ID: 1019745930

View in Genome Browser
Species Human (GRCh38)
Location 7:2700390-2700412
Sequence CTGCTGTCCATGGGCCACCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 276
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 244}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019745930_1019745937 -9 Left 1019745930 7:2700390-2700412 CCCGGGTGGCCCATGGACAGCAG 0: 1
1: 0
2: 2
3: 29
4: 244
Right 1019745937 7:2700404-2700426 GGACAGCAGCAGGGGCTCCCAGG 0: 1
1: 0
2: 6
3: 56
4: 478
1019745930_1019745939 1 Left 1019745930 7:2700390-2700412 CCCGGGTGGCCCATGGACAGCAG 0: 1
1: 0
2: 2
3: 29
4: 244
Right 1019745939 7:2700414-2700436 AGGGGCTCCCAGGAGTGGCCAGG 0: 1
1: 1
2: 2
3: 49
4: 447
1019745930_1019745938 -4 Left 1019745930 7:2700390-2700412 CCCGGGTGGCCCATGGACAGCAG 0: 1
1: 0
2: 2
3: 29
4: 244
Right 1019745938 7:2700409-2700431 GCAGCAGGGGCTCCCAGGAGTGG 0: 1
1: 0
2: 10
3: 65
4: 546

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019745930 Original CRISPR CTGCTGTCCATGGGCCACCC GGG (reversed) Exonic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
900493602 1:2965825-2965847 CTGCTTTCCAGGGCCCATCCTGG - Intergenic
900521861 1:3109787-3109809 ATTCTCTCCATGGGCCACTCAGG - Intronic
901089161 1:6629912-6629934 CTGCAGCCCCTGGGCCACACTGG - Intronic
901604619 1:10449446-10449468 CTGCTGGCCCTGGGGCAGCCGGG - Intronic
901934647 1:12619026-12619048 CTCCTGTCCTTGGGTCTCCCTGG + Intergenic
902120988 1:14165454-14165476 CTCCTGTCCGTGGCTCACCCAGG + Intergenic
902927447 1:19705604-19705626 CTGCTGGCCACATGCCACCCAGG - Intronic
903377661 1:22876714-22876736 CTGCTGCCCACCGCCCACCCTGG - Intronic
903847246 1:26285709-26285731 CTGCCCTCCACGGGGCACCCAGG - Intronic
904616442 1:31752699-31752721 CTGGTGTCCAAGCCCCACCCGGG - Intronic
904764021 1:32828370-32828392 CTCCTGTGCATGGGGCAGCCTGG + Intronic
904856533 1:33502006-33502028 CTGCGTTCCATGGGGCCCCCTGG + Intergenic
905568608 1:38986252-38986274 CTGTTTTCCATGGGGCAGCCAGG + Intergenic
905662089 1:39735478-39735500 CTGCTGTCCATGTGCAGGCCAGG + Intronic
907486436 1:54781330-54781352 CGGCCGTCCCTGGGCCACCAGGG + Exonic
911003085 1:93188342-93188364 CTGCTGTCCAACTGCTACCCTGG + Intronic
911059383 1:93734590-93734612 CAGCTTTGCATGGGCCACCCAGG + Intronic
914355733 1:146882634-146882656 CTCCTGCCACTGGGCCACCCCGG - Intergenic
915623385 1:157099513-157099535 CTGCAGTGCATGGTCCACTCCGG + Exonic
917619917 1:176785421-176785443 CGTCTCTCCATGGGCCTCCCAGG - Intronic
917821364 1:178767586-178767608 CTGCTGTTCATGTGCTCCCCAGG + Intronic
920458152 1:206116703-206116725 CTGCTGACCCTGGGCCAGCTGGG - Exonic
922896659 1:229106052-229106074 CTCCTGTCCTTGAGCCACACTGG - Intergenic
1063320272 10:5045783-5045805 CTGCAGTCCATGCACCAGCCTGG - Intronic
1067211765 10:44265468-44265490 CTGCTGTCCATGGAGCAGTCTGG - Intergenic
1067498084 10:46776354-46776376 GTGCAGTCCATGGGCCAGGCGGG + Intergenic
1067596562 10:47564060-47564082 GTGCAGTCCATGGGCCAGGCGGG - Intergenic
1070503335 10:77091586-77091608 CTCCTGTCCCTGTGCCCCCCAGG + Intronic
1070628945 10:78070761-78070783 CTGCTGGCCAAGGGGCAGCCTGG + Intergenic
1071756811 10:88551144-88551166 CTGATGTCCCCAGGCCACCCAGG + Intronic
1071876750 10:89850995-89851017 CTGCACTCCAGGGGCCTCCCAGG + Intergenic
1072312433 10:94169461-94169483 CTCCTCTCCAAGGCCCACCCAGG - Intronic
1072341465 10:94455905-94455927 CTGTTGTCCAGGTGCCATCCTGG - Intronic
1072582012 10:96747881-96747903 CTGCTGTCAGTGGACCAGCCTGG + Intergenic
1072826174 10:98608946-98608968 TTGCTGTCCAGTGGCCACACAGG - Intronic
1075729543 10:124628077-124628099 CTGCTGTTCCTGGGCCAGCAGGG + Intronic
1076458355 10:130620581-130620603 CTGAGGTCCACAGGCCACCCTGG - Intergenic
1076522756 10:131091157-131091179 CAGCAGTCCAGGGGCCACGCAGG + Intergenic
1076817155 10:132920658-132920680 CTCCTGTGCATGGGCGACCCCGG + Intronic
1076999626 11:316106-316128 CTGCTGTCCACGGGCACCCGAGG - Intergenic
1078164211 11:8868902-8868924 CTGCGGCCCATGGGCCGCCCAGG + Intronic
1078545849 11:12246394-12246416 CTGCTGGCCATTTGCCACGCTGG + Intronic
1082028215 11:47587747-47587769 GTGCTGTCCATGGGCTGCCCTGG - Exonic
1084771392 11:71344824-71344846 CTGCTGTTCACAGGCCACCCTGG - Intergenic
1084944861 11:72633003-72633025 CTCCTGTACATAGGCCCCCCAGG + Intronic
1085028985 11:73258331-73258353 CTGCTGTCCCTGGGTCCTCCTGG - Intergenic
1089133524 11:116231168-116231190 CTGCTGCCCAAGTGCCATCCAGG - Intergenic
1089812606 11:121144045-121144067 ATGCTTTCCATGCTCCACCCAGG - Intronic
1091721515 12:2817361-2817383 CTTCTGTCCAGGGACCACCTAGG + Intronic
1092908289 12:13122380-13122402 CTGCTGTTTATAAGCCACCCAGG - Intronic
1094723882 12:33092495-33092517 CTACTGTCCATGTGTCACACTGG - Intergenic
1097178355 12:57156536-57156558 CACCTGGCCATGGGCAACCCTGG + Intronic
1098751190 12:74294255-74294277 GTGCTGTCCAAGCCCCACCCAGG - Intergenic
1100192044 12:92203220-92203242 CTGCATTCCATGATCCACCCTGG - Intergenic
1101878950 12:108613597-108613619 CTGCTGTCCCTGCCCCTCCCAGG - Intergenic
1101879228 12:108614992-108615014 CTGCTGTCCCTGCCCCTCCCAGG - Intergenic
1102240333 12:111320893-111320915 CTGCTGTCCCTGGGTCCCGCAGG + Intronic
1103003769 12:117406013-117406035 CTGCTCTGCATGGGCCAGGCTGG - Intronic
1104120030 12:125790136-125790158 CTGTTGTCAATAAGCCACCCAGG + Intergenic
1104376096 12:128266847-128266869 CCGCTGTCCGTTGGGCACCCGGG + Intergenic
1104414547 12:128587227-128587249 CTGCTCTTCATAAGCCACCCAGG - Intronic
1104720968 12:131045095-131045117 CTGCTGTCCAGGGGGCCTCCAGG + Intronic
1105900052 13:24745970-24745992 CCGCTGCCCGTGGGCCACCCCGG + Intergenic
1111702147 13:91704461-91704483 CTGCTGGTCATGGGGCCCCCAGG + Intronic
1112422587 13:99266447-99266469 CTGCAGCCCATGGGCCACATGGG - Intronic
1113543820 13:111131169-111131191 CAGCTCTCCATGGGCAACCGTGG - Intronic
1113762586 13:112859790-112859812 CTTGTGGACATGGGCCACCCCGG + Intronic
1114678031 14:24458539-24458561 CTGCTCTCCATCAGCCTCCCTGG - Intergenic
1115245135 14:31287086-31287108 CTGCTGTCCATGGACAGCTCAGG + Intergenic
1116001310 14:39245297-39245319 TTGGTTTCCCTGGGCCACCCTGG + Intronic
1116768956 14:49105115-49105137 CTGCTGTCCATGGACCTCTATGG + Intergenic
1117882045 14:60321576-60321598 CTGATGTCCTTGGGCCAGCTGGG + Intergenic
1118765084 14:68904254-68904276 CAGCTGTCCAGAGACCACCCAGG + Intronic
1121079839 14:91098779-91098801 GTGCTGGCCATGGGCCACATGGG - Intronic
1121449685 14:93999173-93999195 CTGCTGTAGATGGGCAACCCGGG + Intergenic
1122827239 14:104376254-104376276 CTGCTGGCCACTGGCCTCCCTGG + Intergenic
1122886759 14:104713701-104713723 CTCCTCTCCCTGGGCCACCCTGG + Intronic
1129470648 15:75751641-75751663 CTGCTGTCCACCAGGCACCCTGG - Intergenic
1129717500 15:77860689-77860711 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1130461252 15:84159508-84159530 CTGCTGCCCCTGGGCCACTCTGG - Intergenic
1130992877 15:88887073-88887095 CTGCTGTCCCTGTCCCAGCCTGG + Intronic
1131532379 15:93204915-93204937 CTGCATTCCATGGGCCAGGCCGG - Intergenic
1132373924 15:101316026-101316048 CTGCTGTCCACCACCCACCCAGG - Intronic
1132756430 16:1487570-1487592 CGGCTGCCCGTGGCCCACCCTGG - Exonic
1133893109 16:9900355-9900377 CTGTAATCCATGTGCCACCCTGG + Intronic
1134134697 16:11670753-11670775 CTGCGGTCTGTGGGCCCCCCGGG + Intronic
1134684680 16:16150346-16150368 CTGCTTTCCATGCGGCTCCCTGG + Intronic
1136277779 16:29189135-29189157 CTGCGCTCCATGGCCCACTCTGG - Intergenic
1139527396 16:67525342-67525364 CGGCTGTGCCCGGGCCACCCTGG - Intronic
1139961880 16:70722547-70722569 GGGCTGTCCAAGGGCAACCCAGG + Intronic
1139978284 16:70832810-70832832 CTCCTGCCACTGGGCCACCCCGG + Intronic
1140208967 16:72955958-72955980 CTGGTGTGCATGGTTCACCCTGG + Intronic
1140551354 16:75869683-75869705 CTGTTGTCCCAGGGTCACCCAGG + Intergenic
1142082154 16:88155177-88155199 CTGCGCTCCATGGCCCACTCTGG - Intergenic
1142567439 17:849794-849816 CTGCTGTCCCTGGCCCAGCAAGG - Intronic
1142887086 17:2919611-2919633 CCCCAGACCATGGGCCACCCAGG - Intronic
1143086804 17:4422167-4422189 CTGCATTCCATTGGCCACACAGG - Intergenic
1143289090 17:5815558-5815580 CTGCTGTCCAGACCCCACCCTGG + Intronic
1143411417 17:6711933-6711955 CTGCTGTCCTTGACCCATCCAGG + Intronic
1143597192 17:7922421-7922443 CTGTTTTCCAAGGACCACCCCGG + Exonic
1144788593 17:17845296-17845318 CTGCTGCCCCTGGGGCAGCCAGG + Intronic
1147393346 17:40122866-40122888 CTGCTGCCCGGGGGCCGCCCCGG - Intronic
1147571657 17:41575332-41575354 GTGCTGTGGATGGGCCACCCTGG + Intergenic
1148052123 17:44774602-44774624 CTGCTGGGCGTGGGCCACACGGG - Intronic
1151156082 17:72123749-72123771 CTGCCGCCCAACGGCCACCCGGG + Exonic
1151238030 17:72735771-72735793 GTGGTTTCCATGGTCCACCCAGG - Intronic
1151668392 17:75558384-75558406 CTGGGGCTCATGGGCCACCCTGG + Intronic
1152044815 17:77928977-77928999 CTGCTGTCGAAGGGCCACAAGGG + Intergenic
1152178583 17:78803568-78803590 CTCCTGTACATGGGGCTCCCAGG + Exonic
1152205116 17:78970501-78970523 CTGCTCTCCATGACCCAGCCCGG + Intergenic
1152512647 17:80800980-80801002 CTGCTGTCCCTGGGCCACACGGG - Intronic
1152574107 17:81132656-81132678 CTGCTGCCCGGGGGCCAGCCGGG + Intronic
1152707315 17:81851350-81851372 ACGCTGTGCCTGGGCCACCCTGG + Intronic
1152738908 17:82010702-82010724 CTGGTGTCCATGGCCCAGCATGG + Intronic
1152779506 17:82220005-82220027 CTGCTGTGAAAGGGCCCCCCCGG - Intergenic
1154380529 18:13845922-13845944 CTGCTGTCCACTGGCCAGCATGG - Intergenic
1155361914 18:25011450-25011472 CTGGTGTCCAAGCTCCACCCTGG + Intergenic
1157195967 18:45620244-45620266 CGGCTGTGCATGGCCCAGCCAGG + Intronic
1157711006 18:49849746-49849768 CGGCTGCCCATGGGCCGCACTGG - Intronic
1159785590 18:72710504-72710526 ATGCTGTGCATGGGCCAGACTGG - Intergenic
1161046656 19:2138487-2138509 CTGCTGTCGGTGAGCCACTCAGG - Intronic
1161513151 19:4682913-4682935 CCGCTGTCCCGGGGCCGCCCTGG + Intronic
1162502031 19:11059646-11059668 CAGCTGTCCAGGGGCAACACAGG + Intronic
1162524196 19:11197812-11197834 CTGCTGTCCCTGGGCCGCTGCGG + Intergenic
1162524942 19:11201645-11201667 CTGGAATCCCTGGGCCACCCTGG + Intronic
1163320766 19:16573181-16573203 CTGATGTCCAAGGACCAGCCGGG + Intronic
1163917789 19:20257708-20257730 TGGCTGTCCATCGTCCACCCAGG - Intergenic
1164936567 19:32219523-32219545 TTGCTGTCCTTCTGCCACCCAGG + Intergenic
1165700343 19:37932597-37932619 CTCCTGTCCCTGGTCCTCCCAGG - Intronic
1165902628 19:39175762-39175784 CTGGGGTCCATGGACCGCCCTGG - Intronic
1167571787 19:50293104-50293126 ATGCTGTCCCTGGGTAACCCTGG - Intronic
1168567129 19:57434604-57434626 AAGCTGTAGATGGGCCACCCTGG + Intronic
925109528 2:1322289-1322311 CTGCTCTCCAGAGGCAACCCTGG + Intronic
925431848 2:3801641-3801663 CTCCGGGCCAGGGGCCACCCAGG - Intronic
925915996 2:8606762-8606784 CTGCAGACCTTGGACCACCCGGG + Intergenic
927484465 2:23479149-23479171 CTGCTTTCCCTGGCCCACTCTGG + Intronic
927714667 2:25343596-25343618 CTGCTGTCCATGGTCCCCACCGG + Intergenic
931629355 2:64285212-64285234 CTCCTGTACAAGGGCCACCAAGG - Intergenic
933771165 2:85745059-85745081 CAGCTGTCCCTGGGGCATCCAGG + Intergenic
933998300 2:87686064-87686086 TTGCAGTCCAGGGGGCACCCAGG - Intergenic
936055745 2:109260724-109260746 ATACTGTCCATGGGCAATCCAGG + Intronic
936295549 2:111264809-111264831 TTGCAGTCCAGGGGGCACCCGGG + Intergenic
936373113 2:111919409-111919431 CTGATGCCCATGTCCCACCCAGG - Intronic
937134970 2:119544533-119544555 CGGCCGACCCTGGGCCACCCGGG - Intronic
937317535 2:120941507-120941529 CTGCTCTCCCAGGGCCTCCCTGG - Intronic
937924034 2:127154071-127154093 CTCAGGCCCATGGGCCACCCTGG + Intergenic
942190336 2:173463192-173463214 CTGCTGCACATGGGTCACCCTGG + Intergenic
944290153 2:197995730-197995752 CTCCTGTACACTGGCCACCCAGG - Intronic
945779822 2:214155345-214155367 CTACTGCCCATGGGCCAGCTTGG + Intronic
946066479 2:216991844-216991866 CTCCTGACCAGGGGCCAGCCTGG - Intergenic
946515941 2:220411905-220411927 CTGCTGTCCATGTGCTTCCTGGG + Intergenic
948117045 2:235501018-235501040 CTGCTTTCCATGGGACAGGCTGG + Intronic
948647044 2:239411865-239411887 CTGCTGTCTCTCGGCCCCCCAGG - Intergenic
948838066 2:240635871-240635893 CTACTGTGCATGGGCCCTCCTGG - Intergenic
949003887 2:241634392-241634414 CTGCTGTCCTGAGGCCATCCTGG - Intronic
1168981904 20:2011434-2011456 TTACTGTCCATTGGCCAGCCTGG - Intergenic
1169411521 20:5374571-5374593 TGGCTCCCCATGGGCCACCCTGG - Intergenic
1175089299 20:56488829-56488851 CTGCTTTCCCTTGGCCTCCCTGG + Intronic
1176145279 20:63562678-63562700 CGTCTGCCCGTGGGCCACCCAGG + Exonic
1178382333 21:32121249-32121271 TTGTTCTGCATGGGCCACCCTGG - Intergenic
1179831609 21:44000545-44000567 CTGCTGTCCCTGCACCAGCCTGG + Intergenic
1180008557 21:45034722-45034744 CGCCTGTCCCTGAGCCACCCTGG - Intergenic
1180180947 21:46118484-46118506 CTGATGTCCACGGGGCACCTGGG - Intronic
1181033354 22:20158557-20158579 CTGCTGCCCAAGGGCCCACCTGG - Intergenic
1181329628 22:22079845-22079867 CAGCTCTCCATGGGCTCCCCAGG - Intergenic
1181582253 22:23834850-23834872 CTGCCGTCCCTGGGCCGCCCTGG + Exonic
1181829233 22:25546161-25546183 CTGCTTCCCATGAGCCTCCCTGG + Intergenic
1182835670 22:33339421-33339443 GTGCTGACCATGGGCCTCTCAGG - Intronic
1183829540 22:40410470-40410492 CTCCTGTCCTAGGGCCACGCTGG + Exonic
1184190019 22:42888148-42888170 CTGCTGACCAGGAGCCACTCAGG - Intronic
1185208556 22:49553985-49554007 CCGGTGTCCATGGGCCACACTGG - Intronic
1185208570 22:49554053-49554075 CCGGCGTCCATGGGCCACACTGG - Intronic
949511625 3:4771615-4771637 CTTCTGTCCATGGGGTTCCCAGG - Intronic
952769882 3:36989676-36989698 CTGCAGTGCATGGGACAGCCTGG - Exonic
953227374 3:41033185-41033207 CAGCTGGCCAAGGGCCAGCCAGG + Intergenic
953413887 3:42704600-42704622 CTGCTGTGTGTGGGTCACCCAGG - Intronic
953537294 3:43786180-43786202 CTGCTGGGCATGGGCCCCCAAGG + Intergenic
953863072 3:46561778-46561800 CTGCAGTCCAGGGCCCACCCTGG - Intronic
954745033 3:52782898-52782920 GTGCTGTCCTGGGGCCACCCTGG + Intronic
955121552 3:56064798-56064820 CTGCAGCCCATGGGCCAAACTGG + Intronic
956201349 3:66709567-66709589 ATGCTGTCCCTGTGCCACCGAGG + Intergenic
961040325 3:123673841-123673863 CTGCTGGCCATGGGACAGGCAGG + Intronic
962473043 3:135730966-135730988 CTGCTGTCCATGTACTTCCCAGG + Intergenic
962740478 3:138359684-138359706 CTGCAGGACATGGGCCAGCCTGG - Intronic
968479909 4:828719-828741 CTGCTGGCCAGGAGCCACCCAGG + Intergenic
968608921 4:1548199-1548221 CTGCCAGCCATGGGCCACCCGGG - Intergenic
968658562 4:1789331-1789353 CTTCTGCCCATGGGACCCCCTGG - Intergenic
968902980 4:3439848-3439870 ATGCTGGCCATGGGGCTCCCTGG + Exonic
969392400 4:6900597-6900619 CTGCTGTTCCTGGGCCTCCAGGG + Intergenic
969878757 4:10155953-10155975 CTGCTTTCCCTGGGCCACCCTGG + Intergenic
971311044 4:25525999-25526021 CTTCTGACCATAGGCCTCCCGGG - Intergenic
972142788 4:35982359-35982381 CTGCTGTCCAGGTGCTTCCCAGG - Intronic
973640090 4:52893897-52893919 TTGCTGTCCTTGGGCTCCCCAGG + Intronic
973792503 4:54391359-54391381 CTGCTGTGCATGTACCTCCCTGG - Intergenic
975319922 4:72998140-72998162 CTGGTATCCATGGGGCATCCTGG - Intergenic
976161223 4:82201496-82201518 CTGCAGTCCATGGGCAAGTCTGG + Intergenic
976320098 4:83704429-83704451 CTGCTGTCCTGCGACCACCCAGG - Intergenic
979230255 4:118341114-118341136 CTGGTGTCTATGGCCCACCTTGG + Intronic
980693705 4:136329031-136329053 CTGCTGTCCAAGTGCTTCCCAGG - Intergenic
982962506 4:161858291-161858313 CTGCTGTTTATAAGCCACCCAGG + Intronic
983926919 4:173412562-173412584 CTGGTGACCATGGGCCACTCAGG - Intergenic
985593348 5:776457-776479 CTGCTGGCCAGGGGCCTACCCGG - Intergenic
985708474 5:1414977-1414999 GAGCTGTCCTTGGGCCACCTTGG + Intronic
985898151 5:2762913-2762935 CTGCTCTCCAGGGGCCACTGGGG - Intergenic
988555532 5:32232811-32232833 CTGCTGGCCGTGGCTCACCCAGG + Intronic
990003960 5:50923640-50923662 CTGCCAGCCATGGGCCACCCGGG + Intergenic
991291229 5:65035514-65035536 CCGCTGCGCATGCGCCACCCAGG + Intergenic
991406129 5:66302543-66302565 CTGCTGCCCATGGGGAACCAAGG - Intergenic
995282369 5:110350674-110350696 GGGCTTTCCATGGGCAACCCAGG + Intronic
998253329 5:140567134-140567156 CTGCTGCCCCTTAGCCACCCAGG + Exonic
1002097749 5:176841448-176841470 CTGCTGCACATGGGACAGCCAGG - Intronic
1003253638 6:4455548-4455570 CTGCTGTGCTTGGGAAACCCTGG - Intergenic
1005137256 6:22583927-22583949 CTGATGCCCATGGGCCACATAGG + Intergenic
1005219065 6:23565147-23565169 CTGCTCTAAATTGGCCACCCTGG + Intergenic
1006838091 6:37011258-37011280 CTGCTATACAGGGGCCAGCCTGG - Intronic
1006867650 6:37222307-37222329 CTGCCATCCATGGCCCCCCCAGG + Intronic
1009269325 6:61598498-61598520 CTTCTGTCTATGGGGCACACTGG - Intergenic
1015506336 6:133992688-133992710 CTACTTTCCATGGCCCACCAAGG - Intronic
1015519335 6:134115091-134115113 CTGCTGTCACTGGGCCAACAGGG + Intergenic
1016894837 6:149041530-149041552 CTGGTGTGCAGGGGCTACCCTGG - Intronic
1017809025 6:157970790-157970812 CTGCTGGGAATGAGCCACCCAGG + Intergenic
1018891504 6:167986233-167986255 CTGCTGGTCAGGGGCCACACTGG + Intergenic
1019200996 6:170315105-170315127 CTGCTGTCCAGGGGCTCTCCTGG + Intronic
1019330844 7:460095-460117 CTTCTCTCCTTGGGCCATCCTGG - Intergenic
1019373907 7:678625-678647 CTGTTGTGCCTGGGCCACCCAGG + Intronic
1019479041 7:1257610-1257632 CTGCTACCCAGGGGCCAACCAGG - Intergenic
1019593652 7:1848282-1848304 CGGCTGACCATCGGCCACTCGGG + Exonic
1019745930 7:2700390-2700412 CTGCTGTCCATGGGCCACCCGGG - Exonic
1019825141 7:3278421-3278443 TTGGTGTCCGTGGGCCACACTGG + Intergenic
1021528619 7:21617973-21617995 CTGCTGTCCTGGGGACAGCCTGG - Intronic
1023280362 7:38563179-38563201 CTACTTTCCATGGTTCACCCAGG + Intronic
1024116117 7:46195505-46195527 CTGCATTCCATGGGCCACAGGGG - Intergenic
1024267794 7:47620007-47620029 CTGTTGTCTATAAGCCACCCAGG + Intergenic
1032090309 7:128908534-128908556 CTGCTGCCCAGGGGGCTCCCTGG + Exonic
1032257433 7:130308427-130308449 CTGCTGTCCCTGGGCTCGCCTGG + Intronic
1032448187 7:132002860-132002882 CTTCTGTCCAAAGGCCACCCAGG - Intergenic
1033128359 7:138724437-138724459 CAGCTGCCCCTTGGCCACCCAGG + Intronic
1033391939 7:140936897-140936919 CTGCTTTTCATGGGCCACTGAGG + Intergenic
1035484063 7:159208714-159208736 GTGGTGTTCATGGGCCACACTGG - Intergenic
1035484078 7:159208835-159208857 GTGGTGTTCATGGGCCACACTGG - Intergenic
1035812495 8:2504403-2504425 CTGCTGTTCCAGGGCCTCCCTGG + Intergenic
1045662464 8:104452378-104452400 CTGGTGTCCGTGAGCCTCCCAGG - Intronic
1048099899 8:131339694-131339716 CTGCTTACCATGTGCCACACAGG + Intergenic
1048165393 8:132057864-132057886 CTTCTGGGCAAGGGCCACCCTGG - Intronic
1048603485 8:135943595-135943617 CTGCTGTCCCTGCACCACCATGG - Intergenic
1049092981 8:140530675-140530697 CTGCTATCCTTGGGCCTCCCAGG + Intergenic
1049261658 8:141642214-141642236 CTGCGGTCCCTGGGCCTCGCAGG - Intergenic
1049339238 8:142103089-142103111 CTGCTTTCCATTGACCCCCCTGG - Intergenic
1049428131 8:142546514-142546536 CTGCTTCCCAGGGGCCTCCCAGG - Intergenic
1049552435 8:143266878-143266900 CTGCTTTCCAGGGGCGTCCCCGG - Intronic
1049647173 8:143740665-143740687 CTGCTGGGCATGGGCCATGCTGG + Intergenic
1050203932 9:3177807-3177829 CTTCTGTCCCTGACCCACCCAGG + Intergenic
1051123828 9:13781131-13781153 CTGGTTTCCCTGGGCCACACTGG - Intergenic
1054948494 9:70823088-70823110 CTGCTGCCCATGAGCCTCTCTGG + Intronic
1054948809 9:70825696-70825718 CCACTGTCCATGAGCCTCCCTGG + Intronic
1056100294 9:83294323-83294345 CTGTTGTCTATAAGCCACCCTGG + Intronic
1056792578 9:89635642-89635664 CTGCTGTTCAAGTGGCACCCTGG - Intergenic
1057201010 9:93140017-93140039 CTGCTGGCCTTGGCCCATCCAGG + Intergenic
1058420124 9:104825590-104825612 CTGCAGTGCATGGGCTTCCCTGG - Intronic
1059352974 9:113678610-113678632 ATGCTGGCCATGGGCCACCTGGG + Intergenic
1060835842 9:126754734-126754756 CGGCTCACCATTGGCCACCCAGG + Intergenic
1061034456 9:128105982-128106004 CTGCTGTCCCTGGGGTACCACGG - Intronic
1061864172 9:133483976-133483998 CTAGTGTCCATGGCCCACCTAGG + Intergenic
1062279498 9:135745668-135745690 CTGCTGTCCTCGGGACACGCCGG + Intronic
1062337781 9:136079984-136080006 CTGCTGGCCATGGGGCTGCCTGG + Intronic
1062382044 9:136291203-136291225 GTCCTGTCCTTGGGCCCCCCAGG + Exonic
1186287452 X:8060772-8060794 CTGTTGTTCATAAGCCACCCAGG + Intergenic
1189733161 X:44042975-44042997 CTACTGGCCATTGGCCAACCTGG + Intergenic
1189773897 X:44452760-44452782 CTGCTGTCAATGTGCCATCTTGG + Intergenic
1194206823 X:91019893-91019915 CTGCTATCCATGGGCCAGGCAGG - Intergenic
1195694282 X:107655300-107655322 CTGCTGTCCATCTGCCACTAGGG + Intergenic
1197093946 X:122571906-122571928 CTGGTGTCCATGCACCACCAGGG - Intergenic
1200552574 Y:4594682-4594704 CTGCTATCCATGGGCCAGGCAGG - Intergenic
1202378004 Y:24255636-24255658 CTGCTGCCCCTGGGCCACTCTGG + Intergenic
1202492778 Y:25414485-25414507 CTGCTGCCCCTGGGCCACTCTGG - Intergenic