ID: 1019743607

View in Genome Browser
Species Human (GRCh38)
Location 7:2687935-2687957
Sequence TTCGTGCCTCCCCAGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 136}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019743607_1019743622 28 Left 1019743607 7:2687935-2687957 CCTCTCACCTGGGGAGGCACGAA 0: 1
1: 0
2: 2
3: 17
4: 136
Right 1019743622 7:2687986-2688008 CTGTTTGGCTTTAGGCTCTGGGG No data
1019743607_1019743616 20 Left 1019743607 7:2687935-2687957 CCTCTCACCTGGGGAGGCACGAA 0: 1
1: 0
2: 2
3: 17
4: 136
Right 1019743616 7:2687978-2688000 TCCCTCACCTGTTTGGCTTTAGG No data
1019743607_1019743621 27 Left 1019743607 7:2687935-2687957 CCTCTCACCTGGGGAGGCACGAA 0: 1
1: 0
2: 2
3: 17
4: 136
Right 1019743621 7:2687985-2688007 CCTGTTTGGCTTTAGGCTCTGGG No data
1019743607_1019743619 26 Left 1019743607 7:2687935-2687957 CCTCTCACCTGGGGAGGCACGAA 0: 1
1: 0
2: 2
3: 17
4: 136
Right 1019743619 7:2687984-2688006 ACCTGTTTGGCTTTAGGCTCTGG 0: 1
1: 0
2: 1
3: 6
4: 119
1019743607_1019743614 13 Left 1019743607 7:2687935-2687957 CCTCTCACCTGGGGAGGCACGAA 0: 1
1: 0
2: 2
3: 17
4: 136
Right 1019743614 7:2687971-2687993 ACTGACCTCCCTCACCTGTTTGG 0: 1
1: 0
2: 2
3: 17
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019743607 Original CRISPR TTCGTGCCTCCCCAGGTGAG AGG (reversed) Intronic
902527880 1:17071163-17071185 GTCCTACCTCCCCAAGTGAGGGG + Intronic
903285200 1:22272713-22272735 CTGGGGCCTCCCCAGGTGGGAGG - Intergenic
905124017 1:35704329-35704351 TTCCTGCCTCACTGGGTGAGGGG + Intergenic
910100867 1:83574805-83574827 TTTGTTCCTTTCCAGGTGAGAGG + Intergenic
915479574 1:156175669-156175691 TTTGCACCTCCCCTGGTGAGTGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
917966927 1:180184749-180184771 CTCGTGCATCCCCTTGTGAGGGG - Intronic
920853671 1:209646579-209646601 TCTGTGCCTCCCAAGGTGATCGG - Intronic
920920067 1:210291572-210291594 CTGGTGCCTCCCCAGGGAAGTGG - Intergenic
921130178 1:212213154-212213176 GTCATGCCTCCCCAGGCGTGAGG - Intergenic
923187916 1:231591710-231591732 TACGTGCCTCCCCAGCAGACTGG + Intronic
924737597 1:246772322-246772344 TACTTGCCTCCACAGGTTAGGGG - Intergenic
1064726226 10:18282423-18282445 CCAGTGCCTCCCCAGGTGACTGG - Intronic
1072715944 10:97752837-97752859 CTCCTGCCTCCCAAGGTGCGGGG - Exonic
1074180254 10:111055912-111055934 TTTCTGCCTCCCAAGGTGATGGG + Intergenic
1074744904 10:116522879-116522901 TTCCAGCCTCCCCAGGAGAGTGG - Intergenic
1075552183 10:123400784-123400806 TTGGTGCCTCCACTGGGGAGGGG + Intergenic
1076208058 10:128618956-128618978 CTGGTGGCTCCACAGGTGAGAGG - Intergenic
1076380102 10:130019090-130019112 TCCCTGGCACCCCAGGTGAGTGG - Intergenic
1077541447 11:3148341-3148363 CCCTTGCCTCCCCAGGTCAGGGG - Intronic
1082052674 11:47785012-47785034 TTTGTACCTCTCCAGGTAAGTGG + Exonic
1083684025 11:64365435-64365457 TTCGGGGGTCCCCAGGTGGGGGG - Exonic
1084968270 11:72755693-72755715 TTCCTGGCTCCCAAGGTGAGTGG - Exonic
1085312576 11:75525282-75525304 TTCGTCCCGCCTCAGGTGAGGGG - Exonic
1088084367 11:105960001-105960023 TTGGTGCCCCTCAAGGTGAGAGG - Intronic
1090084671 11:123640723-123640745 TTGATGACTCCCCAGGTGATTGG - Intronic
1090589698 11:128252035-128252057 TTCCTGCCTCCCCAGAGGAATGG + Intergenic
1091333646 11:134750797-134750819 ATCGTGGCTCTCCAGGTGAGGGG - Intergenic
1096103232 12:48981811-48981833 TTCATGCCGCCCCAGGCAAGTGG - Intergenic
1096659986 12:53118335-53118357 CTCATTCCTCCCCAGGTGAGGGG + Exonic
1097972657 12:65651103-65651125 TTCCAACCTCCCTAGGTGAGAGG + Intergenic
1098022651 12:66171641-66171663 TTAGTCACTCTCCAGGTGAGAGG + Intergenic
1103724837 12:122992395-122992417 GTGGTTCTTCCCCAGGTGAGAGG - Intronic
1104605879 12:130187061-130187083 TTCCTGCCTCGCCTGCTGAGGGG - Intergenic
1104973747 12:132542917-132542939 TTTGTGTCTCCCCATGTGTGGGG + Intronic
1105717545 13:23082160-23082182 TTCCTGCTTCCCCAGGAGAATGG - Intergenic
1106344857 13:28866102-28866124 TTCGTGCCTCCCTGGGTAGGTGG + Intronic
1114957614 14:27844154-27844176 TTAGTGCTTCCAGAGGTGAGGGG - Intergenic
1115320034 14:32069847-32069869 TTCTTGACTCCCCAGTTCAGTGG + Intergenic
1118976880 14:70685491-70685513 TTCCTGCCTCCCCTGGTAAGTGG + Intergenic
1121029415 14:90645489-90645511 TCCCTGCTTCCCCAGGGGAGGGG - Intronic
1121313240 14:92946323-92946345 TCAATGCCTTCCCAGGTGAGTGG - Exonic
1122417121 14:101555374-101555396 TGCGTGCCTCCCAAGCAGAGGGG + Intergenic
1122717318 14:103703447-103703469 CTCCTCCCTCCCCAGGCGAGGGG - Intronic
1122987206 14:105217986-105218008 ATCCTGCCCTCCCAGGTGAGTGG + Intronic
1123762244 15:23441971-23441993 TTCCTGCTGCCACAGGTGAGCGG - Exonic
1124439031 15:29674076-29674098 TTCCTGCCTCCCAGGGTGTGTGG + Intergenic
1125278369 15:38017593-38017615 TTCCTGCTTCCTCAGTTGAGGGG + Intergenic
1126644525 15:50861642-50861664 TTCCAGCCTTCCCAGCTGAGGGG + Intergenic
1127103692 15:55591167-55591189 TACCTGCCTCCCAAGCTGAGTGG - Intergenic
1127390568 15:58501974-58501996 TTCTAGCCTCCCCAGGAGAGTGG - Intronic
1129231804 15:74201216-74201238 TGCGTGCCTCCCCAGGGGCTGGG - Intronic
1129736994 15:77972166-77972188 TACGTGCCTCCCCAGGGGAGCGG + Intergenic
1129849076 15:78781449-78781471 TACGTGCCTCCCCAATGGAGGGG - Intronic
1130154992 15:81342812-81342834 TTCCTGCCTCCCCAAGGGTGGGG + Intronic
1131023392 15:89119065-89119087 TTCGGGCTTCACCAGGAGAGAGG - Intronic
1132235299 15:100215667-100215689 TTGGTCCCTCCCCAGGTGTAAGG + Intronic
1132996441 16:2825955-2825977 TTCGCCCCTCCCCAGATAAGAGG + Intronic
1134215946 16:12317053-12317075 CTCCTACCTGCCCAGGTGAGAGG + Intronic
1139366615 16:66437580-66437602 TTTGTGTCTCCGCAGGTGAGTGG + Exonic
1141910951 16:87057997-87058019 CTCGTTAATCCCCAGGTGAGCGG - Intergenic
1142010784 16:87712790-87712812 CTCCAGCCTCCCCAGGAGAGGGG - Intronic
1142366727 16:89654068-89654090 CTCGTGCCTCCCCTGTTGGGGGG - Intronic
1143028960 17:3956848-3956870 GTCAGGCCTCCCCAGGTGGGCGG - Intronic
1143031202 17:3968195-3968217 TTCAGGCCTCCCCAGGGGAGGGG + Intergenic
1143845856 17:9772297-9772319 TTCGTGCCTCCCTAAGAGATAGG - Intronic
1144581766 17:16463290-16463312 TTCGTGCCACTCCACGTGAAAGG + Intronic
1145313115 17:21711273-21711295 CACGTGCCTCACCTGGTGAGGGG + Intergenic
1146659138 17:34652983-34653005 TTTATGCCACCCCAGGTGGGTGG + Intergenic
1147339362 17:39744686-39744708 TTCCTGCTTCCCCAGGCCAGGGG - Intronic
1148225195 17:45894462-45894484 CGCGAGCCTCCCCAGGGGAGGGG - Exonic
1148995704 17:51707567-51707589 TTCTTTCCTCCCCTGGTAAGTGG - Intronic
1151309703 17:73285703-73285725 TTCCTGCCTTGCCAGGGGAGGGG + Exonic
1153693521 18:7616906-7616928 TTAGTGCTTCCACATGTGAGTGG + Intronic
1163384654 19:16992137-16992159 TTCTTGCCTCCCCTGATGATGGG + Intronic
1165194720 19:34092885-34092907 ATCGTGAATCACCAGGTGAGGGG + Intergenic
1165384138 19:35500604-35500626 TTCGTGCCTCCGCAGTCGTGCGG + Intronic
1166496860 19:43309512-43309534 TTCGTGCCTCCCATGGCAAGTGG - Intergenic
1168671437 19:58244042-58244064 CTGGTTCCACCCCAGGTGAGTGG + Exonic
925346484 2:3175483-3175505 TTCGTGCCTCCCCAGCTGACCGG - Intergenic
930545856 2:52766252-52766274 TTGGTGCCACCCAAGGTCAGAGG + Intergenic
932441900 2:71742850-71742872 TTCGTTGCTGCCCAGGAGAGTGG - Intergenic
932784801 2:74590685-74590707 TCCGTGGCTCCAGAGGTGAGGGG - Intronic
934479661 2:94623747-94623769 TTAGTGCTTCCAGAGGTGAGGGG + Intergenic
934740724 2:96720213-96720235 TTTCTGCCTCCCCAGGGGTGAGG + Intronic
937274319 2:120674339-120674361 TCCCTGACTCCCCAGGTGTGTGG + Intergenic
946352661 2:219165415-219165437 CTTCTCCCTCCCCAGGTGAGTGG - Exonic
947765520 2:232634675-232634697 TCAGTGTCTCCCCAGGTGAGCGG - Intronic
1172427186 20:34863305-34863327 TTCGGGGACCCCCAGGTGAGGGG - Exonic
1173346543 20:42205667-42205689 TCAGTGTCTCCCCAGGAGAGTGG - Intronic
1178351177 21:31873780-31873802 TTCCTGCCTGCCTGGGTGAGCGG + Exonic
1182558575 22:31141984-31142006 TCCCAGCCTCCCCAGGTGATGGG - Intergenic
1183580105 22:38719556-38719578 TTGGTGCCTCCCAAGGTGCTGGG + Intronic
1184677199 22:46050204-46050226 TTCGAGCCTCCGCAGTGGAGGGG + Exonic
1185373644 22:50472119-50472141 TCCCTGACTCACCAGGTGAGGGG + Intronic
949394343 3:3598710-3598732 CTCCTGTCTCCCCAGGTCAGAGG + Intergenic
950088511 3:10278448-10278470 TTCCTCCCTCGCCAGGTAAGGGG + Exonic
950221828 3:11201962-11201984 CTGGTGCCTGCCCCGGTGAGGGG - Intronic
950407589 3:12814315-12814337 TGTGTGCCTCCACAGGTGATAGG + Intronic
954746266 3:52789272-52789294 TTTGTGGCTGCCCAGGTCAGCGG + Intronic
955319243 3:57962342-57962364 TTCTGCCCTCCACAGGTGAGGGG + Intergenic
959596566 3:108135432-108135454 GGGGTGCCTGCCCAGGTGAGTGG + Intergenic
962603757 3:137014727-137014749 TTCTTGTCTCCCCCAGTGAGAGG + Intergenic
964743046 3:159987837-159987859 TTGGTAGCTCCTCAGGTGAGCGG - Intergenic
966260959 3:177978781-177978803 TTCCTGCCTCCTAAGGTGAAGGG - Intergenic
969319486 4:6403139-6403161 TGGGTGCCTCCCCACGTGGGTGG + Intronic
971243868 4:24912057-24912079 TGCCGGCCTCTCCAGGTGAGAGG - Intronic
976538129 4:86242240-86242262 TTGGTGCCTCTCGAGGTCAGAGG - Intronic
981030362 4:140119305-140119327 TTCATGCCTCCTGAAGTGAGTGG - Intronic
986115862 5:4773830-4773852 TTCATGTCTCCTCAGGTAAGTGG - Intergenic
986710576 5:10485626-10485648 TGCCTGCCTCCCCAGGGGATGGG - Intergenic
992640004 5:78761094-78761116 TTCAGCTCTCCCCAGGTGAGTGG + Intronic
993430306 5:87824714-87824736 TTCGTGATTCTCCAGGAGAGTGG - Intergenic
995110935 5:108428260-108428282 TTGGTGCCCCTCCAGGTTAGAGG - Intergenic
996396084 5:123015515-123015537 TTCGTGACACCCCAGGACAGTGG + Intronic
999856032 5:155595327-155595349 TTCATGCATCCCCAGGAGAAAGG + Intergenic
1001277066 5:170358811-170358833 GTCGTGGCTCCCCTGGTGAGTGG + Intronic
1003248835 6:4406395-4406417 TTAGTGCCCCTCAAGGTGAGAGG + Intergenic
1004019526 6:11764123-11764145 TTTGTGCCTCACAAGCTGAGGGG - Intronic
1004349188 6:14876263-14876285 TTCATGCTTCCTCAGGTGATAGG - Intergenic
1013422368 6:109978453-109978475 GTCCTGACGCCCCAGGTGAGTGG + Exonic
1018923081 6:168189276-168189298 TTCTTACTTCCCCAGCTGAGCGG + Intergenic
1019743607 7:2687935-2687957 TTCGTGCCTCCCCAGGTGAGAGG - Intronic
1020280985 7:6649865-6649887 TGCCTACCTCCCCAAGTGAGAGG + Intronic
1022467865 7:30663558-30663580 TCCGTGCCTTCCCAGCAGAGGGG + Intronic
1031159674 7:118151338-118151360 TTCGTGCCTCCCAAAGTGCTGGG + Intergenic
1031708455 7:125013100-125013122 TTGGTGCCTCTAAAGGTGAGTGG - Intergenic
1032018753 7:128395123-128395145 TTGGAGCCTCCACAGGTGAGGGG - Exonic
1032432380 7:131872423-131872445 TTAGTGCTACCCCAGGTGAGTGG + Intergenic
1034196559 7:149252781-149252803 GTGGTGCCCACCCAGGTGAGTGG + Exonic
1034475684 7:151280205-151280227 TCTGTGCCTCCCCAGGTGTCAGG + Intergenic
1037618440 8:20542554-20542576 TCAGGGCCTCCCCAGGTGAAGGG + Intergenic
1041024034 8:53666032-53666054 TGTCTGCCTCCCCAGGTGTGGGG + Intergenic
1041639444 8:60180703-60180725 TTCCTGCCTCTCAAGGTGATGGG + Intergenic
1043223765 8:77699096-77699118 TTGGTGCCTCTCAAGGTCAGAGG - Intergenic
1046249206 8:111608836-111608858 CTCGTGCCTCCCAAAGTGATGGG + Intergenic
1047359299 8:124153120-124153142 ATCGTGCCTGGCCAGGTGGGTGG + Intergenic
1049706229 8:144044124-144044146 TGAATGCCTCCCCAGGAGAGTGG - Intronic
1053678164 9:40459837-40459859 TTAGTGCTTCCAGAGGTGAGAGG - Intergenic
1053928092 9:43087875-43087897 TTAGTGCTTCCAGAGGTGAGGGG - Intergenic
1054285563 9:63165106-63165128 TTAGTGCTTCCAGAGGTGAGGGG + Intergenic
1054291239 9:63295374-63295396 TTAGTGCTTCCAGAGGTGAGGGG - Intergenic
1054389260 9:64599914-64599936 TTAGTGCTTCCAGAGGTGAGGGG - Intergenic
1054506458 9:65916459-65916481 TTAGTGCTTCCAGAGGTGAGGGG + Intergenic
1058961899 9:109999454-109999476 TTCCTGCCTCTCCAGTTTAGGGG + Intronic
1059426405 9:114223440-114223462 TCTGTGCCTGCTCAGGTGAGTGG + Intronic
1059746130 9:117203743-117203765 TTGGTGCCTCTCAAGGTCAGAGG - Intronic
1060104515 9:120865505-120865527 TTGGGGCCTCCCCAGTTCAGTGG - Intronic
1060748234 9:126151767-126151789 ATTGTGCCTCCCCAGGAGGGAGG - Intergenic
1062144412 9:134981064-134981086 TTGGTGTCTAACCAGGTGAGTGG - Intergenic
1186300406 X:8194679-8194701 TCTGTGCTTCCCCTGGTGAGAGG + Intergenic
1192763410 X:74119382-74119404 TTCGTGACTCTCCATGGGAGTGG - Intergenic
1196438571 X:115696289-115696311 TTGCTCCCTCCCCAGGTGAGAGG - Intergenic
1196441354 X:115722584-115722606 TTGTTCCCTCCCCAGGTGAGAGG - Intergenic
1196444883 X:115840573-115840595 TTGTTCCCTCCCCAGGTGAGAGG - Intergenic
1196465686 X:115969495-115969517 TTGCTCCCTCCCCAGGTGAGAGG + Intergenic