ID: 1019744064

View in Genome Browser
Species Human (GRCh38)
Location 7:2689655-2689677
Sequence AGGTGCCACTGCGGTGTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 95}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019744064_1019744067 -7 Left 1019744064 7:2689655-2689677 CCTGAAACACCGCAGTGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1019744067 7:2689671-2689693 GGCACCTGCGGCTCCGTGTGTGG 0: 1
1: 0
2: 0
3: 19
4: 128
1019744064_1019744069 -2 Left 1019744064 7:2689655-2689677 CCTGAAACACCGCAGTGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1019744069 7:2689676-2689698 CTGCGGCTCCGTGTGTGGCTTGG No data
1019744064_1019744072 8 Left 1019744064 7:2689655-2689677 CCTGAAACACCGCAGTGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1019744072 7:2689686-2689708 GTGTGTGGCTTGGAGGACGCAGG 0: 1
1: 0
2: 1
3: 23
4: 218
1019744064_1019744073 23 Left 1019744064 7:2689655-2689677 CCTGAAACACCGCAGTGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1019744073 7:2689701-2689723 GACGCAGGCATGAGACCTGTTGG 0: 1
1: 0
2: 0
3: 8
4: 103
1019744064_1019744070 1 Left 1019744064 7:2689655-2689677 CCTGAAACACCGCAGTGGCACCT 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1019744070 7:2689679-2689701 CGGCTCCGTGTGTGGCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019744064 Original CRISPR AGGTGCCACTGCGGTGTTTC AGG (reversed) Intronic
901707082 1:11082130-11082152 AGGTGCTACTGAGCTTTTTCAGG - Intronic
903569063 1:24291070-24291092 TGGTCCCTCTGAGGTGTTTCAGG + Intergenic
915081226 1:153354070-153354092 AGCTCCCACTGTGGTCTTTCAGG - Intergenic
915363075 1:155297547-155297569 GGGTGCCCCTGCAGTATTTCTGG - Intronic
915510009 1:156381724-156381746 AGGTGTCACTGTGGTGTGTAGGG + Intronic
915877490 1:159627216-159627238 AGGTACATCTGCGCTGTTTCAGG - Intergenic
920046716 1:203137539-203137561 AGGTGCTATTGCAGTGATTCAGG + Intronic
921903298 1:220470443-220470465 TGGTGCCACTGCAGAGTTTGGGG + Intergenic
1067355377 10:45519781-45519803 TGGTGCTACTGCTGTATTTCAGG - Intronic
1069621641 10:69840990-69841012 TGGCGCCACTGCAGGGTTTCAGG - Intronic
1074983462 10:118637963-118637985 AGGTGCCAAAGGGTTGTTTCTGG - Intergenic
1076905833 10:133360512-133360534 AGGTGCCACGCCCGTGTGTCCGG - Intergenic
1077442374 11:2574702-2574724 AGGAGCCACTGCTGAGTGTCTGG - Intronic
1077497862 11:2895245-2895267 TGGTGACACTGCTGTGTTCCTGG - Intronic
1083177078 11:60957094-60957116 AGGTCCTACTGCAGTGGTTCAGG - Intergenic
1083449080 11:62730499-62730521 AGATGCCAATGGGGTGTTTCAGG - Intronic
1085278662 11:75315990-75316012 AGGTGGCACTCAGCTGTTTCTGG + Intronic
1089347606 11:117800530-117800552 AGGTGCCAATGCAGAATTTCTGG - Intronic
1090334495 11:125953605-125953627 AGGTGCCCCTGTGGTGTGCCGGG - Intergenic
1091147257 11:133290593-133290615 AGGTGCCACTCAGGGGTCTCTGG - Intronic
1094337394 12:29375395-29375417 ATGTGCTACTGTGGTGTTTCTGG - Intronic
1098914877 12:76246851-76246873 AGCTGCCACTGCTGTGGTTGGGG - Intergenic
1101217890 12:102603222-102603244 AAGTGCCACTTCTCTGTTTCAGG + Intergenic
1103424395 12:120819879-120819901 TGGTGCCACTGCCTTGATTCAGG + Intronic
1110941993 13:81362653-81362675 AGGTGCCACTGGGGTATGTGGGG - Intergenic
1114811630 14:25907350-25907372 AGGTGCCACTGGGCTCTCTCTGG + Intergenic
1116509561 14:45726755-45726777 AAGTGCCTCTGTGGTGTTTTCGG - Intergenic
1118590181 14:67395273-67395295 TGGTGCCACCACGGTGCTTCAGG - Intronic
1123073689 14:105654909-105654931 AGATGCCAGGGCCGTGTTTCCGG + Intergenic
1123110900 14:105866454-105866476 AGGTGCCCCTGCGGGCTTGCTGG + Intergenic
1124264304 15:28219754-28219776 GGGGGGCACTGCGGTGCTTCCGG + Intronic
1126499232 15:49326176-49326198 AGGTGTCACTGAAGTGTCTCTGG - Intronic
1127670275 15:61188155-61188177 AGGTGGCCCTGAGGTGTGTCGGG - Intronic
1131856603 15:96603634-96603656 AGGTTCCACTGGGGTCATTCTGG + Intergenic
1134038257 16:11048673-11048695 GGGTGCTGCTGGGGTGTTTCTGG - Intronic
1135523594 16:23196454-23196476 AGATGCCACTGAAGAGTTTCAGG + Intronic
1141026453 16:80553494-80553516 AGGTGGCACTGGGGTGTCTAGGG - Intergenic
1142606151 17:1082247-1082269 GGGTGCCACTGAGGTCTTTTTGG + Intronic
1144421790 17:15105381-15105403 AGGGGCCACTCAGGTGTTGCGGG + Intergenic
1146796770 17:35787103-35787125 AGGTCAAACTGGGGTGTTTCTGG + Intronic
1147559597 17:41500715-41500737 ACGTGCCCCTGCGCTGTCTCTGG + Intergenic
1152211876 17:79006804-79006826 AGGTGCCACCGCGGTGTGGAAGG - Intronic
1159175368 18:64826823-64826845 AGGTTCCACTTTGGTTTTTCTGG + Intergenic
1162396293 19:10419630-10419652 TGGGGCCTCTGGGGTGTTTCTGG - Intronic
1162876467 19:13624357-13624379 AGGTCCCAGTGCGGTGTTAAGGG - Intergenic
1166608369 19:44165686-44165708 AGATGCCACTGTGATGTATCCGG + Intronic
1168101050 19:54141181-54141203 AGGTGCCACAGTGGGGATTCAGG - Intronic
1168209665 19:54881359-54881381 CGCTGCCACTGCGGTGGTACTGG - Intronic
925573163 2:5332813-5332835 AGGTGCCTCTGCAGTGTCTGAGG + Intergenic
926635252 2:15171627-15171649 AGGTATCACTGCAGTGTTACGGG + Intronic
935173108 2:100626088-100626110 AGTGGCCACTGCAGTGCTTCGGG + Intergenic
936794314 2:116187887-116187909 AAGTCCCATTGCGGTGTTTGAGG + Intergenic
937119176 2:119430300-119430322 AGGCCCCACTGCAGAGTTTCTGG - Intronic
938257614 2:129871858-129871880 TGGTGCCACTGCTGAGTGTCTGG + Intergenic
938473682 2:131589262-131589284 AGGTGACACTCCTGTGTTCCAGG - Intergenic
942718131 2:178918085-178918107 AGCTGCCACTGGTCTGTTTCGGG - Intronic
1170621385 20:17999284-17999306 AGGTGTCTGTGAGGTGTTTCTGG - Intronic
1171426507 20:25051904-25051926 AGGTGCCATTGGGTTGTTTCTGG + Intronic
1175218817 20:57405435-57405457 AGGCGCCACTGCGGGGTTCCTGG + Intronic
1176058684 20:63162287-63162309 GGGTGCCACGGCGGTGCTCCAGG - Intergenic
1180044920 21:45300931-45300953 GGGTGCCCCTGCGGGGTCTCAGG + Intergenic
1180701272 22:17782673-17782695 AGGAGCCACTGTGGCGTTTCCGG + Intergenic
1182076349 22:27498064-27498086 AGGGGCCACTGCGCAGCTTCAGG - Intergenic
1183073384 22:35411606-35411628 AGGGGCCACTGAGGGTTTTCAGG + Intronic
1183383671 22:37503053-37503075 AGGGGCCACGGCGGGGCTTCAGG + Intronic
1183447729 22:37869818-37869840 AAGAGCCCCTGTGGTGTTTCTGG + Intronic
1185218232 22:49615794-49615816 AGGCCACGCTGCGGTGTTTCCGG - Intronic
951158212 3:19381270-19381292 AGGTGCCACTGCAATGTTTTGGG + Intronic
960419567 3:117427236-117427258 AGGTGGCACTGGGGTGAGTCTGG - Intergenic
960593705 3:119389584-119389606 ATGTGACAATGGGGTGTTTCTGG - Intronic
961051000 3:123747113-123747135 TGTTGCCACTGCCGTTTTTCAGG - Intronic
968220085 3:196930773-196930795 AAGTGCCACTGAAGTGTTTCTGG + Intronic
970166160 4:13240658-13240680 AAGTCCCAGTGGGGTGTTTCAGG - Intergenic
970350039 4:15193160-15193182 AGGTGACACAGAAGTGTTTCTGG - Intergenic
971872800 4:32266243-32266265 AAGTGGCACAGCTGTGTTTCAGG - Intergenic
973162266 4:47032666-47032688 ACGGGCTACTGCGGTGTTCCAGG + Intronic
974950334 4:68578424-68578446 AGGTGTCATTGTGGGGTTTCAGG - Intronic
974958731 4:68673961-68673983 AGGTCCCACTGTGGGGTTTGAGG - Intergenic
975495790 4:75034850-75034872 GGGAGCCACTGGGGTTTTTCAGG - Intronic
986089818 5:4493242-4493264 AGGTGCCTGTGAGGTTTTTCTGG + Intergenic
992576267 5:78116908-78116930 GGGAGCCACTGCAGGGTTTCAGG - Intronic
993981094 5:94544569-94544591 AGGTGCCATTGGGATATTTCTGG - Intronic
997189626 5:131918818-131918840 AGGTGTCACAGCCGTGTTCCTGG - Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998337117 5:141383127-141383149 AGCTGCCGCTGCGCTGGTTCAGG - Exonic
999702973 5:154245015-154245037 GGGTGCCACTGCAGGGATTCTGG + Intronic
1001109989 5:168887672-168887694 AGGTGGGACTGTGATGTTTCTGG - Intronic
1013179661 6:107707517-107707539 AGGTGCTACTGCGGTTTGCCTGG + Intronic
1014711634 6:124813200-124813222 AGTTGCCAATGTGGTATTTCGGG - Intronic
1015600036 6:134902827-134902849 AGGTGGCTCTGCTGTGTTTCAGG - Intergenic
1019744064 7:2689655-2689677 AGGTGCCACTGCGGTGTTTCAGG - Intronic
1020038774 7:4985454-4985476 AGGGGGCACTGCTGTGTTCCCGG - Intronic
1020156527 7:5729026-5729048 AGGGGGCACTGCTGTGTTCCCGG + Intronic
1024326613 7:48114231-48114253 AGGTGCCTCTGCAGGGCTTCTGG - Intergenic
1026664508 7:72330914-72330936 AGGTGTCACTGTTGGGTTTCTGG - Intronic
1036752537 8:11452437-11452459 TGGTGCCTCTGGGCTGTTTCAGG + Intronic
1039442784 8:37606948-37606970 AGGAGCCACTGCAGTGCCTCGGG + Intergenic
1045438475 8:102187536-102187558 AGGTGCCACTTGGGTCTCTCAGG + Intergenic
1047359109 8:124151874-124151896 AGCTGCCACTGAGGTGTCCCTGG + Intergenic
1048639712 8:136340856-136340878 AGGTGCAACTGCACTGTTTCAGG + Intergenic
1053077198 9:35142986-35143008 AGGTGCCACTGACCTGTTTTTGG + Intergenic
1056396293 9:86184363-86184385 AGGGGGCACTGTGGTGTTTGTGG + Intergenic
1060154652 9:121310870-121310892 AGGAGCCACTGAGGTGCTCCTGG + Intronic
1192155508 X:68743534-68743556 AGAGGCCACTGGGATGTTTCAGG - Intergenic
1199531617 X:148854502-148854524 TGGGGCCACTGGGGTTTTTCTGG - Intronic
1201753514 Y:17460938-17460960 AGGTGTCACTTCAGTGTTTCAGG - Intergenic
1201848039 Y:18445045-18445067 AGGTGTCACTTCAGTGTTTCAGG + Intergenic