG - Intronic
1146390120 17:32414379-32414401 CAGGGTGGGTACAGGGAGAATGG - Intergenic
1146531327 17:33609944-33609966 CAGGCTGCTCACCGGGAGGAGGG - Intronic
1146785781 17:35720111-35720133 CGGGCTGGGCACAGGATGACAGG + Intronic
1147235861 17:39057045-39057067 CAGGCTCAGCGAAGGGAGGCTGG + Intergenic
1147312867 17:39605390-39605412 GGGGCTGGGGACAGGGGGGCGGG + Exonic
1147403189 17:40193077-40193099 CAAGCTGGGCACTTGGAGGAAGG - Intronic
1147509949 17:41059702-41059724 TCGGCTGGCCGCAGGGAGGCCGG + Exonic
1147553301 17:41460354-41460376 GAGGTTGGGACCAGGGAGGCTGG - Intronic
1147833996 17:43317131-43317153 GAGGCTGGGAATAGGGAGGATGG - Intergenic
1147907360 17:43832034-43832056 CAGGCTGTGGACAGAGAGGATGG + Intronic
1148049184 17:44760763-44760785 TGGGCTGGGCAGAGGGAGGAAGG + Intronic
1148482618 17:47970083-47970105 AAGACTGGGGACAAGGAGGCTGG - Intronic
1148703454 17:49606452-49606474 CAGGCTGGGCACAGTGGTGCTGG - Intronic
1149500814 17:57150951-57150973 CAGGCTGGGCAGTGGGAGTTGGG - Intergenic
1149546680 17:57509047-57509069 CAGACTGGGAAGATGGAGGCAGG - Intronic
1149620466 17:58041039-58041061 CAGGCTGGGCACTTAGAGGAGGG + Intergenic
1149869168 17:60167485-60167507 AAGGCTGGCCACAGAGAGGGAGG + Intronic
1150633715 17:66898250-66898272 CAGGCTGGGCACATGATTGCAGG + Intergenic
1150647171 17:66986168-66986190 GAAGCTGGGGACAGGGAGGTAGG + Intronic
1150651904 17:67015983-67016005 CAGGCTGGCCTCAGGGTGGTGGG - Intronic
1151337380 17:73447856-73447878 CAGGAGGGGCCCTGGGAGGCTGG - Intronic
1151751955 17:76044241-76044263 GAGGCTGGGGACAGGAAGGAAGG + Intronic
1151907007 17:77055173-77055195 GAGGCTGGGCAAAGGCAGGGAGG - Intergenic
1151944870 17:77314138-77314160 CAGCCTGGGCAAAGGGAGTAAGG + Intronic
1151964412 17:77423917-77423939 CAGGCAGGGCTCAGGGCGGGCGG - Intronic
1152069609 17:78128293-78128315 GGGGCGGGGGACAGGGAGGCCGG - Intronic
1152099513 17:78292778-78292800 GAAGCTGGACACAGAGAGGCAGG - Intergenic
1152259546 17:79259674-79259696 CAGGCTCAGCAAAGGGAGCCCGG - Intronic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152518264 17:80838714-80838736 CAGCCTGGGCAGAGGCAGGAGGG + Intronic
1152527175 17:80895057-80895079 CTGTCTGGGGACAGTGAGGCCGG + Intronic
1152552000 17:81034783-81034805 CGGGCTGGGGGCGGGGAGGCGGG - Intergenic
1152588089 17:81197968-81197990 GAGGCTGGGCTCTGGGAGGGAGG + Intronic
1152615234 17:81334758-81334780 CAGCCAGGGGTCAGGGAGGCTGG + Intergenic
1152641790 17:81452365-81452387 GAGGCTGGCCGCAGGGTGGCGGG + Intronic
1152698261 17:81806842-81806864 CAGGCGGGGGACAAGGAGGAAGG - Intronic
1152730081 17:81965862-81965884 CAGGCTGGGCACAGGGCACCAGG + Intergenic
1152755383 17:82084976-82084998 CAGGCTGGGGATGGGGAGGCTGG + Intronic
1152790333 17:82275183-82275205 CGGGCTGGGCAAGGTGAGGCAGG + Intergenic
1153671239 18:7414533-7414555 CTGGCAGAGCACAGGGAGGAGGG + Intergenic
1153980512 18:10304878-10304900 GGGGCTGGGCCCAGGGAGCCTGG - Intergenic
1154008678 18:10557387-10557409 CATGCTGGGCCCTGAGAGGCAGG - Intergenic
1154073606 18:11178008-11178030 CAGGCTGCCCTCAGGAAGGCCGG + Intergenic
1154107331 18:11534008-11534030 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1154170301 18:12046569-12046591 CATGCTGGCCACTGGGTGGCAGG + Intergenic
1154200120 18:12293884-12293906 CAGGATGGGCAGGGGGAGCCAGG - Intergenic
1154256132 18:12782250-12782272 CAAGCTGAGAACAGGGAAGCTGG - Intergenic
1154466135 18:14643684-14643706 CATGCTGGTCACTGGGTGGCAGG - Intergenic
1154485355 18:14867835-14867857 CATGCTGGCCACTGGGTGGCTGG - Intergenic
1155045137 18:22096648-22096670 CATTCTGGGCACTGGGGGGCAGG + Intronic
1155802887 18:30131282-30131304 CAAGCTGAGCACAGGGTGCCCGG + Intergenic
1155907497 18:31469279-31469301 CAGGCCGCACTCAGGGAGGCTGG + Exonic
1157269851 18:46264686-46264708 CAGGCTGGGCAGGTGGAGGCAGG - Exonic
1157621099 18:49017993-49018015 CAGGCGGGGACCATGGAGGCAGG - Intergenic
1158105659 18:53882633-53882655 CATGCTGGAGCCAGGGAGGCTGG - Intergenic
1158118900 18:54026448-54026470 CATGCTGGGGACTGGGAGTCAGG + Intergenic
1159988802 18:74877391-74877413 GAGGCTGGGCAGAGGTAGACTGG + Intronic
1160022667 18:75192611-75192633 TGGGCTGGGGACAGGAAGGCTGG - Intergenic
1160213319 18:76902870-76902892 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1160399942 18:78602734-78602756 CAGGGCGTGCACAGAGAGGCAGG + Intergenic
1160795073 19:941437-941459 CTGGCTGGGGACACGCAGGCGGG - Intronic
1160982783 19:1823851-1823873 CAGGCTTGGGAGAGGGTGGCTGG + Intronic
1161111202 19:2471277-2471299 CAGGCTGGGCACGGTGTTGCGGG - Intergenic
1161210424 19:3062613-3062635 CGGGCGGGCCACGGGGAGGCGGG - Intronic
1161301765 19:3546218-3546240 CAGGCTGGGGTGGGGGAGGCCGG - Intronic
1161338918 19:3730155-3730177 CAGGCTGGGGTCAGAGATGCTGG - Intronic
1161591625 19:5131610-5131632 CAGGTGGGGCACAGGGGAGCTGG + Intronic
1161795641 19:6385040-6385062 CAGGCTGGGCACGTGGAGAGCGG - Intronic
1161835775 19:6645303-6645325 CACCCTGGGGACAGGGAAGCCGG + Intergenic
1161844121 19:6702091-6702113 CTGGCTGGTCCCCGGGAGGCAGG - Intronic
1161849573 19:6731525-6731547 GAGGGTGGGCACAGAGAGGGCGG + Intronic
1161866229 19:6833863-6833885 CAGGCTGGGCATAGGTAGACAGG + Intronic
1161925254 19:7294517-7294539 GGGGCCCGGCACAGGGAGGCGGG - Intergenic
1162017156 19:7851984-7852006 CAGCCTGGCCGCAGGGAGACAGG + Intronic
1162174616 19:8822067-8822089 GAGGCTGGGAACAGGGAAGACGG + Exonic
1162247157 19:9410906-9410928 CGGGCTGGGGAGAGGGAGGGAGG + Intergenic
1162251776 19:9450755-9450777 CAGACTGGTCACTTGGAGGCAGG - Intergenic
1162583839 19:11546983-11547005 CAGGCTGGGCAGGGGGTGGTGGG + Intronic
1163302618 19:16457485-16457507 CAGGCTTGCCACGGGGAGGGAGG + Intronic
1163377830 19:16944574-16944596 CTGGCTGGGCAAAGGGTGACTGG + Intronic
1163427675 19:17248051-17248073 CGGGCAGGGGTCAGGGAGGCGGG - Intronic
1163548122 19:17951195-17951217 CAGGCAGGGGACAGGGAGGGGGG - Intergenic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163648607 19:18504181-18504203 CAGGGACGGCACAGAGAGGCTGG + Intronic
1164158726 19:22612481-22612503 CAGGCTGGTCAGAGGGCTGCAGG - Intergenic
1164416293 19:28048897-28048919 CAGGCTGGCCCCAGTGAGGATGG + Intergenic
1164416564 19:28050672-28050694 CAGGCTGGCCCCAGTGAGGATGG - Intergenic
1164670103 19:30067574-30067596 CAGGCTGGGCAGAGGGATCCTGG + Intergenic
1164671941 19:30077392-30077414 CAGGTTGGGCACAGGTGGGCAGG - Intergenic
1164753711 19:30674299-30674321 CAGCCTGGGCACAGGGTGCATGG - Intronic
1164834547 19:31349264-31349286 CGGGCTGAGGACAGGGAGGGAGG + Exonic
1165052589 19:33151436-33151458 GAGGCTGGGGACAGGCAGGCAGG + Intronic
1165138510 19:33685681-33685703 CAGGCTGGGGCCTGGAAGGCTGG - Intronic
1165160057 19:33810846-33810868 CATGCTGGGCACAGGGCAGCCGG - Intronic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165363755 19:35351774-35351796 AAGACGGGGCACAGCGAGGCCGG - Exonic
1165438826 19:35812328-35812350 GAGCCAGGGCCCAGGGAGGCTGG - Intronic
1166130791 19:40744499-40744521 GAGGCTGGGACCAGAGAGGCTGG - Intronic
1166313843 19:41977843-41977865 CAGGCAGTGCAGAGGGAGGTTGG + Intronic
1166355537 19:42225209-42225231 CTGGCTGGGCTCAGGGCTGCGGG + Exonic
1166432913 19:42741738-42741760 CAGGCAGGACACAGGGTGCCTGG + Intronic
1166448878 19:42880952-42880974 CAGGCAGGTCACAGGGTGCCTGG + Intronic
1166453279 19:42919143-42919165 CAGGCAGGTCACAGGGTGCCTGG + Intronic
1166455768 19:42938451-42938473 CAGGCAGGTCACAGGGTGCCTGG + Intronic
1166465561 19:43027727-43027749 CAGGCAGGTCACAGGGTGCCTGG + Intronic
1166482837 19:43187747-43187769 CAGGCAGGACACAGGGTGCCTGG + Intronic
1166485319 19:43206881-43206903 CAGGCAGGACACAGGGTGCCTGG + Intronic
1166748954 19:45155679-45155701 CAGGCTGGCCACAGGGGTGGGGG + Intronic
1166856271 19:45783965-45783987 CATGCTGGGGACAGGGATGAGGG + Exonic
1166993954 19:46710467-46710489 CTGGCTGGGCACAGTGGGGGAGG - Intronic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167151655 19:47713620-47713642 CAGACTGGGGACAGGGTGGCAGG - Intronic
1167249699 19:48393459-48393481 CAGGCTGGGGACAGGCAGGCAGG - Intergenic
1167260387 19:48454662-48454684 CAAGCTGAGGACAGGGATGCTGG - Exonic
1167467715 19:49658860-49658882 CGAGCTGCTCACAGGGAGGCAGG + Intergenic
1167648285 19:50717366-50717388 CAGGCTGGGGCCAGGAGGGCAGG - Intronic
1168102442 19:54148354-54148376 CAGCCTGGGCATAGGGAGCAGGG - Exonic
1168104963 19:54160937-54160959 CTGGGTGGTCTCAGGGAGGCTGG + Exonic
1168126772 19:54288273-54288295 CAGTCATGGCACAGAGAGGCAGG + Intergenic
1168144885 19:54415447-54415469 CTGGCTGGGCTCAGGGGAGCGGG - Intronic
1168469660 19:56629955-56629977 CAGGCTCGGGGCAGGGAGGATGG - Intergenic
1168469780 19:56630574-56630596 CAGGCTGGGGGCAGGGAGAATGG + Intergenic
924989029 2:295429-295451 GAGGGTGGGCAGAAGGAGGCAGG - Intergenic
925017696 2:543948-543970 GAGGCTGGAGGCAGGGAGGCAGG + Intergenic
925067166 2:937569-937591 CAGCCGGGTCTCAGGGAGGCCGG - Intergenic
925232450 2:2245858-2245880 CTGGCTGTGAACATGGAGGCTGG + Intronic
925329123 2:3044707-3044729 CAGCCAGGGTGCAGGGAGGCAGG + Intergenic
925345400 2:3168576-3168598 CAGGCTGTGGTCAGGCAGGCAGG + Intergenic
925347905 2:3183404-3183426 CAGGCAGGGGACAGTCAGGCTGG - Intergenic
925826808 2:7857490-7857512 CAGGCTGTGCACAGGGGTCCAGG + Intergenic
925830169 2:7886100-7886122 CAGTTTGGGCATAGGGTGGCAGG + Intergenic
926001872 2:9339835-9339857 CAGGCTGGACACAGAGAGGTGGG - Intronic
926076980 2:9950499-9950521 CTGGTGGGGCACAGGGAGGCGGG - Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
926251340 2:11156865-11156887 CAGGCTGGGAGCAGAGAGGCTGG + Intronic
926714509 2:15913573-15913595 GAGGCTAGGCAGAGGGAGGGAGG + Intergenic
927529476 2:23781381-23781403 CAGGCTGGGCACAGTGGCTCAGG + Intronic
927554644 2:24023309-24023331 CAGGCTGGGTGCAGGGGGCCTGG - Intronic
927824457 2:26298545-26298567 CGGGCAGGGCACTGGGACGCGGG - Intergenic
927868665 2:26609384-26609406 AAGGCTGGGGAGAGGGAGGTGGG - Intronic
927963279 2:27254223-27254245 CAGGCTGGCTGGAGGGAGGCTGG - Intronic
928205644 2:29281333-29281355 CAGGCTGCCCACAGAGAGGAAGG - Intronic
928311438 2:30213670-30213692 CAGCCTGGTGGCAGGGAGGCGGG + Intergenic
928983277 2:37157124-37157146 CGGGCTTGGCACCGGCAGGCGGG + Intergenic
929061697 2:37930934-37930956 CTGGCAGGGCAGAGGGCGGCAGG + Intronic
929454239 2:42054959-42054981 AAGGCGGGGCACTGTGAGGCAGG - Exonic
930021642 2:47005209-47005231 CGGGCTGGACACAGAGAGGAAGG + Intronic
930145564 2:47999282-47999304 AAGGCTGGGCACAGTGACTCAGG - Intergenic
932357556 2:71078744-71078766 CAGGCTGAGCACCTGGGGGCAGG - Exonic
932442557 2:71747021-71747043 CCGGCTGGGGAGAGTGAGGCAGG - Intergenic
932573363 2:72949951-72949973 CAGGATGGCCACATGGAGTCTGG + Intronic
932764867 2:74463112-74463134 CAGGCAGGGGACATGGAGACTGG + Intronic
932781574 2:74561806-74561828 AGGCCAGGGCACAGGGAGGCAGG - Intronic
932814286 2:74849482-74849504 CAGGCTGGGGAATCGGAGGCAGG - Intronic
932874195 2:75433339-75433361 CTGGCTGGAGCCAGGGAGGCTGG + Intergenic
934053696 2:88233416-88233438 CCGGCTGGGCACTGGGTGACGGG + Intergenic
934322203 2:91980993-91981015 CATGCTGGCCACTGGGTGGCAGG - Intergenic
934460493 2:94211779-94211801 CATGCTGGCCACTGGGTGGCAGG - Intergenic
934502344 2:94870781-94870803 CAGGCTGGGCACAGCGGGGAGGG - Intergenic
934681018 2:96284001-96284023 CAGGCTGGAAAGAGGGAGGGAGG + Exonic
935582747 2:104772384-104772406 CAGGGTGTGCACTGCGAGGCTGG + Intergenic
936083730 2:109452778-109452800 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936083748 2:109452835-109452857 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936083790 2:109452948-109452970 GAGGCTGGTCCCTGGGAGGCTGG + Intronic
936093725 2:109516528-109516550 CAGGCAGGGCACAGGCAAGGCGG + Intergenic
936527871 2:113254281-113254303 CAGGCTAGGGATAGGTAGGCTGG + Intronic
936537246 2:113321888-113321910 GAGCATGGGCAGAGGGAGGCCGG + Intergenic
936664118 2:114574875-114574897 TGGGCAGGGCACAGCGAGGCAGG + Intronic
936713808 2:115162089-115162111 CAGCCTGGGAAGCGGGAGGCGGG - Intronic
936778402 2:116002355-116002377 GAGGCTGGACACCGGGAGGAGGG - Intergenic
937016493 2:118610893-118610915 GTGGGTGGGCACAGGGAGGGAGG - Intergenic
937320245 2:120956652-120956674 CAGGCAGGGCTCCGGGAGGCTGG - Intronic
937861921 2:126718174-126718196 CAGGCTGGGGACAGGAGAGCAGG - Intergenic
937950841 2:127387354-127387376 CGGGCTGGGCGCCGGGAGGGGGG - Intronic
937952794 2:127401378-127401400 CAGGCTGGGCCCAGGCGGCCAGG + Intergenic
938287084 2:130127910-130127932 CATGCTGGCCACTGGGTGGCAGG + Intronic
938312560 2:130302456-130302478 CACGCTGGCCACTGGGTGGCAGG - Intergenic
938428509 2:131210960-131210982 CATGCTGGCCACTGGGTGGCAGG - Intronic
938469411 2:131544978-131545000 CATGCTGGCCACTGGGTGGCAGG - Intergenic
938573364 2:132582713-132582735 TTGGCTGGGCAGAGGCAGGCAGG - Intronic
939107389 2:137964711-137964733 CAGGCTGGGCACAGGGATAAGGG + Intronic
940512979 2:154642364-154642386 CAGGCTGGGAACATGAAGGAGGG + Intergenic
940512986 2:154642416-154642438 CAGGCTGGGAACATGAAGGAGGG - Intergenic
940909955 2:159201878-159201900 CAGGCTGTTCAAAGGCAGGCAGG - Intronic
942449869 2:176102029-176102051 CAGGCTTGCCTCATGGAGGCAGG + Intergenic
943338572 2:186648688-186648710 CAGGCTGGTCTCAGTCAGGCTGG + Intronic
944061991 2:195579434-195579456 CAGGCTGGGCCCAGGGGCTCAGG - Intronic
944661902 2:201928566-201928588 CAGGCTGGGCCAGGGGAGGGAGG - Intergenic
944962481 2:204890718-204890740 CCTGCTAGCCACAGGGAGGCAGG + Intronic
946153629 2:217792743-217792765 CAGTGTGGGCAAAGGGAGCCAGG - Intergenic
947524399 2:230869557-230869579 CAGGCTGAGAACAGGGAAGATGG - Intronic
947564622 2:231185937-231185959 CAAGCTGGTTCCAGGGAGGCTGG + Intergenic
947574832 2:231264776-231264798 CAGGCTGGGCACAGTGGCTCAGG - Intronic
947640362 2:231704322-231704344 CAGGCTGGGGTCAGGAAAGCAGG + Intergenic
947715621 2:232337575-232337597 CAGGCTGGGGTCAGGCTGGCTGG - Intronic
947734654 2:232448328-232448350 CAGGCTGGGGTCAGGCTGGCTGG - Intergenic
947836610 2:233180434-233180456 CAGGCTGAGCACAGGGGTACAGG - Intronic
947864502 2:233386890-233386912 CAGGAAGGGCACAGTGAGGATGG + Intronic
948033784 2:234841437-234841459 CAGCCTGGGCAACGGTAGGCTGG - Intergenic
948080660 2:235202784-235202806 CATGCTGAGCACAGGGAAGCAGG - Intergenic
948087714 2:235265480-235265502 CAGGGTGAAGACAGGGAGGCTGG - Intergenic
948350459 2:237335954-237335976 CAGGATGGGGAGTGGGAGGCTGG + Intronic
948612051 2:239176187-239176209 AAGGCCGGGCAGAGGGAGGGAGG - Intronic
948612080 2:239176271-239176293 GAGGCCGGGCAGAGGGAGGGAGG - Intronic
948612088 2:239176290-239176312 AAGGCCGGGCAGAGGGAGGGAGG - Intronic
948695151 2:239729521-239729543 CGGGTGGGGCAGAGGGAGGCGGG + Intergenic
948753418 2:240145095-240145117 CAGGCAGGACACAGCCAGGCAGG - Intergenic
948862181 2:240758007-240758029 GAGGGTGGGAACATGGAGGCAGG - Intronic
949050400 2:241894789-241894811 CGGGCAGGGTGCAGGGAGGCAGG - Intronic
1169090746 20:2860126-2860148 CAGGCTGGCCAGAGGCATGCCGG - Exonic
1169367636 20:5003749-5003771 GAGGTTGGGCAGAGGAAGGCAGG - Intronic
1170257381 20:14360095-14360117 CTTGCTGGGCACAGGGTGGTGGG + Intronic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171279477 20:23883761-23883783 CAGGCTGGGACCAGGGAGTTGGG - Intergenic
1171460938 20:25297571-25297593 CAGGCCTGGCACTGGGAGGTGGG + Exonic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172271759 20:33659158-33659180 GAGGATGGAGACAGGGAGGCTGG - Intronic
1172450072 20:35015768-35015790 TAGGCTGGGCACAGTGACTCAGG - Intronic
1172571525 20:35974543-35974565 CAGGCGGAGCACTGGGCGGCTGG + Intronic
1172647639 20:36481159-36481181 CAGGCTAGACACAGGCAGGATGG - Intronic
1172664057 20:36586998-36587020 CAGGCTGGGAACCGGAAAGCCGG - Intronic
1172776364 20:37409512-37409534 CAGCCTGTGCACAGGCAGGTGGG - Intergenic
1173039983 20:39453037-39453059 GAAGCTGGCCACAGGGAAGCTGG + Intergenic
1173614660 20:44394899-44394921 CAGGCTAAGGACAGGGAGGGAGG + Intronic
1173741668 20:45406429-45406451 CCGGCTGGGCGGAGGGAGGAAGG + Intronic
1173791178 20:45828691-45828713 CAGGCTGGGCACTGGGGAGTAGG + Intronic
1173899487 20:46576704-46576726 CAGGCTGTGACCAGGGAAGCAGG + Intronic
1174204753 20:48830080-48830102 CAGGCTGGGCACAGTGGCTCCGG + Intergenic
1174283960 20:49459165-49459187 ATGGCTGGACACGGGGAGGCAGG + Intronic
1174484534 20:50852874-50852896 CAGGCTGGGCAGGGAGAGGTGGG - Intronic
1174846464 20:53948124-53948146 CACGCTGGGCAAACAGAGGCAGG - Intronic
1175173760 20:57097402-57097424 CGGGCAGGGCTCAGGGTGGCTGG - Intergenic
1175292451 20:57885277-57885299 CAGGCTGGGACCAGGGTCGCAGG - Intergenic
1175322528 20:58099516-58099538 CTGCCAGGGCACAGGTAGGCCGG + Intergenic
1175809583 20:61850777-61850799 CAGGCTGGGCACACCCAGGGTGG - Intronic
1175836976 20:62002204-62002226 CACGCTGGGCCCAGGCATGCTGG + Intronic
1175852963 20:62103783-62103805 CAGGGTGGACCCAGGGTGGCAGG + Intergenic
1175940406 20:62535154-62535176 GAGGGTGGGGACAGGCAGGCCGG + Intergenic
1175974216 20:62702285-62702307 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175974240 20:62702355-62702377 CAGGGTGGGCAGAGGGAGCCTGG + Intergenic
1175993083 20:62799111-62799133 CAGGCAGGGCACAGTCAGGTGGG + Intronic
1176013564 20:62914651-62914673 CAGGCTTGCCCCAGGGAGGCAGG + Intronic
1176237877 20:64062754-64062776 CAAACTGGGCTCTGGGAGGCTGG + Intronic
1176623670 21:9074383-9074405 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1176795979 21:13371641-13371663 CATGCTGGCCACTGGGTGGCTGG + Intergenic
1176808452 21:13514912-13514934 CATGCTGGTCACTGGGTGGCAGG + Intergenic
1177956597 21:27606235-27606257 CATGCTGGAGCCAGGGAGGCTGG - Intergenic
1179618335 21:42595950-42595972 CAGGACGGCCACGGGGAGGCCGG + Intergenic
1179640614 21:42745228-42745250 CGGGGTGGGCGCAGGGAGGAAGG + Intronic
1179880270 21:44290699-44290721 CAGGCAGGGCACAAGGACGGTGG + Intronic
1179982292 21:44901766-44901788 CAGGCTGGGCCCAGGTGGGAGGG + Intronic
1180078573 21:45475664-45475686 CTGGCTGGGGACAGGGATGCTGG + Intronic
1180168118 21:46040516-46040538 CAGGCTGGGCGCAGGGACCAGGG + Intergenic
1180548954 22:16526907-16526929 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1180624605 22:17185891-17185913 GAGGCTGTTCACATGGAGGCCGG - Intronic
1180799248 22:18624167-18624189 AGGGCTGGGCCCAGGGAAGCAGG + Intergenic
1180799365 22:18624600-18624622 CAGGCTGTGGGCAGGGAGGAGGG + Intergenic
1180802119 22:18636833-18636855 CCAGCAGGGCACGGGGAGGCTGG - Intergenic
1180853358 22:19032385-19032407 CCAGCAGGGCACAGGGAGGCTGG - Intergenic
1181219603 22:21358426-21358448 CCAGCAGGGCACGGGGAGGCTGG + Intergenic
1181222353 22:21370666-21370688 CAGGCTGTGGGCAGGGAGGAGGG - Intergenic
1181222470 22:21371099-21371121 AGGGCTGGGCCCAGGGAAGCAGG - Intergenic
1181273435 22:21674024-21674046 CAGGCAGGGCCCACGGAGGGCGG + Intronic
1181318190 22:21984822-21984844 CAGGGTGGTGGCAGGGAGGCAGG - Intergenic
1181335650 22:22125889-22125911 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1181638113 22:24183652-24183674 CAGGCTGTGGGCAGGGAGGAGGG - Intronic
1181761646 22:25062756-25062778 CAGGCTGGGAACTGAGAGGATGG + Intronic
1182686416 22:32123826-32123848 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1182696514 22:32202593-32202615 CATGCTGGCCACTGGGTGGCAGG + Intronic
1182740245 22:32562316-32562338 CAGGCTGAGGACAGGGCAGCGGG + Intronic
1182898789 22:33880827-33880849 CAGAATGGGCACAGCGAGGCAGG - Intronic
1183019791 22:35018104-35018126 GAGGCTGGGCACTGGGAGTGGGG - Intergenic
1183058607 22:35321845-35321867 CAGGTGGGGCACAGGGAGGATGG + Intronic
1183107757 22:35627213-35627235 GAGGCAGGGCAGAGGGAGACAGG + Intronic
1183270701 22:36860967-36860989 CAGGCTAGGCCCAGAGAGCCTGG + Exonic
1183292695 22:37012506-37012528 CAGGTTGGGCACTGGGAGTGGGG - Intronic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183579067 22:38712407-38712429 GAGGCTGGGCAGAGGAAGGCAGG + Intronic
1183588416 22:38766413-38766435 CAGGCTGGGCCCAGGGAAGGGGG + Intronic
1183606766 22:38871039-38871061 GAAGCTGGGGGCAGGGAGGCAGG + Intronic
1183733709 22:39631996-39632018 CCAGCTGGGCAGAGTGAGGCGGG + Intronic
1184094451 22:42309080-42309102 CCGGCCGGCCACAGAGAGGCTGG + Intronic
1184247445 22:43242735-43242757 CAGGCTGGGGACAGAGAGACTGG - Intronic
1184258759 22:43302482-43302504 CAGGCAGGGCAGGGGGCGGCTGG + Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184555979 22:45233314-45233336 CAGGGTGGGCAGACTGAGGCAGG + Intronic
1184651041 22:45919581-45919603 CGGGCTGGGCACAGCAAGGATGG + Intergenic
1184812359 22:46844762-46844784 CGGTCTGAGCACAGTGAGGCTGG + Intronic
1185044831 22:48523637-48523659 CAAGTTGGGCACAGAGGGGCTGG - Intronic
1185046543 22:48531347-48531369 CAGGAAGGGGACAGGCAGGCCGG - Intronic
1185206468 22:49541772-49541794 TGGGCTGGACACAGGGAGGATGG - Intronic
1185221088 22:49629612-49629634 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221109 22:49629676-49629698 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221140 22:49629772-49629794 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185221151 22:49629804-49629826 CTGGGTTGGAACAGGGAGGCTGG + Intronic
1185276723 22:49953102-49953124 GGGGCTGGGCACAGTGGGGCTGG + Intergenic
949556357 3:5156837-5156859 GAGGCTGGGGGCGGGGAGGCAGG - Intronic
950109863 3:10412134-10412156 CAGCATGGGCACAGTGTGGCAGG - Intronic
950264310 3:11562969-11562991 CAGGCTGGGGAGAGGGAGACAGG + Intronic
950415938 3:12869116-12869138 CAGCCTGGGCAAAGAGAGCCCGG - Intronic
950417386 3:12876231-12876253 CAGCCTGGGCAAAGAGAGCCCGG - Intergenic
951110351 3:18796108-18796130 CAGGCTGGGCTCTGGTAGGTGGG + Intergenic
952165101 3:30739322-30739344 GAGGATGGGCACAGGAAGGAGGG - Intronic
953193873 3:40713921-40713943 CAGGCTGGGCAGAAAGTGGCTGG - Intergenic
953901631 3:46846941-46846963 GGGGCTGGGAACAGGAAGGCTGG + Intergenic
953913958 3:46906304-46906326 CAGCCTGGGCTGAGGGAGACAGG - Intergenic
953930652 3:47004240-47004262 CAGGCTGGGGTCTGGGAGTCTGG - Exonic
953982253 3:47418706-47418728 CCTGCTGGGCACTGGGAAGCAGG - Exonic
954370980 3:50169503-50169525 CAGGCTGGGCACAGGTTGGGAGG - Intronic
954389833 3:50262892-50262914 GAGGACAGGCACAGGGAGGCGGG - Intergenic
954406164 3:50346109-50346131 CAGTCTGGACATAGGGAGGATGG - Exonic
954414823 3:50388154-50388176 CAGGCGGGGCAGACGCAGGCGGG - Intronic
954415409 3:50391036-50391058 CTGGCTTGGCAGAGGCAGGCAGG + Intronic
954421382 3:50420823-50420845 CAGGCTGGGGGCAAGGAGGAAGG - Intronic
954673816 3:52304754-52304776 CAGGCAGGGCACAGGTGGGGTGG + Intergenic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
954699706 3:52444929-52444951 CAGGCGGGGCACACTGGGGCCGG + Exonic
954708890 3:52495333-52495355 CAGGCACAGCACAGGCAGGCGGG - Exonic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
956170222 3:66427516-66427538 CAGGCTGGGCACAGTGACTCTGG + Intronic
956176966 3:66482090-66482112 CAGCCTGGGCACAGGCAGGCTGG + Intronic
956456063 3:69421403-69421425 CAGGCTGGGTACAGGATGACAGG + Intronic
958932370 3:100221351-100221373 CAGGCTAACCACAGGGAGTCAGG - Intergenic
959856613 3:111166168-111166190 CAGAATGGGCAAAGGAAGGCTGG + Intronic
960623821 3:119661019-119661041 CAGGCCAGGCACAGGCAGCCTGG + Intronic
960658135 3:120028750-120028772 GAGGCTGGGCAGAGAGAGGTTGG + Intronic
960688050 3:120313711-120313733 GAGGGAGGGCACAGGCAGGCTGG - Intergenic
961305978 3:125959312-125959334 CAGGCTGGCCACAGTGACACGGG - Intergenic
961372630 3:126440806-126440828 CAGCCTGGGCAGAGGTGGGCTGG - Intronic
961387937 3:126534906-126534928 CCGGCTGGGGACAGGGATGCTGG - Intronic
961387953 3:126534970-126534992 CCGGCTGGGGACAGGGATGCTGG - Intronic
961443143 3:126964764-126964786 CAGGGTGTGCACCTGGAGGCGGG + Intergenic
961448900 3:126993578-126993600 CAGGTTGGGTGCTGGGAGGCAGG - Intronic
961520012 3:127461721-127461743 CAGGCTGGCCCCAGGGAATCAGG - Intergenic
961635574 3:128330700-128330722 CAGCCTGGGCACAAGGGGGCAGG + Intronic
961829409 3:129615811-129615833 CAGGCAGGGCACAGCAAGGGCGG + Intergenic
962349209 3:134644489-134644511 AAGGCTGGGCAAGGGGAGGATGG + Intronic
963225126 3:142854661-142854683 CAGGCTGGGCCCAAGGTGGATGG - Intronic
963745053 3:149117423-149117445 CAGGCTGAGCAAAGGAAGGTAGG - Intergenic
965749476 3:171961100-171961122 CCGGCGGGGAACAGGCAGGCAGG - Intergenic
966815212 3:183884814-183884836 GAGGCTGGGCGCAGAGAGGCTGG - Exonic
966888153 3:184387972-184387994 CAGGCTGGGCACAGGCCAGCCGG - Exonic
967105833 3:186254440-186254462 CAGGCTGTGCAAAGGCAGGGAGG - Intronic
967948722 3:194824104-194824126 CATGGTGGGCACAGGGTAGCGGG - Intergenic
968474844 4:799376-799398 AGAGCTGGGCACATGGAGGCTGG + Intronic
968566548 4:1316535-1316557 ATGGCTGGGCATGGGGAGGCTGG - Intronic
968701475 4:2059971-2059993 CAGGCTGGTCCCCGGGAGCCGGG - Intronic
968731768 4:2272435-2272457 CTGGTTAGGCACAGGGAGTCTGG - Intronic
968813286 4:2809508-2809530 CAGGCTGGGTACAGGGTCCCTGG + Intronic
968890054 4:3363969-3363991 GAGGCCGGGCACTGGGAGTCTGG + Intronic
968904082 4:3443687-3443709 CAGGCAGGGGACAGGTGGGCAGG + Intronic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
968983022 4:3860955-3860977 CGGGTTGGACACAGGGAGGCTGG - Intergenic
968983060 4:3861107-3861129 CAGCGTGGACACAGGAAGGCTGG - Intergenic
969489334 4:7490318-7490340 CAGGCCTGGCAGAGGGAGGCAGG - Intronic
969490961 4:7498981-7499003 GAGGCTGGGGAAAGGGGGGCAGG + Intronic
969568899 4:7996396-7996418 CAGCCTGGGCACTGGGAACCTGG - Intronic
969616501 4:8255957-8255979 CAGGGGGAGGACAGGGAGGCAGG - Intergenic
969622092 4:8283792-8283814 GAGCCTCGTCACAGGGAGGCTGG - Intronic
969696895 4:8740075-8740097 CAGGCTGGGCAGGGGGAGGGTGG + Intergenic
970550592 4:17177188-17177210 CAAACTGAGCAGAGGGAGGCAGG + Intergenic
971235937 4:24842489-24842511 GTGGGTTGGCACAGGGAGGCTGG - Intronic
971378830 4:26078100-26078122 CAGGCAGGGCACAGGTTTGCTGG - Intergenic
971440098 4:26676434-26676456 CAGGCTGGGCACAGTGGCTCAGG + Intronic
972457690 4:39270303-39270325 CAGTGTGGGGACAGGGAGACGGG + Intronic
972546528 4:40085315-40085337 CAGGCTGGGCGCAGTGACTCAGG - Intronic
973216058 4:47670667-47670689 CAGCATGGGCACAGGGAGGCAGG + Intronic
973533021 4:51851655-51851677 CAGGTGGGGCACAGGGAGGGAGG + Intronic
979538963 4:121857398-121857420 CAGGCTGGGCACAGCGGCTCAGG - Intronic
980154834 4:129092008-129092030 TAAGTTGGGCACAGGGAGACTGG - Intronic
980405856 4:132353524-132353546 CAGGCTGGGCAACAGTAGGCAGG + Intergenic
984067034 4:175061899-175061921 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
984742048 4:183174251-183174273 CAGGTTGGGCAAAGGCAGGCAGG + Intronic
985279034 4:188269045-188269067 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279050 4:188269095-188269117 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279066 4:188269145-188269167 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279082 4:188269195-188269217 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279098 4:188269245-188269267 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279114 4:188269295-188269317 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279130 4:188269345-188269367 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279146 4:188269395-188269417 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279162 4:188269445-188269467 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279178 4:188269495-188269517 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279194 4:188269545-188269567 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279210 4:188269595-188269617 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279226 4:188269645-188269667 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279242 4:188269695-188269717 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985279258 4:188269745-188269767 TAGCCTGGGCATAGGGAGGAGGG - Intergenic
985487126 5:158192-158214 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487145 5:158233-158255 CAGGATGGGCAGGGGGAGGAGGG - Intronic
985487255 5:158552-158574 CAGGACGGGCAGAGGGAGGAGGG - Intronic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985513581 5:325497-325519 CAGGTTGGGCACTTGGTGGCTGG - Intronic
985956493 5:3269615-3269637 CTGGCTGGGCCCACGGAGGACGG + Intergenic
986346134 5:6837130-6837152 CTGGCTGGAGTCAGGGAGGCTGG + Intergenic
986450355 5:7857475-7857497 CAGGGTTGGCCCAGGGAGGGAGG - Intronic
986612869 5:9587344-9587366 CAGGCAGGGCCTGGGGAGGCAGG + Intergenic
986792915 5:11181033-11181055 CAGGCTGGGCAGAGGCTGACTGG + Intronic
987710285 5:21495523-21495545 GAGGCTGGGCATAGGGAGATGGG + Intergenic
988079795 5:26401160-26401182 CAGGCTGGGCAAGAGAAGGCAGG + Intergenic
988749327 5:34178650-34178672 GAGGCTGGGCATAGGGAGATGGG - Intergenic
989480627 5:41925868-41925890 GACGCTGGGAACAGGGACGCTGG - Intronic
990977633 5:61573296-61573318 CAGGCTGGCCTCAGGGAAGGGGG - Intergenic
991674717 5:69079579-69079601 CAGGCTGGGCACAGTGGCTCAGG + Intergenic
991676607 5:69094461-69094483 CAGCCTGCGCGCAGGGAGGCAGG - Intronic
991737582 5:69641842-69641864 GAGGCTGGGCATAGGGAGATGGG - Intergenic
991760612 5:69914583-69914605 GAGGCTGGGCATAGGGAGATGGG + Intergenic
991786720 5:70203518-70203540 GAGGCTGGGCATAGGGAGATGGG - Intergenic
991789158 5:70221568-70221590 GAGGCTGGGCATAGGGAGATGGG - Intergenic
991813908 5:70496674-70496696 GAGGCTGGGCATAGGGAGATGGG - Intergenic
991817039 5:70517958-70517980 GAGGCTGGGCATAGGGAGATGGG - Intergenic
991839843 5:70789633-70789655 GAGGCTGGGCATAGGGAGATGGG + Intergenic
991879165 5:71203903-71203925 GAGGCTGGGCATAGGGAGATGGG - Intergenic
991881605 5:71221932-71221954 GAGGCTGGGCATAGGGAGATGGG - Intergenic
991946174 5:71900409-71900431 CAGGCTGGGGAAAAGAAGGCAGG - Intergenic
992256169 5:74923305-74923327 CGGGCTGGGGACAGGGAGACGGG - Intergenic
992365478 5:76084811-76084833 CCGGCGGGGCAGAGGGGGGCGGG + Intronic
993603561 5:89958790-89958812 AAGGCTGAGGCCAGGGAGGCAGG - Intergenic
994460132 5:100061912-100061934 GAGGCTGGGCATAGGGAGATGGG - Intergenic
994484280 5:100375337-100375359 GAGGCTGGGCATAGGGAGATGGG - Intergenic
995542811 5:113201102-113201124 CTGGCTGGGCACAGGGGCTCAGG + Intronic
997265197 5:132491063-132491085 CAGGCTGGGGCCAGGGGCGCTGG - Intergenic
997347704 5:133204071-133204093 CAGGGTGGGGACAGCAAGGCTGG + Intronic
997362845 5:133306080-133306102 CATGCTGGGCCCTGGCAGGCTGG - Intronic
997644152 5:135469039-135469061 TAGGCTGGGCCCAAGGAGGTGGG - Intergenic
997831087 5:137150665-137150687 CAGGCAGGGCTCAGCAAGGCAGG + Intronic
998134113 5:139665754-139665776 CAAGCTGGGCAGAGGGACCCCGG + Intronic
998399049 5:141838437-141838459 CAGGCGGGGCACATTGATGCTGG + Intergenic
998407074 5:141880015-141880037 CACGCTGGGGGCAGGGAGACCGG - Intergenic
998471172 5:142385056-142385078 CAGGCTGGGAAAAGTGGGGCTGG - Intergenic
998537549 5:142948547-142948569 CAGCATGGCCACAGGGATGCTGG - Intronic
998655178 5:144170690-144170712 CAGGTTGGGCACCGGTGGGCGGG + Intronic
999153530 5:149442245-149442267 CAGGCTGGGCAGCGAGGGGCTGG - Intergenic
999295921 5:150459367-150459389 CAGGCAGGGCACACAGAGGCCGG - Intergenic
1001401357 5:171448369-171448391 CAGGAAGGGCACAGGGAGTGAGG - Intronic
1001581720 5:172803103-172803125 CAGCCTGGGGACATGGAGGGAGG + Intergenic
1001972964 5:175971537-175971559 GAGGCTGGGCACAGTGACTCAGG - Intronic
1002102512 5:176864397-176864419 CGTGCTGGGCACAGGGAGACTGG + Intronic
1002244474 5:177872252-177872274 GAGGCTGGGCACAGTGACTCAGG + Intergenic
1002281241 5:178131147-178131169 AAGGCTGGGGCCCGGGAGGCCGG - Intronic
1002290897 5:178200044-178200066 CAGGCTGGGGCCATGGAGACTGG - Intergenic
1002319972 5:178369160-178369182 TAGGCAGGCCTCAGGGAGGCTGG + Intronic
1002349148 5:178570739-178570761 CAGGCTGAGCACATGGAGGGGGG + Intronic
1002377021 5:178796104-178796126 CAGGCTGGGCCCAGGGCTGCAGG + Intergenic
1002724130 5:181283274-181283296 CATGCTGGCCACTGGGTGGCAGG - Intergenic
1002988849 6:2218949-2218971 TAGGCTGGGCACAGTGATTCAGG + Intronic
1003112241 6:3259793-3259815 CAGGCTTGGCCCAGCGCGGCAGG - Intronic
1003395510 6:5749279-5749301 GTGGCTGGGGACAGGCAGGCTGG + Intronic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1003974101 6:11326656-11326678 CAGGAGGGGCAGAGGGAAGCTGG - Intronic
1004304928 6:14491757-14491779 GATGCTGGGCACAGGGAAGTTGG - Intergenic
1004321306 6:14633679-14633701 GAGGCTGAGCCCAGGGAGTCTGG - Intergenic
1005547401 6:26884996-26885018 GAGGCTGGGCATAGGGAGATGGG - Intergenic
1006030013 6:31171513-31171535 CAGGCTGGGCAGATGGTGCCAGG - Intronic
1006285430 6:33089796-33089818 AAGGAGGGGCACAGGGATGCTGG + Intergenic
1006300505 6:33191496-33191518 CTGGCTGGCCAGAGGGAGGAGGG + Intronic
1006370787 6:33642515-33642537 CAGGCTGGTGACAGGGAGGTGGG + Intronic
1006383793 6:33717524-33717546 GAGGCTGGGGACAGGGTGGTGGG - Intergenic
1006407945 6:33856063-33856085 CAGTCTGGGGCCAGGGAGGGAGG - Intergenic
1006444019 6:34068852-34068874 CTGGCTGGGCCCCGAGAGGCCGG - Intronic
1006625122 6:35392414-35392436 CAGTCTGGGCAGGCGGAGGCTGG - Intronic
1006639693 6:35483597-35483619 CTGGCTGGAGACAGAGAGGCTGG - Intronic
1006642463 6:35496412-35496434 CGGCCTGGGCGCTGGGAGGCCGG + Intronic
1006716475 6:36123845-36123867 TGGGCTGGGTGCAGGGAGGCAGG + Intergenic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1006947057 6:37791624-37791646 CAGGCTGGCCACATGGGGGCGGG + Intergenic
1007040091 6:38713886-38713908 CAGGCAGTGGACTGGGAGGCAGG + Intergenic
1007418059 6:41703489-41703511 CAGACCAGCCACAGGGAGGCTGG - Intronic
1007633499 6:43285238-43285260 CAGGCTGGGCCCGGGCCGGCGGG - Exonic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1007757427 6:44109298-44109320 GAGGCTGCGCACGGGGAGGTTGG + Intergenic
1008095646 6:47336885-47336907 TAGGCAGGGCACAGACAGGCTGG - Intergenic
1012620613 6:101339698-101339720 CAGCATGGCCACAGGGAGGCAGG - Intergenic
1012939734 6:105403438-105403460 CAGCCCGGGAACAGGAAGGCTGG - Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1014474606 6:121857137-121857159 CAGGCTGTGCACTGTGAGGCTGG - Intergenic
1014928379 6:127302679-127302701 AAGGCTGGGCACAGTGGGTCAGG - Intronic
1015123027 6:129721958-129721980 CAGGATGGGGAAGGGGAGGCAGG + Intergenic
1015591515 6:134827240-134827262 CAGGCTGACCGCAGGGAGGTGGG + Intergenic
1016238962 6:141905599-141905621 CAGCCTGGGCAGAGAGAGACTGG + Intergenic
1016368279 6:143342256-143342278 GAGGCTGGGCGCAGAGAGGCTGG + Intergenic
1017456333 6:154604479-154604501 CTGGGAGGGGACAGGGAGGCAGG - Intergenic
1017817036 6:158023346-158023368 TAGGCAGGACACAGTGAGGCTGG + Intronic
1017822652 6:158060408-158060430 TAGGCAGGGGACATGGAGGCTGG - Intronic
1017971343 6:159315168-159315190 CACCCTGAGCTCAGGGAGGCAGG - Intergenic
1018054706 6:160041716-160041738 CAGGCGGTTCACAGTGAGGCAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018587376 6:165376631-165376653 CAGGCTGGGCACAGCGGCTCTGG + Intronic
1018892120 6:167989900-167989922 CTGCGTGGGTACAGGGAGGCCGG - Intergenic
1018990549 6:168670474-168670496 CAGGATGGGCACGGGTGGGCTGG + Intronic
1019219661 6:170463728-170463750 CAGGCTGGGCCGGGGCAGGCAGG - Intergenic
1019271923 7:154279-154301 CAGGCTGCTCTCGGGGAGGCTGG - Intergenic
1019329455 7:455467-455489 CAGGCCTGGCACAGGGAGGAGGG - Intergenic
1019357798 7:590070-590092 GAGGCAGGGCCCAGGGAGCCAGG - Intronic
1019359836 7:599026-599048 CAGGCAGGACCCAGGGAAGCTGG + Intronic
1019384453 7:746677-746699 CAGGGTGGGCAGGGGGTGGCAGG - Intronic
1019444259 7:1063013-1063035 CAGGCTTGGCAAAGCCAGGCAGG - Intronic
1019468389 7:1203227-1203249 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1019539183 7:1544148-1544170 CAGGCTGGGCCCAGAGCCGCAGG - Exonic
1019539807 7:1546533-1546555 CAGGCTGGGCAGCTGGAGGGAGG - Exonic
1019541522 7:1553818-1553840 CAGGCAGGACACAGAGTGGCTGG - Intronic
1019742562 7:2682140-2682162 CAGGCTGGGCACAGGGAGGCTGG + Intronic
1019979321 7:4609546-4609568 CAGGGTGGGGGCAGGGGGGCTGG + Intergenic
1020092492 7:5349349-5349371 AGGGCTGGGGACAGGGAGGGGGG + Intronic
1020633798 7:10672236-10672258 CCTGCTGGGGCCAGGGAGGCTGG - Intergenic
1020927569 7:14351400-14351422 TTGGCAGGGCACAGGGAGCCTGG + Intronic
1021141669 7:17033475-17033497 GAGGCTGGGCACAGGGCGAGAGG + Intergenic
1023905018 7:44515989-44516011 CAGGCAGGGCACAGGGCATCAGG + Intronic
1023905023 7:44516008-44516030 CAGGCAGGGCACAGGGCATCAGG + Intronic
1024044787 7:45579307-45579329 GAGGCTGGGGAAAGGGAGGCAGG - Intronic
1024270385 7:47637094-47637116 CAGGCGCGGCCCAGGGAGGCTGG - Intergenic
1024511560 7:50208247-50208269 CATGCTGGGGTCAGGGAGGGAGG + Intergenic
1024580603 7:50797418-50797440 CAGCCTGGGCCCAGAGAGACGGG - Intergenic
1024607591 7:51035058-51035080 GAGGCTGGGCCCAAGGACGCAGG - Intronic
1025927224 7:65969913-65969935 GAGGCTGGGCATAGGGAGATGGG - Intronic
1026024187 7:66732052-66732074 CAGGCTGGGCTGGGGGTGGCTGG - Intronic
1026277039 7:68889091-68889113 CAGGCTGGGCTCAGCAGGGCAGG - Intergenic
1026795155 7:73361607-73361629 TGGGCTGGGGACAGGGAGCCAGG - Intergenic
1026837490 7:73648180-73648202 CGGGCTGGGCTCGGGGAGGGAGG + Intergenic
1026888911 7:73970944-73970966 CAGGCTGGGCTGGGGGTGGCAGG - Intergenic
1026974164 7:74486438-74486460 CAGGCAGGGCATAGGGAGTAAGG + Intronic
1027156616 7:75772777-75772799 CAGGCAGGCCCCAGGGAGTCTGG + Intronic
1027378458 7:77578039-77578061 CAGGCTGGCTACATGCAGGCTGG - Intronic
1028644136 7:93076665-93076687 CTGGCTGGAGCCAGGGAGGCTGG + Intergenic
1029225776 7:99027477-99027499 CAGGCTGGGCCCAGGAGGTCAGG - Exonic
1029248107 7:99217208-99217230 CGGGCTGGGCACACAGAGGGTGG - Intergenic
1031979392 7:128115042-128115064 CAGGCTGGACACAGGGAGGGAGG - Intergenic
1032125191 7:129188587-129188609 CAGCCTCGGCGCAGGGGGGCCGG + Intergenic
1032188350 7:129747084-129747106 CAGGCAGAGCACAGGGCTGCAGG - Intronic
1032329259 7:130962498-130962520 CAGCCTGTGCACTGGGAGGAGGG - Intergenic
1032513757 7:132492158-132492180 CAGGGTGGGGACACTGAGGCAGG + Intronic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1032825205 7:135561944-135561966 CAGCCTGGGCAGAGTGAGGGAGG - Intronic
1033344989 7:140519601-140519623 CAGGCTGGGCACCCAGAGCCCGG + Intronic
1033589557 7:142797859-142797881 CAGGCTGGGAACAGCGCGGGTGG + Intergenic
1034406178 7:150903749-150903771 CAGCCAGGGCCCAGGGTGGCAGG + Intergenic
1034413920 7:150955295-150955317 CAGGCTGGGGAGAGGGCTGCTGG - Intronic
1034990206 7:155543178-155543200 CCGGCTGGCCACAGAGCGGCAGG - Intergenic
1035106012 7:156441930-156441952 CGGTCTGGGCCCTGGGAGGCTGG - Intergenic
1035246932 7:157568698-157568720 CAGGCTCGGCACGCAGAGGCAGG + Intronic
1035275446 7:157745471-157745493 CAGGGCAGGCTCAGGGAGGCAGG + Intronic
1035352912 7:158258983-158259005 CAGCGTCGGTACAGGGAGGCAGG + Intronic
1036587300 8:10136169-10136191 CACGCTGGGCACAGGGACCCCGG + Intronic
1037703608 8:21296877-21296899 CGCTCTGGCCACAGGGAGGCAGG + Intergenic
1037770163 8:21794133-21794155 CAGGCTGGGCACAGTGGCTCAGG - Intronic
1037801225 8:22037001-22037023 GGGGCTGGGTGCAGGGAGGCAGG - Intergenic
1037868650 8:22469798-22469820 CAGACAGGGCACAGTGGGGCTGG - Intronic
1038061867 8:23922830-23922852 CACGCTGGGCGCTGGGAGGATGG + Intergenic
1038524682 8:28262867-28262889 CAGGCAGGGCTCAGAGCGGCAGG + Intergenic
1038611960 8:29066633-29066655 CACGCTGGGCACAGCTGGGCGGG + Intergenic
1038828628 8:31033384-31033406 CAGGCTGTGCCGGGGGAGGCGGG - Exonic
1039469257 8:37803374-37803396 CTGGCTGCTCCCAGGGAGGCTGG - Intronic
1039475585 8:37837823-37837845 CAGGAGGGGCCCGGGGAGGCTGG + Exonic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039646535 8:39290430-39290452 CTGGCTTGGCCCAGGAAGGCAGG - Intergenic
1039779201 8:40767348-40767370 AAGGCTGGGTAAGGGGAGGCAGG - Intronic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1040385041 8:46909394-46909416 CAGGCTGGGAACAGATAGCCTGG + Intergenic
1040601635 8:48890475-48890497 CACGCTGGGCGCAGGGATGCGGG + Intergenic
1040840469 8:51779485-51779507 CATGCAGGGCACAGAGAGGAGGG + Intronic
1042020833 8:64370365-64370387 CAGGCTGGGACCGGGCAGGCAGG - Intergenic
1044356159 8:91225019-91225041 CCTGCTGGGGCCAGGGAGGCTGG - Intronic
1045287716 8:100806344-100806366 AAGGCTGGGCACAGGGACTATGG - Intergenic
1045341289 8:101256945-101256967 CAGGATGGGCACCTGGAGCCGGG + Intergenic
1045488126 8:102649937-102649959 CAGGCAGGTCACAGAAAGGCAGG - Exonic
1045495035 8:102700864-102700886 GGGGCTGGGCCCTGGGAGGCTGG - Intergenic
1047801810 8:128318028-128318050 CAAGCTGTGCACAGTGGGGCAGG + Intergenic
1047927468 8:129695594-129695616 CATGCTGACCACAGGGAGGTGGG - Intergenic
1048382104 8:133874281-133874303 CAGGCTGGCCAAAGGAAGGCTGG + Intergenic
1048804669 8:138228887-138228909 CAGACTGGGGACAGAGAAGCAGG + Intronic
1048888022 8:138924309-138924331 CAGGCTGGGCAGACCCAGGCTGG - Intergenic
1048987082 8:139740460-139740482 CATGCTGGGCAGGGGGAGGCAGG + Intronic
1048999531 8:139815989-139816011 CAGGCTGGGGACCGGGCGGGTGG + Intronic
1049205053 8:141359716-141359738 GAGGCTGGGCACATGGGGGCTGG + Intronic
1049206757 8:141367155-141367177 GAAGCTGGGGAGAGGGAGGCTGG + Intronic
1049233568 8:141496643-141496665 CTGGCTGGGCCCTGGGAGGAGGG + Intergenic
1049250666 8:141587250-141587272 CAGGCTGGGGACACAGAGGTTGG + Intergenic
1049358888 8:142202457-142202479 CAGGCTGAGCACCGGGGGCCTGG + Intergenic
1049392975 8:142381504-142381526 CAGGGTGGGCTCAGGGACGGTGG + Intronic
1049474499 8:142790512-142790534 CAGGCTTGGCCCTGGGAAGCAGG - Intergenic
1049576378 8:143391783-143391805 CAGGTGGGGCACAGGCAGGTGGG - Intergenic
1049606257 8:143530507-143530529 CAGCCTGGGCACAGGGTGGTGGG + Intronic
1049708883 8:144054934-144054956 CAGAGTGGGCACAGGGGAGCAGG + Intronic
1051036544 9:12753891-12753913 CAGACTGGTCACTGGGTGGCAGG - Intergenic
1051894733 9:21975198-21975220 GCGGCTGGGAGCAGGGAGGCCGG - Intronic
1052344981 9:27400399-27400421 CAGGATGTGCACAGCTAGGCGGG - Intronic
1052835915 9:33249817-33249839 GAGAATGGGCACAGGAAGGCAGG + Intronic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053274112 9:36770557-36770579 CAGGCTGGGCAGAGGGGGAAGGG + Intergenic
1053299220 9:36936741-36936763 CAGGGTGGGGACAGGGAGGTGGG + Intronic
1053372792 9:37576466-37576488 CAGGAGGGGCACCGGGAGGCGGG + Intronic
1053379307 9:37636009-37636031 CTGGCAGGGCAGAGGGCGGCAGG + Intronic
1053415563 9:37944955-37944977 CAGGCTGAGCCCCTGGAGGCTGG + Intronic
1053532884 9:38899304-38899326 GGGGCAGGGCACAGTGAGGCTGG - Intergenic
1053886271 9:42646708-42646730 CATGCTGGCCACTGGGTGGCTGG - Intergenic
1054205110 9:62123733-62123755 GGGGCAGGGCACAGTGAGGCTGG - Intergenic
1054225291 9:62454157-62454179 CATGCTGGCCACTGGGTGGCTGG - Intergenic
1054633249 9:67464637-67464659 GGGGCAGGGCACAGTGAGGCTGG + Intergenic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055514745 9:77023286-77023308 CTGGCTGGGCACACGGAAGCTGG - Intergenic
1055934714 9:81593948-81593970 CAGGCTGGGCTAAAGGAGACCGG - Intronic
1056738018 9:89226195-89226217 GAGACAGGGGACAGGGAGGCTGG - Intergenic
1056762350 9:89424627-89424649 CAGGCAGGACACAGTGAGGAAGG - Intronic
1057182138 9:93035957-93035979 CAGGCTGGGCAGAGGCGGGGTGG - Exonic
1057227596 9:93300731-93300753 CATGCAGGGCACAGGGCGGTGGG - Intronic
1057305691 9:93910821-93910843 CAGGCTGGCCACAGGGTGGCAGG + Intergenic
1057371796 9:94480230-94480252 CAGGCTGGCCACTGGGTGGGAGG - Intergenic
1057379124 9:94553400-94553422 CACGCTGGCCACTGGGCGGCAGG + Intergenic
1057510887 9:95678696-95678718 CAGGCTGGGTGCAGGGAGAGTGG + Intergenic
1057605018 9:96492841-96492863 CAGCCTGGGAAGAGGCAGGCTGG + Intronic
1057794104 9:98143401-98143423 CAGGGTGGAGACTGGGAGGCAGG + Intronic
1058419414 9:104820066-104820088 CAGCCTGGGGACAGGGAGGCAGG + Exonic
1058868551 9:109183249-109183271 CAGGCAGGGTACAAGGCGGCTGG + Intronic
1059108600 9:111533398-111533420 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1059415233 9:114158086-114158108 CCGTCTGGGCACAGGGGGTCTGG + Intronic
1059447945 9:114350699-114350721 AACGCTGGGAACTGGGAGGCAGG + Intronic
1059453528 9:114385872-114385894 CAGGCTGGGCATCAGGAGACAGG + Intronic
1060374351 9:123105306-123105328 CAGGCTGAGCACCTGGGGGCCGG + Intergenic
1060555306 9:124504809-124504831 CGGGCCGGGGACGGGGAGGCGGG + Intronic
1060807765 9:126588266-126588288 CAGGCTCTGCACAGGGAGGCTGG - Intergenic
1060994443 9:127868157-127868179 TAGGTTGGGCTCGGGGAGGCAGG - Intronic
1061084878 9:128393005-128393027 CAGGCTGGGGGCAGGGAGAGGGG - Intergenic
1061117785 9:128625554-128625576 AAGGCTGGGGTCAGGGAGGTGGG + Intronic
1061202701 9:129146775-129146797 TGGGCTGGGCTCAGGGAGTCGGG + Intronic
1061242582 9:129383130-129383152 GAGGGTGGGGGCAGGGAGGCGGG + Intergenic
1061359575 9:130132421-130132443 CAGGGTGGACACAGGACGGCAGG - Intronic
1061446061 9:130638824-130638846 GAGGCTGGGGACAAGGAGGTGGG - Intergenic
1061798580 9:133102393-133102415 GAGCCTGGGCTCAGGGAGTCAGG - Intronic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1061958691 9:133977101-133977123 CAGGCTTGGGGCAGGGCGGCTGG - Intronic
1061996554 9:134188999-134189021 CAGGCTGGGCAAGGGTTGGCAGG + Intergenic
1062025687 9:134339138-134339160 CGGACAGGGCACAGGGAGGCAGG - Intronic
1062109448 9:134773959-134773981 GAGGCTGTGCCCAGGGAGGAGGG - Intronic
1062119838 9:134828244-134828266 CAGGCTGGGCCCAGCAGGGCAGG - Intronic
1062121580 9:134836676-134836698 GATGCTGGGCAGGGGGAGGCGGG - Intronic
1062153595 9:135033936-135033958 CAGGCAGGGGACAGGGTGGCTGG - Intergenic
1062153660 9:135034117-135034139 GAGGCAGGGGACAGGGTGGCGGG - Intergenic
1062191352 9:135249465-135249487 TAGGCAGGGCAGAGTGAGGCTGG - Intergenic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062278730 9:135742621-135742643 CAGGCGGGGCACAGACACGCAGG - Intronic
1062344409 9:136108294-136108316 CAGGCCAGGCACAGGGATGCTGG - Intergenic
1062450582 9:136614148-136614170 AAGGCTGGGCAAGGCGAGGCTGG + Intergenic
1062457720 9:136647275-136647297 CAGGCTGAGCCCAGGGTGGCAGG + Intergenic
1062468833 9:136693279-136693301 CGGGCTGAGCACAGGGGGTCGGG - Intergenic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1062610052 9:137369533-137369555 GACGCTGGGACCAGGGAGGCTGG + Intronic
1062623741 9:137433916-137433938 CGGGCCGGGCACTGGGAGGAGGG - Intronic
1062630635 9:137461659-137461681 CAGGCTGGGGACTGGCAGGCGGG - Intronic
1203746854 Un_GL000218v1:44811-44833 CAGGCTGGGCACAGCGGGGAGGG + Intergenic
1203563254 Un_KI270744v1:74669-74691 CAGGCTGGGCACAGTGGGGAGGG - Intergenic
1185590110 X:1270724-1270746 GGGGCTGGGAACAGGGAGGCTGG - Intronic
1185633156 X:1531456-1531478 CGGGCTGGGCACAGTCAGGCTGG - Intronic
1185870630 X:3662192-3662214 GAAGGTGGGGACAGGGAGGCAGG + Intronic
1186163835 X:6805797-6805819 CAGACTGGGCACAGTGACTCAGG - Intergenic
1186724930 X:12347087-12347109 CAGACTGGGCACAGGAATGCAGG + Intronic
1187425117 X:19170661-19170683 CAGGCTGGGCACAGTGGAGCAGG + Intergenic
1187644155 X:21328501-21328523 CAGGGAGGGCACAGGCAGGTTGG - Intergenic
1187766736 X:22650880-22650902 AAGCCTGGGCACTTGGAGGCTGG - Intergenic
1188146909 X:26625267-26625289 AAGCCTGGGCACAGTGTGGCTGG - Intergenic
1188650491 X:32626187-32626209 CAGGCTGGGCACAGTGGCTCAGG + Intronic
1189229607 X:39441996-39442018 CCGTCTGGGGACAGGGAGACTGG + Intergenic
1189446599 X:41086064-41086086 CAACCAGGGCACACGGAGGCGGG - Exonic
1189496638 X:41514712-41514734 CAGGATGGGCACCAGGAGCCTGG + Intergenic
1190111217 X:47590315-47590337 CAGGGTGGGGACAGGTTGGCTGG - Intronic
1190249123 X:48708809-48708831 CACTCTGGGCACAGGTAGTCAGG - Exonic
1190319632 X:49172434-49172456 CGGCCTGGGCACAGGAGGGCGGG + Intronic
1192583710 X:72304837-72304859 CAGGCTGGGGTCAGGGTGGGTGG - Intronic
1193649086 X:84108782-84108804 TAGGCAGGGAGCAGGGAGGCTGG + Intronic
1193713221 X:84903659-84903681 CAGGCTGGGCACAGTGGCTCAGG - Intergenic
1194206817 X:91019878-91019900 CAGGCAGGGAACATGGAGGCAGG - Intergenic
1195162579 X:102185098-102185120 CAGCCAGGACACAGGGATGCAGG + Intergenic
1195721903 X:107876003-107876025 CAGACTGTCCCCAGGGAGGCTGG - Intronic
1195983112 X:110601058-110601080 CTTGCTGGAGACAGGGAGGCTGG + Intergenic
1196935374 X:120725226-120725248 AATGGTGGGCACAAGGAGGCTGG - Intergenic
1197525091 X:127551437-127551459 GAGGCTGGGCAGAGGGTGGGAGG - Intergenic
1197702978 X:129613523-129613545 TGTGCTGGGCACAGGGAGGGGGG + Intergenic
1197800590 X:130343674-130343696 CAGACTGGGCAATGGGAGGGAGG + Intronic
1199040624 X:143111364-143111386 CAGGCTGGGCAAGAGAAGGCAGG - Intergenic
1199783283 X:151082528-151082550 TAGGCTGACCACAGGGTGGCGGG - Intergenic
1199850709 X:151723354-151723376 GGGGCTGGGGACAGGGAGGTGGG - Intergenic
1199860936 X:151800057-151800079 CAAGCTGGGCAAAGGAGGGCTGG - Intergenic
1199925626 X:152460607-152460629 CAGGCTGGGCACGGTGACTCAGG + Intergenic
1200032384 X:153306974-153306996 GAGGCAGGGCCCAGGCAGGCAGG + Intergenic
1200233740 X:154458556-154458578 CATGCGGGGCACAAGGAGTCGGG - Intronic
1200233842 X:154458892-154458914 CAGGCTGGGGACAGGTCGGGAGG - Intronic
1200552568 Y:4594667-4594689 CAGGCAGGGAACATGGAGGCAGG - Intergenic
1200793402 Y:7318938-7318960 GAAGGTGGGGACAGGGAGGCAGG - Intergenic
1201160178 Y:11159825-11159847 CAGGCTGGGCACAGTGGGGAGGG + Intergenic
1201382177 Y:13393032-13393054 CAGCCTGGGCATAGTGAGACTGG - Intronic