ID: 1019744345

View in Genome Browser
Species Human (GRCh38)
Location 7:2691261-2691283
Sequence GACCTTCCCCTACTCTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019744345_1019744352 1 Left 1019744345 7:2691261-2691283 CCCCTCAAGAGTAGGGGAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1019744352 7:2691285-2691307 GTGTGTGAGGACTGGAGTCAGGG No data
1019744345_1019744356 29 Left 1019744345 7:2691261-2691283 CCCCTCAAGAGTAGGGGAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1019744356 7:2691313-2691335 TGTGCTGGGAGTCAAGATCCAGG 0: 1
1: 0
2: 2
3: 20
4: 209
1019744345_1019744353 2 Left 1019744345 7:2691261-2691283 CCCCTCAAGAGTAGGGGAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1019744353 7:2691286-2691308 TGTGTGAGGACTGGAGTCAGGGG 0: 1
1: 0
2: 4
3: 36
4: 362
1019744345_1019744349 -7 Left 1019744345 7:2691261-2691283 CCCCTCAAGAGTAGGGGAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1019744349 7:2691277-2691299 GAAGGTCCGTGTGTGAGGACTGG 0: 1
1: 0
2: 0
3: 8
4: 142
1019744345_1019744354 14 Left 1019744345 7:2691261-2691283 CCCCTCAAGAGTAGGGGAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1019744354 7:2691298-2691320 GGAGTCAGGGGTCTCTGTGCTGG 0: 1
1: 0
2: 2
3: 30
4: 293
1019744345_1019744355 15 Left 1019744345 7:2691261-2691283 CCCCTCAAGAGTAGGGGAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1019744355 7:2691299-2691321 GAGTCAGGGGTCTCTGTGCTGGG No data
1019744345_1019744351 0 Left 1019744345 7:2691261-2691283 CCCCTCAAGAGTAGGGGAAGGTC 0: 1
1: 0
2: 0
3: 2
4: 80
Right 1019744351 7:2691284-2691306 CGTGTGTGAGGACTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019744345 Original CRISPR GACCTTCCCCTACTCTTGAG GGG (reversed) Intronic
911100574 1:94092793-94092815 GACCTTCTCCTAGTCTGGGGGGG + Intronic
911104022 1:94116148-94116170 ATCCCTCCCCTACTCCTGAGAGG - Intronic
915272845 1:154767403-154767425 GACCTTACTGTCCTCTTGAGTGG - Intronic
918198774 1:182247457-182247479 GACCATTCCCGACTCTAGAGGGG - Intergenic
919545288 1:198909894-198909916 AACCTGCCACTAGTCTTGAGAGG - Intergenic
1063577483 10:7274958-7274980 GCCCTTTCCCTACTCTGAAGAGG - Intronic
1067527790 10:47048726-47048748 GCCCTGCCTCTGCTCTTGAGAGG - Intergenic
1076410317 10:130244600-130244622 CACCTGCCCCTGCTCTTGACAGG + Intergenic
1077025822 11:439447-439469 GACCCCACCCTACTCCTGAGAGG + Intronic
1081568568 11:44275699-44275721 GACATTCCCCTTCTCTTGTTTGG - Intronic
1092545941 12:9450943-9450965 GACCTTCACGTCCTATTGAGAGG - Intergenic
1092834824 12:12477517-12477539 AACCTTCCACTACTCTGGATGGG - Exonic
1094507015 12:31071130-31071152 GACCTTCACGTCCTATTGAGAGG + Intergenic
1096582795 12:52599157-52599179 GCCCTTTCCCCACTCTTGAGAGG - Intronic
1097821889 12:64136080-64136102 GACCTACCCCTAATCTGGATGGG - Intronic
1098039301 12:66337880-66337902 CACCTTCCCCAACCCTTGAAAGG - Intronic
1100702027 12:97159263-97159285 GACCTTCCACTCATCTTGAATGG - Intergenic
1109426087 13:62167853-62167875 GACCTCCCTGTACACTTGAGGGG + Intergenic
1111736668 13:92149639-92149661 CACCTTCCCTTATTCTTCAGCGG - Intronic
1112518832 13:100078851-100078873 GACCTTCGCCTAGCGTTGAGTGG + Intergenic
1114938476 14:27574704-27574726 GACCTTCCCCTTCTCTGTAACGG - Intergenic
1121459744 14:94065728-94065750 GACCTTCACCTTCTCTAGTGGGG - Intronic
1122942185 14:104986324-104986346 AACCTTCCCCTGCCCTGGAGAGG - Exonic
1127716690 15:61655508-61655530 CAACTTCCCCTACTCTGGATTGG + Intergenic
1135064359 16:19296825-19296847 GACCTTCACCCACCCCTGAGTGG + Intronic
1135873515 16:26175038-26175060 AACCTTCCCCAACTCATGTGAGG - Intergenic
1143378329 17:6480310-6480332 GACTTTCCCCCAATCTAGAGGGG + Intronic
1145305190 17:21670211-21670233 GACCTTTCCCTCCCCTAGAGAGG - Intergenic
1147557048 17:41486278-41486300 GACCCTGCCCTTCTCTAGAGGGG - Exonic
1147686459 17:42289187-42289209 CACCTTCCCCTCCCCTTCAGCGG + Intronic
1147952099 17:44112979-44113001 TCCCTTCCCTTCCTCTTGAGAGG - Intronic
1152912809 17:83015020-83015042 GACCTGCCACCACTGTTGAGGGG + Intronic
1164507658 19:28872786-28872808 GACCTTGCACTACACTTGTGGGG + Intergenic
925178136 2:1799086-1799108 GACCTTCCTCTATTCTAGAAGGG - Intronic
935077594 2:99760862-99760884 CCTATTCCCCTACTCTTGAGAGG + Intronic
937297221 2:120817137-120817159 GACTTTGCCCATCTCTTGAGAGG + Intronic
938221823 2:129575416-129575438 GACATTCCCCTAGTTTTGGGGGG + Intergenic
939757385 2:146130897-146130919 GGGCTTCCCATAGTCTTGAGTGG + Intergenic
940611752 2:156001698-156001720 TACCTTCCTCTTCTCTTGAAGGG - Intergenic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
944662827 2:201935352-201935374 GACCTTCCTCTACACCTGACTGG - Intergenic
946761684 2:223000422-223000444 GACCTTTCCCAACTCTTGGAGGG - Intergenic
1169216518 20:3797382-3797404 CACCTTGCCCTGCTCCTGAGAGG + Intronic
1174287347 20:49482748-49482770 GACCTTCCCCCGCGCTTAAGCGG + Intergenic
1175314009 20:58033292-58033314 GGCATTCACTTACTCTTGAGTGG - Intergenic
1181919662 22:26310851-26310873 GAGCTTCCCTTTCTCTTGTGGGG + Intronic
1185130370 22:49035429-49035451 GGCCTTTCCCTGCTCCTGAGTGG + Intergenic
955209793 3:56929974-56929996 GACCCTCTCCCACTCTTGGGTGG + Intronic
955880688 3:63541497-63541519 GAACTCCCCCTACTATTCAGTGG - Intronic
967965933 3:194960348-194960370 GACCTTCCCCCAATCTGGTGAGG + Intergenic
968041818 3:195595230-195595252 AACCTTGCCCTTCTCTTGAGTGG - Intergenic
970710181 4:18852544-18852566 GAGCTTTCCCTAATCTTGAATGG + Intergenic
972361836 4:38332861-38332883 GACCTTCCCCTCCTCTTTGCTGG - Intergenic
977649885 4:99457233-99457255 GAGCTTCCCCTCCTGTTGGGTGG + Intergenic
993298946 5:86182704-86182726 CTCCTTTCCCTACCCTTGAGGGG + Intergenic
999364408 5:151012622-151012644 GACCTTCCCCAGCTGTTGAATGG - Intergenic
999387787 5:151167419-151167441 GCCCTTCCCCTCCTTTTCAGTGG + Intergenic
1001154525 5:169261737-169261759 CACCTTCCCCTCTCCTTGAGTGG + Intronic
1001214501 5:169842945-169842967 GACACTCCCCTACTCTGGAATGG + Intronic
1001827349 5:174755919-174755941 TAACTTCCCCCATTCTTGAGTGG + Intergenic
1003095423 6:3139512-3139534 GGCCTTTCCCTCCTCTTCAGTGG - Intronic
1004405549 6:15329752-15329774 GACATGCCCTTATTCTTGAGGGG + Intronic
1008804142 6:55406953-55406975 TACCTTCTGCTACTCTTAAGAGG - Intergenic
1011996418 6:93594723-93594745 GTCCTTTCCCCACTCTTGAAGGG + Intergenic
1013043504 6:106460599-106460621 GCCCTGCCCTTACTCTAGAGAGG + Intergenic
1017983846 6:159425383-159425405 GTCCTTCCCCTGCACATGAGAGG + Intergenic
1019128976 6:169859812-169859834 CATCTTCCCCTGCTCTGGAGGGG + Intergenic
1019744345 7:2691261-2691283 GACCTTCCCCTACTCTTGAGGGG - Intronic
1024971332 7:55073996-55074018 ACCCTTCCCCTAGTCTGGAGAGG + Intronic
1035271187 7:157720924-157720946 GACCTTCCTCAACTCGCGAGGGG - Intronic
1036805199 8:11826809-11826831 GCCCTTCCTCTTCTTTTGAGAGG - Intronic
1047773446 8:128049392-128049414 GGCCCTGCCCTTCTCTTGAGAGG + Intergenic
1051608950 9:18942949-18942971 AACCTTCCCCTTCCCTTGACAGG - Intronic
1052488978 9:29138907-29138929 GTCCTTTCCATACTCTGGAGGGG - Intergenic
1055062261 9:72082075-72082097 CCCCTTCCCCTTATCTTGAGTGG - Intergenic
1060879848 9:127110409-127110431 GTCCTTTCTCTACTGTTGAGGGG + Intronic
1060967119 9:127717561-127717583 GACTTTCCCCTACCCTCCAGGGG + Intronic
1062388586 9:136325051-136325073 GAGCTTCCCGGACTCTTGGGGGG + Intergenic
1185761080 X:2690616-2690638 GACCCTCCCCTGCTCTGCAGTGG - Intergenic
1189098104 X:38161112-38161134 GACGATCCCCTACTCTTTACAGG + Intronic
1192441988 X:71181482-71181504 AACCTTTCCCAACTCATGAGAGG + Intergenic
1193062156 X:77218357-77218379 GAGCATCCCATACTCTAGAGGGG - Intergenic
1200907602 Y:8500311-8500333 GACCTAAACCTACTCATGAGAGG - Intergenic