ID: 1019743550

View in Genome Browser
Species Human (GRCh38)
Location 7:2687731-2687753
Sequence AACGAGGCCACCAGGTGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 218}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019743550_1019743560 12 Left 1019743550 7:2687731-2687753 CCTCCTCACCTGGTGGCCTCGTT 0: 1
1: 0
2: 1
3: 15
4: 218
Right 1019743560 7:2687766-2687788 TGGCGCCTTGCCTGATAGCCTGG No data
1019743550_1019743564 30 Left 1019743550 7:2687731-2687753 CCTCCTCACCTGGTGGCCTCGTT 0: 1
1: 0
2: 1
3: 15
4: 218
Right 1019743564 7:2687784-2687806 CCTGGTTCACCCCTCTCACCTGG 0: 2
1: 2
2: 1
3: 29
4: 234
1019743550_1019743553 -8 Left 1019743550 7:2687731-2687753 CCTCCTCACCTGGTGGCCTCGTT 0: 1
1: 0
2: 1
3: 15
4: 218
Right 1019743553 7:2687746-2687768 GCCTCGTTCACCCCCTCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019743550 Original CRISPR AACGAGGCCACCAGGTGAGG AGG (reversed) Intronic
900373913 1:2344647-2344669 GACGAGGCCCCCAGGGAAGGAGG - Intronic
901390738 1:8944281-8944303 AAGGAGGCGGCCAGGTGCGGCGG + Intergenic
901432872 1:9228328-9228350 AACGAAGCAGCCAGGTGAAGTGG + Intergenic
902119252 1:14147930-14147952 AACGTAGGCACCAGGTGTGGTGG + Intergenic
903730514 1:25491592-25491614 AACGTGGGCCCCTGGTGAGGTGG + Intronic
903768552 1:25749897-25749919 CACGGGGGCAGCAGGTGAGGTGG + Intronic
904369643 1:30040307-30040329 GAGGAGGCCCACAGGTGAGGTGG + Intergenic
905606270 1:39303108-39303130 ACCGAGGCCAACAGCAGAGGTGG - Intronic
905807302 1:40886183-40886205 AAGGAGGGCACCTGGGGAGGTGG - Intergenic
906803194 1:48755360-48755382 AGGGAGGCCAACAGGTCAGGAGG - Intronic
908170076 1:61495692-61495714 AAGGAGGCAGCCAGGGGAGGGGG - Intergenic
910665949 1:89726102-89726124 AATGAGGCCACCAAGTGCTGGGG - Intronic
910678950 1:89843408-89843430 AGCGAGGCCACCAGCAGGGGGGG + Intronic
912984960 1:114418550-114418572 AAAGAGACCACCAGGCTAGGAGG + Intronic
914299549 1:146366662-146366684 AAAGAGGGCAGCGGGTGAGGTGG - Intergenic
918107305 1:181425877-181425899 AAGGAGGTCCCCAGGAGAGGCGG - Intronic
919666356 1:200296533-200296555 AAATAGGACTCCAGGTGAGGTGG + Intergenic
919766492 1:201130572-201130594 AAAGAAGCCACCAGGCGCGGTGG + Intergenic
920121919 1:203665215-203665237 AACATGGGCACCAGGTAAGGAGG - Intronic
920761132 1:208784611-208784633 AATGAGGCCACCTGGTTAAGGGG - Intergenic
1062843131 10:686476-686498 AAGGAGGCCACACGGTCAGGAGG - Intronic
1063132234 10:3188405-3188427 CACGATTCCACCAGGAGAGGAGG - Intergenic
1063655580 10:7985305-7985327 ATGGAGGCCAGCAGCTGAGGAGG - Intronic
1066249027 10:33615098-33615120 TAAGAGGCCACCAGGCTAGGAGG + Intergenic
1066455057 10:35565400-35565422 AACAAGCCCACCAGGTGATGGGG + Intronic
1067220682 10:44342010-44342032 AACCAGGCAAAAAGGTGAGGAGG + Intergenic
1067534509 10:47099152-47099174 CACAAGGCCACCAGGTGAGCTGG + Intergenic
1069830118 10:71277777-71277799 CCCGAGGCCACCCGGTGAGTGGG - Intronic
1070113398 10:73506226-73506248 AAAGAGGTCACCAGGTGAGATGG - Intronic
1070269386 10:74938096-74938118 AACGAAACAGCCAGGTGAGGCGG - Intronic
1072627488 10:97122462-97122484 ATCCAGCCCACGAGGTGAGGAGG + Intronic
1075083532 10:119399219-119399241 AGGGAGGCCTCCAGGGGAGGTGG + Intronic
1075974581 10:126684516-126684538 AATGAGACCAGCTGGTGAGGTGG + Intergenic
1076202739 10:128571285-128571307 GACATGGCCAGCAGGTGAGGTGG - Intergenic
1076504476 10:130962808-130962830 CATGAGGTCACCACGTGAGGTGG - Intergenic
1079280521 11:19083113-19083135 ACTGAGGGCCCCAGGTGAGGTGG + Intergenic
1081047694 11:38296490-38296512 AACCAGGCCAGCAGCTGCGGAGG - Intergenic
1083491121 11:63015720-63015742 GACCCGGCCACCAGGTGAGGAGG - Exonic
1084090741 11:66878143-66878165 AGGCAGGCCAGCAGGTGAGGAGG - Intronic
1085317712 11:75555451-75555473 ACAGAGGCCACCATGGGAGGGGG - Intergenic
1089368852 11:117939202-117939224 AGCAAGGCCCCAAGGTGAGGAGG - Intergenic
1090994220 11:131850705-131850727 GACAAGGTCACCAGGTCAGGCGG + Intronic
1091356386 11:134941024-134941046 AAAGAGGCCACCCTGTGGGGGGG + Intergenic
1091548309 12:1519020-1519042 GACGAGCACACCTGGTGAGGCGG - Intergenic
1094400259 12:30055600-30055622 AGCGAGGCCACCAGCTCATGGGG - Intergenic
1095955322 12:47802646-47802668 AAGAAGGCCAAGAGGTGAGGTGG + Intronic
1096864806 12:54556201-54556223 AACCAGGACAGCAGGTGGGGTGG + Intronic
1098857333 12:75667690-75667712 AACGAGGAAACCAGCTGATGAGG - Intergenic
1100142339 12:91634078-91634100 AACCGGGCCAGCAGCTGAGGAGG + Intergenic
1102962962 12:117105505-117105527 AGAAAGGCCACCAGGTTAGGAGG + Intergenic
1104344492 12:127983519-127983541 ACCGAGGCCAGCAGCTGCGGAGG + Intergenic
1104593432 12:130102985-130103007 AAAGAGGATACCAGGTGTGGTGG - Intergenic
1105000628 12:132687779-132687801 AAGGCGGCCACCAGGTGAGCGGG + Exonic
1106606569 13:31234535-31234557 AAGGAGGACAGCAGGTAAGGTGG + Intronic
1107532636 13:41298890-41298912 AAGGAGGAGGCCAGGTGAGGAGG + Intergenic
1107740986 13:43450393-43450415 GACGAGGCCAACAGATCAGGAGG + Intronic
1111249397 13:85583749-85583771 TACAATGCCAGCAGGTGAGGTGG - Intergenic
1112011095 13:95294504-95294526 AAAGAGGCCTCCTGGAGAGGAGG - Intronic
1113672450 13:112184232-112184254 GCCGAGGCCACCAGCTGTGGAGG - Intergenic
1114080466 14:19198693-19198715 AAGGAGGCCAACAAGTGAGGAGG + Intergenic
1114322312 14:21557406-21557428 AAAGAGGCCAACAGGTGCCGGGG - Intergenic
1115256199 14:31405144-31405166 AACGATGTGACCAGGTGTGGTGG + Intronic
1115853031 14:37602570-37602592 ATCGAGGACACCAGATGCGGCGG - Intronic
1116359603 14:43976515-43976537 AAGGAGGCGGCCAGGTGCGGTGG - Intergenic
1119676400 14:76558705-76558727 AACTAGGCCACATGATGAGGAGG + Intergenic
1119970653 14:78966331-78966353 AATGAAGCCATCTGGTGAGGTGG - Exonic
1120855569 14:89209192-89209214 AACGTGGCCGCCAGATAAGGTGG - Intronic
1121052412 14:90828187-90828209 AACGAGGCGACCAGGCGCGGCGG + Intergenic
1121778216 14:96604890-96604912 AAAGGGGTCACCAGGTGAAGTGG + Intergenic
1127075253 15:55319094-55319116 AAGGAGGCCACCACGTCGGGTGG + Exonic
1132692216 16:1186709-1186731 TACGTGGCCACCCGTTGAGGAGG - Intronic
1134094903 16:11412832-11412854 AACCAGGCAGTCAGGTGAGGGGG - Exonic
1135843170 16:25894791-25894813 AAAGAGGCCACCAGGCACGGTGG - Intronic
1137411460 16:48231871-48231893 CACGAGGCCACCAGAAGAGTTGG + Exonic
1137712281 16:50574663-50574685 AACGAGGCAAGGAGGTGGGGAGG - Intronic
1137887324 16:52119071-52119093 CACGAGGGCACCAGCTGTGGTGG - Intergenic
1140146010 16:72309576-72309598 CATAAGGCCACCAAGTGAGGAGG - Intergenic
1141307958 16:82884309-82884331 AAGGAGGCAACCTGGGGAGGGGG + Intronic
1142147973 16:88500310-88500332 GACGAGGCCACCAGCTCATGGGG - Intronic
1142674774 17:1506971-1506993 GACTATGACACCAGGTGAGGAGG - Exonic
1143162825 17:4882418-4882440 AACAAGGCCAGGAGATGAGGAGG - Intronic
1143789551 17:9282779-9282801 CATGCGGCCACCAGGTGAGCAGG - Intronic
1145041866 17:19582959-19582981 AAGGAGGCCAGCAGGGAAGGAGG + Intergenic
1145042544 17:19587751-19587773 AAGGAGGCCAGCAGGGAAGGAGG - Intergenic
1146207897 17:30920632-30920654 AAGGAGGCCACCATGTTTGGAGG + Intronic
1146599892 17:34205152-34205174 AGGGAGGCCACCTGCTGAGGAGG - Intergenic
1146858591 17:36276235-36276257 AAAAAGGCAACCAGGTGTGGTGG - Intronic
1147088912 17:38080311-38080333 AAAAAGGCAACCAGGTGTGGTGG - Intergenic
1147108296 17:38240214-38240236 AAAAAGGCAACCAGGTGTGGTGG + Intergenic
1147568387 17:41551758-41551780 AACGAGGGCACCAGGGAGGGCGG - Intergenic
1148421099 17:47547643-47547665 AAAAAGGCAACCAGGTGTGGTGG - Intronic
1148442460 17:47718564-47718586 GCTGAGGCCACCAGGTGTGGAGG + Intergenic
1148451678 17:47782432-47782454 AACGGGTTCAGCAGGTGAGGTGG + Intergenic
1148838719 17:50480517-50480539 GAAGAGTTCACCAGGTGAGGGGG + Intronic
1150264531 17:63823808-63823830 TCCGGGGTCACCAGGTGAGGCGG - Exonic
1150637034 17:66920329-66920351 GAGGAGGCCAGCAGGAGAGGAGG - Intergenic
1151840648 17:76615135-76615157 ACCCAGGCCAGCAGGGGAGGAGG - Intergenic
1152704002 17:81833511-81833533 AACGTGACTCCCAGGTGAGGGGG - Exonic
1154064566 18:11094983-11095005 AACTATGCCACCAAGTGTGGGGG + Intronic
1158073908 18:53506568-53506590 AAGGAGGCGGCCAGGTGTGGTGG + Intronic
1158324807 18:56302466-56302488 AACCAGGCCACAAGGAGAGAGGG - Intergenic
1158946708 18:62453368-62453390 AAGAAGGCAGCCAGGTGAGGTGG - Intergenic
1160381311 18:78458278-78458300 AAGGAGGCAAGCAGGGGAGGGGG + Intergenic
1160694077 19:474206-474228 ACCGAGGCCAGCAGCTGATGTGG + Intronic
1160917960 19:1506730-1506752 AACGCTGGCCCCAGGTGAGGTGG - Exonic
1161221373 19:3119672-3119694 AAGGAGGGCACCATGGGAGGGGG + Intronic
1161802598 19:6424444-6424466 AGCGGGCCCGCCAGGTGAGGAGG - Exonic
1161970803 19:7578871-7578893 GATGTGGCCACCAGGTGCGGTGG + Intergenic
1162199477 19:9010266-9010288 TACCTGGCCAGCAGGTGAGGAGG + Intergenic
1164155691 19:22595804-22595826 TCCGAGGCCCCCAGGTCAGGGGG + Intergenic
1165475247 19:36026577-36026599 TGCGAGGCCGCGAGGTGAGGAGG - Exonic
1167393435 19:49211574-49211596 GACAAGGCCACCAGGTGCGGGGG - Exonic
1167423971 19:49420267-49420289 ATGGAGGCCAGCAGGTGGGGAGG + Intergenic
1168481684 19:56725277-56725299 AGAAAGGCCACCAGGTTAGGAGG + Intergenic
925068591 2:950042-950064 AGCGAGGAGACCAGGTGGGGAGG - Intergenic
929685423 2:44029865-44029887 ATCCAGGCAACCAGGTGTGGTGG + Intergenic
929974144 2:46616181-46616203 AACACGGCAAACAGGTGAGGTGG + Intronic
931214544 2:60228771-60228793 AAAGAGGCCAACAGAAGAGGGGG + Intergenic
931623453 2:64234155-64234177 GACGAGGCCAGGAGCTGAGGAGG - Intergenic
932740267 2:74285764-74285786 AAGGAGTCAGCCAGGTGAGGCGG - Exonic
934977848 2:98817836-98817858 AATGAGGTCCCCAGGTGAGAAGG + Intronic
935496755 2:103791929-103791951 AACGAGACCAACAGATCAGGAGG + Intergenic
937866445 2:126754679-126754701 AGTGAGGACACCATGTGAGGAGG - Intergenic
937975102 2:127577570-127577592 AGCAAGGCCACGAGGTGGGGAGG - Intronic
941244317 2:163078387-163078409 TGAGAGGCCACCAGGTAAGGAGG + Intergenic
942060469 2:172224513-172224535 AAGAAGGCCATCAGGTTAGGTGG - Intergenic
942512575 2:176717920-176717942 AACAAGCCCACCAGGTGACTGGG - Intergenic
947713177 2:232327214-232327236 AAGGAGGCCACCAGGCGGGCAGG - Intronic
947720249 2:232365683-232365705 AAGGAGGCCACCAGGCGGGCAGG - Intergenic
947732869 2:232440667-232440689 AAGGAGGCCACCAGGCGGGCAGG - Intergenic
948223145 2:236289266-236289288 GACCAGGCCAGCAGGAGAGGAGG + Intergenic
948758345 2:240172591-240172613 TACGAGGCCACGCTGTGAGGAGG + Intergenic
1169713236 20:8588210-8588232 GAAGAGGCCTCCAGGGGAGGTGG + Intronic
1170026376 20:11892430-11892452 AACGAGTCCTCCAGGGGAAGTGG + Intronic
1170329243 20:15190586-15190608 TATGAGGCCAACAGGTCAGGAGG + Intronic
1170356513 20:15497575-15497597 AAGGAGGCGGCCAGGTGCGGTGG - Intronic
1170369442 20:15632794-15632816 AAGGAGGACAGCAGGGGAGGAGG - Intronic
1171111177 20:22483869-22483891 AACCAGCCCTCCAGGGGAGGAGG + Intergenic
1173257487 20:41405210-41405232 CACGATGCCAACAGGTGAAGAGG - Exonic
1174307929 20:49627800-49627822 ATCGAGGGTACCAGGTTAGGAGG + Intergenic
1175299979 20:57935862-57935884 AATGAAACCACCAGGTTAGGAGG + Intergenic
1175423717 20:58851622-58851644 ATCAAGGCCACCAGGTGGTGTGG + Intronic
1178054194 21:28780819-28780841 ATAGAGGCCACCAGGAGGGGGGG - Intergenic
1179544922 21:42107504-42107526 AGCCTGGCCAGCAGGTGAGGGGG - Intronic
1180500313 22:15923991-15924013 AAGGAGGCCAACAAGTGAGGAGG - Intergenic
1180593602 22:16960109-16960131 GGCCAGGCCACCAGGGGAGGTGG + Intergenic
1180606658 22:17064148-17064170 AATGAGGGGACCAGGTGTGGTGG + Intergenic
1181810506 22:25401045-25401067 AACGAGGCCACCAAGCCAAGGGG + Intronic
1182034708 22:27188779-27188801 AGCAAGGCCCCCAGGTGAGCTGG - Intergenic
1182485451 22:30636132-30636154 AACGTGGGCACTAGGCGAGGAGG + Exonic
1183614650 22:38936509-38936531 AAAGAGGCCAGGAGGAGAGGAGG + Intergenic
1184389936 22:44197498-44197520 CACGTGGCCACCATGTGAGGTGG - Intronic
1184458893 22:44626124-44626146 AGGGAGGCCCCCAGGTGAGGGGG - Intergenic
1184988646 22:48153094-48153116 AGGGAGGCCACCAGGGGACGGGG + Intergenic
1185294000 22:50044338-50044360 TAGGAGGCCATCAGATGAGGTGG + Intronic
1185392846 22:50571907-50571929 AGTGAGGCCAGCAGGGGAGGAGG + Intronic
949785033 3:7731600-7731622 AGGGAGGCCACCAGGCTAGGAGG + Intronic
950523352 3:13509225-13509247 AAGGAGGCTACCAGGTGAGGAGG - Intergenic
950631835 3:14287135-14287157 AAAGAGGCCAGCAGGAGAGGAGG + Intergenic
950849728 3:16051205-16051227 AACCAGGCCAGAGGGTGAGGTGG - Intergenic
962104621 3:132377914-132377936 AATGAGGCTGCCAGGTGTGGTGG - Intergenic
962750302 3:138430199-138430221 AATGACACCACCAGGTGTGGAGG + Intergenic
963818400 3:149859977-149859999 TACAAGGCAACCAGGTGTGGTGG + Intronic
966852773 3:184174946-184174968 GCCGAGGACACCAGGTGAGCCGG + Exonic
968808349 4:2788926-2788948 AGCGAGGCGGCCTGGTGAGGTGG + Intergenic
977525853 4:98144045-98144067 AATGAGGACACCAGGCAAGGAGG + Intergenic
978362563 4:107946832-107946854 AAGGAAGCCACCAAGTGAAGTGG - Intronic
980050215 4:128032397-128032419 AAAGAAGCCGCCAGGTGCGGTGG + Intronic
980779305 4:137476712-137476734 ATTGATCCCACCAGGTGAGGGGG + Intergenic
981163747 4:141531831-141531853 AAAGAGGGCACCAGGTGTGGTGG + Intergenic
983597721 4:169489659-169489681 AACTTGGACACCAGGAGAGGAGG - Intronic
984069721 4:175095200-175095222 AATGTGGGCACCAGGAGAGGAGG - Intergenic
985009251 4:185565890-185565912 AACGAGGCCTCCAGGCAAGCTGG - Intergenic
985760697 5:1747126-1747148 GAGGAGGCCGCCACGTGAGGTGG - Intergenic
986880624 5:12166097-12166119 AGCGAGGCCACTAGGAGAGAGGG + Intergenic
991507945 5:67344012-67344034 AACTTGGGCACCAGGAGAGGGGG - Intergenic
992270508 5:75058177-75058199 AAAAAGGCCAACAGGTGATGTGG - Intergenic
994626575 5:102227947-102227969 ATCGAGGCTACAAGGTAAGGGGG - Intergenic
995129810 5:108618352-108618374 AAGGAGGCGAGGAGGTGAGGAGG + Intergenic
995752945 5:115472719-115472741 AACGAGGCCAAGAGGAGAGAGGG + Intergenic
998820122 5:146050369-146050391 AACCAGGCTAGCTGGTGAGGTGG + Intronic
1001713027 5:173793199-173793221 AAAGAAGGGACCAGGTGAGGTGG + Intergenic
1002893564 6:1359850-1359872 GAGGATGCCACCAGGTGCGGTGG + Intergenic
1003733785 6:8854820-8854842 AACAAGGCCTCCAGGTGATTTGG + Intergenic
1004913032 6:20305307-20305329 AAAGAGGCCACCATGCAAGGTGG + Intergenic
1012650126 6:101742265-101742287 CATGAGGCAGCCAGGTGAGGAGG + Intronic
1013051177 6:106536865-106536887 TATGAGGCCATCAGGAGAGGGGG - Intronic
1016014107 6:139166645-139166667 AGGGAGGCCTCCTGGTGAGGCGG + Exonic
1016857356 6:148684473-148684495 AAGGAGACCACCAGGTCTGGAGG + Intergenic
1017725118 6:157271654-157271676 AAAGAGGCCAGCAGCTAAGGGGG + Intergenic
1018471680 6:164102722-164102744 AAAGAGACCACCTGGGGAGGAGG - Intergenic
1019142204 6:169956047-169956069 AAGGAGGCTTTCAGGTGAGGGGG + Intergenic
1019743550 7:2687731-2687753 AACGAGGCCACCAGGTGAGGAGG - Intronic
1020254081 7:6492156-6492178 AATGAGGCCACATGGGGAGGGGG + Intergenic
1024816565 7:53277813-53277835 TACAAGGCCACCAAGTGAGATGG - Intergenic
1026000741 7:66557825-66557847 AACCAGGGCACCAGGACAGGTGG + Intergenic
1026321990 7:69276353-69276375 AGAGAGGCCATCAGGGGAGGAGG - Intergenic
1030714208 7:112789942-112789964 AACGTGGCGCCCAGTTGAGGGGG + Intronic
1031489133 7:122366315-122366337 TACGAGGCGGCCAGGTGTGGTGG + Intronic
1032685581 7:134230951-134230973 TACGAGGCCACCTGGTGAACTGG + Intronic
1033139657 7:138814141-138814163 AACAACGCAACCAGGTTAGGAGG + Intronic
1033779321 7:144650559-144650581 AACCAGGCCAGCAGCTGCGGAGG + Intronic
1034467889 7:151240416-151240438 AACCATGTCATCAGGTGAGGTGG - Exonic
1036502516 8:9326542-9326564 AGGGAGGAGACCAGGTGAGGTGG - Intergenic
1036772145 8:11586664-11586686 AACGGGCCCACCAGGAGAGACGG + Intergenic
1037484066 8:19330992-19331014 AATGTGGCCTCCAGGTAAGGAGG - Intronic
1037879727 8:22566716-22566738 AAGGAGGGGACCAGGTGTGGGGG + Intronic
1038780145 8:30563162-30563184 AGCAAGGCCATCAGGAGAGGGGG + Intronic
1038788907 8:30649555-30649577 AAAGAGGACACTGGGTGAGGTGG + Intronic
1039358891 8:36853060-36853082 AACTAGGCTGCCAGGTGCGGTGG + Intronic
1040293620 8:46138017-46138039 AACGGGGCCACAAGGTGACATGG - Intergenic
1040296132 8:46150054-46150076 AACGAGGACACAAGGTAAAGTGG - Intergenic
1040338529 8:46428284-46428306 AACGAGGCCACAGGGTGGCGTGG + Intergenic
1041351701 8:56953406-56953428 TAAAAGGCCACCAGGTTAGGAGG + Intergenic
1048787579 8:138066781-138066803 AAGGAGGCTGCCAGGTGCGGTGG - Intergenic
1048805620 8:138238491-138238513 AAAGAGGCCACGAGGGGAGAGGG + Intronic
1050652782 9:7791201-7791223 AACCATGCCACGAGGTGAGAAGG + Intergenic
1051567701 9:18519005-18519027 AAAGAGCTCACCAGGAGAGGAGG - Intronic
1057186006 9:93058083-93058105 AGGGAGGCCTCCAGGTGTGGTGG + Intergenic
1059398507 9:114054026-114054048 AAGGAAGCCACCAGGTGTGCAGG + Exonic
1059438434 9:114289748-114289770 ACCGAGGCAGGCAGGTGAGGGGG - Intronic
1060617993 9:125036509-125036531 AATGAGGACTCCAGGTGAGAGGG + Intronic
1061025413 9:128045557-128045579 CACAATGACACCAGGTGAGGTGG + Intergenic
1061359297 9:130131115-130131137 AACTAGGACACCTAGTGAGGTGG + Intronic
1062077067 9:134595226-134595248 ATGGAGGCCCCCAGGAGAGGTGG + Intergenic
1062580034 9:137225343-137225365 ACCAATGCCACCAGGGGAGGGGG + Intronic
1187133418 X:16524847-16524869 TAAAAGGCCACCAGGTTAGGAGG + Intergenic
1190276201 X:48901240-48901262 TACGAGGCCACCAGGTTGGAGGG + Exonic
1191249930 X:58255453-58255475 AAGGAGGCCCCCAGCTGAGAGGG - Intergenic
1192241386 X:69332529-69332551 CCCCAGGCCAGCAGGTGAGGTGG + Intergenic
1195570932 X:106397815-106397837 GACAGGGCCACCTGGTGAGGTGG + Intergenic
1197961945 X:132016659-132016681 AACCAGGTCACCAGGTGATGGGG + Intergenic
1199177815 X:144812090-144812112 AAAGAAACCACCAGGTGCGGTGG + Intergenic
1199635535 X:149808513-149808535 AACAAGGACGCCAGGTGAGCGGG - Intergenic
1201281585 Y:12347339-12347361 AACGAGTCCAGCAGGTGATGCGG + Intergenic