ID: 1019747974

View in Genome Browser
Species Human (GRCh38)
Location 7:2711149-2711171
Sequence CTGAGGCTGTGGAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1814
Summary {0: 1, 1: 2, 2: 19, 3: 193, 4: 1599}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019747960_1019747974 21 Left 1019747960 7:2711105-2711127 CCTCCTCCTGCCCAGAGCTCTCT 0: 1
1: 1
2: 7
3: 83
4: 716
Right 1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG 0: 1
1: 2
2: 19
3: 193
4: 1599
1019747964_1019747974 10 Left 1019747964 7:2711116-2711138 CCAGAGCTCTCTCCGTTCCGTGA 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG 0: 1
1: 2
2: 19
3: 193
4: 1599
1019747967_1019747974 -7 Left 1019747967 7:2711133-2711155 CCGTGAGCACCATCTCCTGAGGC 0: 1
1: 0
2: 4
3: 26
4: 266
Right 1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG 0: 1
1: 2
2: 19
3: 193
4: 1599
1019747961_1019747974 18 Left 1019747961 7:2711108-2711130 CCTCCTGCCCAGAGCTCTCTCCG 0: 1
1: 0
2: 5
3: 43
4: 394
Right 1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG 0: 1
1: 2
2: 19
3: 193
4: 1599
1019747962_1019747974 15 Left 1019747962 7:2711111-2711133 CCTGCCCAGAGCTCTCTCCGTTC 0: 1
1: 0
2: 2
3: 20
4: 232
Right 1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG 0: 1
1: 2
2: 19
3: 193
4: 1599
1019747963_1019747974 11 Left 1019747963 7:2711115-2711137 CCCAGAGCTCTCTCCGTTCCGTG 0: 1
1: 0
2: 1
3: 5
4: 85
Right 1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG 0: 1
1: 2
2: 19
3: 193
4: 1599
1019747965_1019747974 -2 Left 1019747965 7:2711128-2711150 CCGTTCCGTGAGCACCATCTCCT 0: 1
1: 0
2: 0
3: 13
4: 153
Right 1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG 0: 1
1: 2
2: 19
3: 193
4: 1599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019747974 Original CRISPR CTGAGGCTGTGGAGGGAAGA GGG Intronic
900000660 1:13141-13163 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900002076 1:19969-19991 CTGAGACTGGGGAGGGACAAAGG + Intergenic
900020377 1:183660-183682 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
900021797 1:190492-190514 CTGAGACTGGGGAGGGACAAAGG + Intergenic
900037376 1:427460-427482 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
900059006 1:663201-663223 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
900081223 1:859022-859044 CTCACGCAGTGGATGGAAGATGG - Intergenic
900215047 1:1477112-1477134 CTGAGGCTCAGGTGGGAGGATGG - Intronic
900222213 1:1515180-1515202 CTGAGGCTGAGGTGGGAGGATGG - Intronic
900385323 1:2407955-2407977 CAACGGCTGTGGAGGGGAGAAGG + Intronic
900566582 1:3335164-3335186 CTGGGGCTGTGCAGGGCAGCTGG - Intronic
900584149 1:3424485-3424507 CTGATGCCGTGGAGGCCAGATGG + Intronic
901056290 1:6450050-6450072 TGCAGGCTGTGGAGGGAAGAAGG - Intronic
901153890 1:7122758-7122780 GGGAGGCTGCGGAGTGAAGATGG - Intronic
901183104 1:7355277-7355299 GGGAGGCTGAGGTGGGAAGATGG + Intronic
901272451 1:7963166-7963188 GGGAGGCTGAGGTGGGAAGATGG - Intronic
901313167 1:8285310-8285332 GTGGGGCAGTGGAAGGAAGATGG + Intergenic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
901558516 1:10050803-10050825 GGGAGGCCGAGGAGGGAAGATGG - Intronic
901814001 1:11783705-11783727 CTGAGGCTGAGGTTGCAAGATGG + Intronic
902179166 1:14674889-14674911 AGGAGGCTGAGGTGGGAAGATGG - Intronic
902218097 1:14947324-14947346 GTGAGGATGTGGAGGGAAGCAGG + Intronic
902328287 1:15717011-15717033 GGGAGGCTGAGGAGGGAGGATGG + Intronic
902346043 1:15818435-15818457 GGGAGGCTGAGGGGGGAAGATGG + Intergenic
903076282 1:20769451-20769473 GGGAGGCTGAGGTGGGAAGACGG + Intronic
903140271 1:21335075-21335097 CAGAGGCAGTGGAGGGTGGAGGG - Intronic
903186141 1:21630371-21630393 GGGAGGCTGAGGAGGGAGGATGG - Intronic
903284835 1:22270074-22270096 GTGAAGCTCTGGAGGGAACATGG - Intergenic
903350977 1:22716434-22716456 CGGAGGCTGAGGTGGGAAGATGG - Intronic
903363246 1:22790378-22790400 CTGGGGTTGGGGAGGGAACAGGG - Intronic
903557859 1:24206398-24206420 CTGGGGCTGGGGAAGGGAGAGGG - Intergenic
903756360 1:25664133-25664155 CAGAGCGTGTGGAGGGCAGATGG - Intronic
903815196 1:26059746-26059768 GTGAGACTGTTGAGGGCAGAAGG - Intronic
903903803 1:26668824-26668846 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904279004 1:29405330-29405352 CTGAGGCTGTGCAGGGCAGCGGG - Intergenic
904482959 1:30805518-30805540 CTGAGGCGGGGGTGGGAAGGGGG + Intergenic
904531249 1:31171086-31171108 CTGAGGCTGAGGCCGGAAGAGGG + Intergenic
904771935 1:32885790-32885812 CAGAGGCTGGGGAGGGAGGAAGG + Intergenic
904849074 1:33443580-33443602 CTGAGGCTGAGGCTGGAAGAAGG + Intergenic
904912983 1:33949334-33949356 CAGTGGCTGGGGAGGGCAGATGG + Intronic
905004317 1:34697947-34697969 CTGAGGCCCTGGAGGGGACATGG + Intergenic
905028189 1:34865514-34865536 CAGCGGCTGGGGAGGGGAGATGG - Exonic
905090773 1:35429736-35429758 TTGAGGCTTTGGAGGGAACAAGG + Intergenic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905249113 1:36636662-36636684 CTGAGGCTGGGGTGGGATAAGGG + Intergenic
905281753 1:36853717-36853739 TTGAGCCTGCGGAGGGGAGAGGG + Exonic
905488746 1:38327213-38327235 CTGAGGCCTTGGAGGCAAGCAGG + Intergenic
905508127 1:38496327-38496349 CCTGGGCTGCGGAGGGAAGAAGG + Intergenic
905595509 1:39203305-39203327 GGGAGGCTGAGGTGGGAAGATGG - Intronic
906056699 1:42923826-42923848 CAGAGTCTGTGGTGGGAAGTGGG + Intergenic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906628809 1:47347312-47347334 ATGAGGCTGAGGTGGGAGGATGG - Intronic
906631087 1:47369106-47369128 AGGAGGCTGAGGTGGGAAGATGG - Intronic
906660545 1:47578473-47578495 CTGAGGCTGTGGAGGGCTAGGGG - Intergenic
907101628 1:51842957-51842979 CAGAGGCTGAGGTGGGAGGATGG + Intronic
907114830 1:51959405-51959427 TGGAGGCTGTGGTGGGAGGACGG + Intronic
907252202 1:53146892-53146914 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
907483436 1:54760469-54760491 CGGAGGCTGTAGAGAGAAGAGGG - Intronic
907866206 1:58401741-58401763 CAGAAGCTGTGAAAGGAAGAAGG - Intronic
908094331 1:60721372-60721394 CTGAGGTTGTGCAGGGCAGTGGG - Intergenic
908135564 1:61128497-61128519 GGGAGGCTGAGGTGGGAAGATGG + Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908602749 1:65758773-65758795 CTGACACTGTGGAAGGAAGATGG + Intergenic
908788617 1:67758876-67758898 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
908999471 1:70201061-70201083 GACAGGCTGAGGAGGGAAGATGG + Intronic
909044939 1:70698540-70698562 ATGAATCTGTGGAGGGAAGATGG + Intergenic
909320448 1:74279241-74279263 GTGAGCCTGTGGTGGGAAGGAGG - Intronic
909412416 1:75370557-75370579 CAAAGGCTGTAGAGAGAAGATGG + Intronic
909442762 1:75716364-75716386 GGGAGGCTGAGGAAGGAAGATGG + Intergenic
909988282 1:82189571-82189593 CTGGTGATGAGGAGGGAAGAGGG - Intergenic
909991709 1:82231369-82231391 TAGAGGCTGTGGAGGGTAGGGGG - Intergenic
910067092 1:83167249-83167271 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
910197001 1:84652316-84652338 TGGAGGCTGAGGAGGGAGGATGG + Intronic
910542655 1:88378645-88378667 CTGAGGGGGAGGAGGGAACATGG - Intergenic
910935164 1:92481083-92481105 CCGAGGCTGTGGAGGCACAAGGG + Exonic
910992821 1:93073527-93073549 GGGAGACTGAGGAGGGAAGATGG - Intergenic
911331166 1:96527217-96527239 CTGAGGCTGGAGAGAGGAGAAGG - Intergenic
911337618 1:96599687-96599709 TAGAGGCTGAGGAGGGAGGATGG + Intergenic
911509862 1:98798448-98798470 CAGAGTCTGGGAAGGGAAGAGGG - Intergenic
911574465 1:99558342-99558364 GGGAGGCTGAGGCGGGAAGATGG - Intergenic
911715056 1:101123509-101123531 ATGACGCTGGGGAGGCAAGAGGG - Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911950167 1:104163269-104163291 GGGAGGCTGTGGGGGGAGGAGGG + Intergenic
912068628 1:105779475-105779497 CTGAGGCTGCGTAGAGAAGAAGG - Intergenic
912244434 1:107946012-107946034 TTGAGGCTGGGGAGGGCAGCAGG + Intronic
912369752 1:109164776-109164798 CTCAGGCTGGGCAGGGAGGATGG + Intronic
912398349 1:109366798-109366820 GGGAGGCTGAGGTGGGAAGATGG + Intronic
912615694 1:111097501-111097523 CTGAGGCTGTGCAGGGCAGCAGG + Intergenic
912774941 1:112500665-112500687 GGGAGACTGAGGAGGGAAGATGG + Intronic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
912875584 1:113355359-113355381 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
912908148 1:113729257-113729279 CTGAGGCTGAGAAGGGTAGTGGG + Intronic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
912975320 1:114324289-114324311 AGGAGGCTGTTCAGGGAAGAGGG - Intergenic
912997827 1:114549332-114549354 CTGAGGCTGTGGAATTGAGAGGG - Intergenic
913214501 1:116609349-116609371 CGGAGGCTGAGGTGGGAGGATGG - Intronic
913259952 1:116988812-116988834 CCGGGCCTGTGGTGGGAAGACGG + Exonic
913262338 1:117010900-117010922 CTGAGGATGTGGTGGGAAAGAGG - Intronic
913283001 1:117203234-117203256 CTGAGGCTGGGGTGGGGAGAAGG + Intronic
913415733 1:118604639-118604661 GGGAGGCTGAGGCGGGAAGATGG + Intergenic
914228087 1:145738701-145738723 CTGGAGCTTAGGAGGGAAGAAGG - Exonic
914837238 1:151217684-151217706 GTGAGGCTGAGGTGGGAAGATGG - Intronic
915099398 1:153488092-153488114 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
915150704 1:153828963-153828985 CAGAGGCTGAGGTGGGAGGATGG + Intronic
915205773 1:154269461-154269483 CTGAGGCTGTGAAGGTGAAATGG - Intronic
915243792 1:154542330-154542352 TGGAGGCTGAGGAGGGAGGATGG - Intronic
915254816 1:154619203-154619225 CTGGGGCTGGGGAGGGAACCTGG - Intronic
915354193 1:155246092-155246114 CAGAGGTTGTGGAGAGAGGATGG + Intergenic
915602204 1:156929494-156929516 CAGAGGTGGTGGAGGGAAGAAGG + Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915676008 1:157531813-157531835 CAGAGACTGGGGAGGGGAGAGGG + Intronic
916011866 1:160713384-160713406 CAGAGGCTGGGAAGGGTAGAGGG + Intergenic
916210525 1:162356416-162356438 CAGAGGCAGTGGAGGGCAGGAGG + Intronic
916689894 1:167180125-167180147 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
916752641 1:167737405-167737427 ATGAGGCTGGGGAGGGAACTGGG + Intronic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917133457 1:171765011-171765033 CAGAGGCTGAGGAGGGGAAAGGG + Intergenic
917322387 1:173796792-173796814 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
917658854 1:177157417-177157439 GGGAGGCTGAGGTGGGAAGATGG - Intronic
918020283 1:180681045-180681067 TAGAGGCTGGGAAGGGAAGAGGG + Intronic
918494997 1:185125567-185125589 TTGAGGCTGGGAAGGGGAGAAGG + Intronic
918586335 1:186193204-186193226 CTGAGGATGAGAAGGGAGGAAGG + Intergenic
918693856 1:187517543-187517565 ATGAGGTTGTGAAGGGAAAATGG - Intergenic
919009583 1:191942767-191942789 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
919034501 1:192289276-192289298 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
919157295 1:193782584-193782606 CAGAGGCTGGGGAGGGTAGAGGG + Intergenic
919167618 1:193916057-193916079 GTGAGAGTGTGGAGGGAAGTAGG - Intergenic
919571315 1:199252510-199252532 AGGAGGCTGTGGTGGGAGGATGG - Intergenic
919571885 1:199259360-199259382 ATGATGCTGTTGAGTGAAGAAGG - Intergenic
919598885 1:199598983-199599005 CAGAGGCTGGGAAGGGAACAGGG + Intergenic
919933336 1:202235800-202235822 CTGAGGCTGGGGTGAGAAGGAGG + Intronic
919970535 1:202574404-202574426 AGGAGGCTGAGGTGGGAAGATGG + Intronic
920025321 1:202989870-202989892 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
920096908 1:203492307-203492329 CCCAGGCTGTGGAGAGAAGATGG + Intergenic
920176471 1:204104860-204104882 CTGTCGTTGTGGAGGGAGGAAGG + Intronic
920199300 1:204249709-204249731 CTGAGACTTTGAAGGGAGGAGGG - Intronic
920678518 1:208055405-208055427 CTGAGGATGGGGAGAGATGAAGG + Intronic
920785338 1:209035333-209035355 CTGAGCCTGTGCAGGGCAGTGGG + Intergenic
921018814 1:211217424-211217446 TGGAGGCTGAGGTGGGAAGATGG - Intergenic
921033069 1:211350948-211350970 AGGAGGCTGAGGTGGGAAGATGG - Intronic
921117950 1:212112414-212112436 ATGAGACTGTGGAGGCAAGCAGG + Intergenic
921168399 1:212524276-212524298 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
921204722 1:212838804-212838826 GGGAGGCTGAGGTGGGAAGATGG - Intronic
921559890 1:216644531-216644553 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921621458 1:217330323-217330345 CTGAGGTTGTGCAGGGCAGCAGG + Intergenic
921703196 1:218290570-218290592 CAGAGGCTGAGGTGGGAGGATGG - Intronic
921939476 1:220825152-220825174 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922079336 1:222279628-222279650 TTGAGACTGTGGAGGGAACATGG + Intergenic
922299732 1:224287254-224287276 CAGAGGCTGGGAAGGGAAGGTGG + Intronic
922322443 1:224500566-224500588 GGGAGGCTGAGGAGGGAGGATGG + Intronic
922477657 1:225917835-225917857 GGGAGGCTGAGAAGGGAAGATGG - Intronic
922523760 1:226281260-226281282 CAGAGGCTGGGAAGGGAAAAGGG + Intronic
922614145 1:226951228-226951250 CTGAGAAAGTGGAGGGATGAAGG + Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
922773536 1:228203779-228203801 CAGAGGCTGGGGAGGGAAGCGGG + Exonic
922859515 1:228804185-228804207 CAGAAGCTGGGAAGGGAAGAAGG - Intergenic
923023915 1:230189205-230189227 CTGAGGCTTAGGAGAGACGAGGG + Intronic
923236421 1:232037536-232037558 GTGAGGCTGTGGATGGATCAGGG + Intronic
923334182 1:232952613-232952635 GGGAGGCTGAGGTGGGAAGATGG - Intronic
923356829 1:233164865-233164887 TAGAGGCTGGGGAGGGGAGAAGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923391262 1:233515782-233515804 CTGAGCCTGTGGAAGGCAGGGGG - Intergenic
923469471 1:234277952-234277974 GGGAAGCTGAGGAGGGAAGATGG + Intronic
923805248 1:237250587-237250609 CTGAGAATGGGAAGGGAAGACGG - Intronic
924226480 1:241926393-241926415 GTGGGGATGTGGAGGGAAAAAGG - Intergenic
924505697 1:244681487-244681509 CTGGGGCGGGGGAGGGAGGATGG + Intronic
1062771174 10:102705-102727 TTCAGGCCGTGGAGGGAAGTGGG + Intergenic
1062779487 10:188486-188508 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1062798969 10:365430-365452 CGGAGGCTGAGGCAGGAAGATGG + Intronic
1062838641 10:652487-652509 CTGAGGCTGTGGGCGGAGGAGGG - Exonic
1062878066 10:957899-957921 AGGAGGCTGAGGAGGGAGGAGGG - Intergenic
1063154739 10:3368856-3368878 CTGAGGCGGTGGGGAGAAGGAGG - Intergenic
1063261407 10:4393322-4393344 CTGAGTCTGTGGAGAGTTGAGGG - Intergenic
1063317551 10:5021110-5021132 CTGAGGCTACGGAGAGAACAGGG - Intronic
1063411493 10:5840041-5840063 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1063529761 10:6819692-6819714 CTGGGGCTGAGGAGAGGAGAAGG + Intergenic
1063538211 10:6906105-6906127 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1063671797 10:8105152-8105174 CCGAGGCTGTGGAGACAATATGG - Intergenic
1064156861 10:12909659-12909681 ATGAGGCTGTGGAGAGTGGAAGG + Intronic
1064461624 10:15540293-15540315 CAGAGGCTGGGAAGGGAAGGTGG - Intronic
1064476229 10:15691688-15691710 CAGAGGCTGGGGAGGGCAGAAGG + Intronic
1064629968 10:17300133-17300155 GAGAGGCTGAGGAGGGAGGATGG + Intergenic
1065274154 10:24068273-24068295 CTGAGGGTGTGGAGCTAAGATGG - Intronic
1065504585 10:26416481-26416503 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1065617995 10:27548537-27548559 CAGAGGCTGGAAAGGGAAGATGG + Intergenic
1065764851 10:29019010-29019032 CAGAGGCTGGGGAGGGTAGTGGG + Intergenic
1065855181 10:29824349-29824371 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1065897285 10:30175134-30175156 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1065960398 10:30729577-30729599 GAGAGGCTGAGGAGGGAGGATGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066319651 10:34289063-34289085 AGGAGGCTGAGGTGGGAAGAAGG - Intronic
1066685184 10:37975096-37975118 CAGAGGCTGCGAAGGGAAGTAGG + Intronic
1066731263 10:38439068-38439090 ATGAGAGTGTGGAGGGAAGGGGG + Intergenic
1066761679 10:38760441-38760463 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1066959908 10:42211980-42212002 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1067268349 10:44767133-44767155 CTGTGGCTTTGGAGATAAGAGGG + Intergenic
1067322004 10:45230018-45230040 TTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1067582366 10:47453796-47453818 CTGAGGTGGAGGAGGGATGAGGG - Intergenic
1068350524 10:55838891-55838913 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1068577724 10:58703267-58703289 TTGAGTCTGTGGTGGGAGGATGG - Intronic
1068950831 10:62775467-62775489 CTGAGGCTGAGGAGGCAGCATGG - Intergenic
1069400715 10:68042516-68042538 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1069414149 10:68183355-68183377 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1069415367 10:68195905-68195927 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1069754219 10:70763509-70763531 CTGAGGCTGCGATGGAAAGAGGG - Intergenic
1069995228 10:72337735-72337757 CTGAGGCTGTGGAAAGAACAGGG - Intronic
1070086643 10:73244390-73244412 GGGAGGCTGAGGTGGGAAGATGG + Exonic
1070269376 10:74938048-74938070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1070344925 10:75532295-75532317 CTGAGGCTGTGGAACCATGATGG - Intronic
1070349976 10:75582508-75582530 CTGAGGCTGGGCAGGGTAGCAGG + Intronic
1070702238 10:78612610-78612632 CTGAGAGTGTGGAGCCAAGAAGG - Intergenic
1070970861 10:80565984-80566006 CGGAGGCTGAGGCAGGAAGATGG + Intronic
1071020867 10:81053670-81053692 CTGAGGCTGCGGTGGGATGGCGG + Intergenic
1071113370 10:82189112-82189134 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1071293002 10:84200925-84200947 CTGGGGATGTGGAGGGCTGAGGG - Intronic
1071543795 10:86511824-86511846 GGGAGGCCGAGGAGGGAAGATGG + Intronic
1072034370 10:91551051-91551073 GAGAGGCTGTGGTGGGAGGATGG - Intergenic
1072049432 10:91688696-91688718 ATGAGGCTGTGGAGAGAAAGGGG + Intergenic
1072078903 10:92008446-92008468 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1072344104 10:94486250-94486272 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1072351471 10:94561568-94561590 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1072587251 10:96793560-96793582 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1072631927 10:97152200-97152222 AGGAGGCTGTGGAGGGAGGCTGG - Intronic
1072702733 10:97655677-97655699 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1073070216 10:100788498-100788520 CTGAGGCTGATGGGGGAAGTCGG + Intronic
1073192982 10:101665362-101665384 CCAAGGCTGAGGTGGGAAGATGG + Intronic
1073232422 10:101983384-101983406 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1073357391 10:102868199-102868221 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1073381248 10:103079525-103079547 CTGAGTCTGGGGAGAGGAGAGGG + Exonic
1073394021 10:103203457-103203479 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1073396323 10:103221099-103221121 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1073618864 10:105026266-105026288 CTGTGGCTGTCCAGGGGAGAGGG - Intronic
1073791957 10:106949492-106949514 CAGAGGCTGTGTAGGGATGAGGG - Intronic
1073952736 10:108829507-108829529 CTGAGGCTGCGCAGGGCAGTGGG + Intergenic
1074129727 10:110563346-110563368 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1074248043 10:111714141-111714163 CTGAGCCTGTGGGGGCAACAGGG + Intergenic
1074585703 10:114766476-114766498 CTGAGGATGTGAAATGAAGATGG - Intergenic
1074882735 10:117671350-117671372 CTGGGGCTGTGGAGTGAACTGGG - Intergenic
1074960725 10:118443002-118443024 GGGAGGCTGTGGCGGGTAGATGG + Intergenic
1075492648 10:122885959-122885981 ATGAGGTTGAGGAGGCAAGAAGG - Intergenic
1075891577 10:125955886-125955908 CTAAGGCAGTGGAAGGAAGCAGG + Intronic
1076071167 10:127490963-127490985 CTGGGGAGGGGGAGGGAAGAAGG - Intergenic
1076261851 10:129072781-129072803 CTGAAGCTGTGAAGACAAGAAGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076872735 10:133201654-133201676 CTGAGGCTGGCGAGGACAGACGG + Exonic
1076964102 11:65383-65405 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1077032240 11:473771-473793 CTGATGCTGGGGCGGGAGGAAGG - Intronic
1077276991 11:1716439-1716461 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
1077385830 11:2269121-2269143 CTGAGGCTGCGGGGGGAAGGTGG + Exonic
1077478126 11:2800516-2800538 CTGAGGCTGTGTAGGGCCCAGGG + Intronic
1077884181 11:6373877-6373899 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1078148344 11:8737850-8737872 ATGAGGCTAAGGTGGGAAGATGG - Intronic
1078642375 11:13108638-13108660 CAGGGCTTGTGGAGGGAAGAGGG + Intergenic
1078652983 11:13213174-13213196 CTATGGCTGTAGAGGGCAGAGGG + Intergenic
1079023318 11:16925908-16925930 CTGAGGAGGGGGAGGGAAAAGGG + Intronic
1079085668 11:17443117-17443139 CTGCTGCTGTCGAGGGAAGGAGG + Intronic
1079625362 11:22610770-22610792 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1080192786 11:29571260-29571282 CTGAGGCTGTGCAGGGTAGTGGG + Intergenic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080666046 11:34337257-34337279 CAGGGGCTGTGTAGGGAAGGAGG + Intronic
1080805722 11:35651511-35651533 CTCAGGCTGTGCAGGGCAGAGGG - Intergenic
1081031373 11:38088507-38088529 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1081132671 11:39399682-39399704 CTGATGATGGGGAGGTAAGAGGG + Intergenic
1081206413 11:40280820-40280842 CGGAAGCTGTGGATGGAAGCAGG - Intronic
1081291459 11:41330674-41330696 CTGAGGCTGAGGTGGGAGGATGG - Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082219047 11:49610363-49610385 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1082733160 11:56824853-56824875 CTGAGGCTTTGCAGGGCAGTAGG + Intergenic
1082780474 11:57283830-57283852 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1082797549 11:57388972-57388994 CTGAGGCTGAGGTGGGAGCATGG - Intronic
1083175989 11:60950939-60950961 CGGCGGGTGTGGAGGGAAGGAGG - Intronic
1083261876 11:61527587-61527609 CAGAGGCCGAGGAGGGAAGCTGG - Intronic
1083301162 11:61740236-61740258 CGAAGGCTGTGGAGGGACCATGG + Intronic
1083420989 11:62553213-62553235 ATGAGGCTGTGAAGGAAGGAGGG + Intronic
1083520483 11:63306247-63306269 CAGAGGCTAGGGAAGGAAGAAGG - Intronic
1083563642 11:63694575-63694597 CGGAGGCTGAGGTGGGAGGACGG - Intronic
1083704100 11:64501285-64501307 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1083766835 11:64845269-64845291 CTGAGGCTTGGGAAGGAGGAAGG + Intergenic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083857728 11:65401369-65401391 GGGAGGCTGGGGAGGGAAGCAGG - Intronic
1083895981 11:65619969-65619991 CTCAGGCTGTTGGGGGAAGGCGG - Intronic
1084016265 11:66384267-66384289 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1084067809 11:66715390-66715412 CTTTGGCTGTGGAGGGACGGGGG + Exonic
1084308828 11:68304183-68304205 CTGAGGCTGTGCAGAGCAGCAGG - Intergenic
1084522768 11:69674759-69674781 CAGGGGCTCTGGAGGGAAAAGGG + Intronic
1084651360 11:70491287-70491309 CTGAGGCTGAGGAGCAAAGTGGG + Intronic
1084665417 11:70573710-70573732 CTGAGGGTGAGGAGGGGAAACGG + Intronic
1084668006 11:70586912-70586934 GTGAGGTGGGGGAGGGAAGAGGG - Intronic
1084923925 11:72496271-72496293 CAGAGGCTGGGAAGGGAAGGGGG + Intergenic
1085068911 11:73523686-73523708 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1085206295 11:74734259-74734281 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1085304219 11:75476087-75476109 CTGAGGCTAAGGTGAGAAGAAGG - Intronic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085741642 11:79082467-79082489 CTGAGGCCGTGGAAGGAAGCAGG - Intronic
1085991153 11:81846221-81846243 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1086630604 11:89014511-89014533 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1086871455 11:92042294-92042316 CCGAGTCTGGGGAGGGTAGAGGG - Intergenic
1086954545 11:92922381-92922403 GTGTGTCTGGGGAGGGAAGAGGG - Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087513377 11:99127057-99127079 CTGAAGCTGTAGAGGTAAGTTGG - Intronic
1087585184 11:100110080-100110102 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1087624373 11:100580243-100580265 TTAAGGGTGTGTAGGGAAGAAGG - Intergenic
1087733005 11:101799642-101799664 CAGAGGCTGGGAAAGGAAGAGGG + Intronic
1087888925 11:103514311-103514333 CAGAGGCTGGGGAGGGTAAAGGG + Intergenic
1087952497 11:104240206-104240228 CAGAGCCTGAGGAGAGAAGACGG - Intergenic
1088006985 11:104953315-104953337 CAGAGGCTGTGGCAGGAATAAGG - Intronic
1088276428 11:108091449-108091471 GGGAGGCTGAGGAGGGCAGATGG + Intronic
1088295606 11:108290524-108290546 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1088327298 11:108614029-108614051 ATGAGGCTGTGGCAGGAGGATGG + Intergenic
1088356773 11:108952317-108952339 GGGAGGCTGTGGTGGGAGGAAGG + Intergenic
1088613929 11:111603604-111603626 TTGAGGCAGTGGAAGGAAGGGGG - Intronic
1088835934 11:113577996-113578018 CTGGGGCTGAGAAGGGAAAAGGG + Intergenic
1088884121 11:113993896-113993918 ATGAGGCTGTGGTGGGGAGACGG + Intergenic
1089259352 11:117212816-117212838 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1089417522 11:118304735-118304757 CTGAGGCTGGGAGGGGAGGAGGG - Exonic
1089597094 11:119587340-119587362 CTGAGACTGAGGTGGGAAGATGG + Intergenic
1089754741 11:120678340-120678362 CTGAGGCTGTGGTGCTCAGAAGG + Intronic
1089777967 11:120852231-120852253 CTGCTGCTGAGGAGGTAAGAGGG + Intronic
1089843113 11:121435984-121436006 CTGAGGCTGTGGGGGGCCCAGGG - Intergenic
1090013695 11:123066506-123066528 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1090137876 11:124217971-124217993 CAGAGGCTGTGAAGGGTAGTAGG - Intergenic
1090313429 11:125763885-125763907 CTGAGGGTGTGGAAGGCAGGAGG - Intergenic
1091192931 11:133709247-133709269 CTGAAGGTGGGGAGGGGAGAGGG - Intergenic
1091373758 12:13268-13290 CTGAGGCTGAGGAAGGAAAGGGG + Intergenic
1091375140 12:20004-20026 CTGAGACTGGGGAGGGACAAAGG + Intergenic
1091471632 12:733366-733388 TGGAGGCTGGGGTGGGAAGATGG - Intergenic
1091706307 12:2695644-2695666 CTGGGGCTGGGGAGGGCAGTGGG - Intronic
1091711535 12:2743873-2743895 CTGGGGCTGGGGAGGGCAGTGGG - Intergenic
1091733370 12:2898402-2898424 GGGAGGCTGAGGCGGGAAGATGG - Intronic
1091849277 12:3682191-3682213 CTGAGGGTGGGGAAGGAGGAAGG - Intronic
1091924171 12:4330598-4330620 CTGAGGCTGGAGGGGGAAAAGGG - Intronic
1091962860 12:4713384-4713406 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1092012090 12:5122413-5122435 CTGAGGCGGAGGAGCCAAGATGG - Intergenic
1092085793 12:5758416-5758438 GTGGGGCTGTGGAGGGAAATAGG - Intronic
1092188772 12:6502087-6502109 CTGATGCTGCAGAAGGAAGAGGG + Intronic
1092238248 12:6822739-6822761 AGGAGGCTTTGGAGGGAGGAGGG - Intronic
1092905064 12:13093556-13093578 CTGTGGCAGTGGATGGAAGCTGG - Intronic
1092937320 12:13376215-13376237 CAGAGGCTGTGGAGGTGAGTGGG - Exonic
1093106118 12:15089732-15089754 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1093186074 12:16021238-16021260 CTGAGGCTGTGCAAGGCAGTAGG - Intronic
1093549676 12:20392960-20392982 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094149523 12:27267509-27267531 ACGAGGCTGAGGTGGGAAGATGG - Intronic
1094168263 12:27464610-27464632 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1094196767 12:27757904-27757926 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1094379893 12:29831328-29831350 CTGAGGCTGTGCAGGGTGGCAGG + Intergenic
1094450045 12:30574752-30574774 CAGAGGCTGTGGAAGCAAGGTGG + Intergenic
1094559893 12:31542352-31542374 CAGAGGCTGAGAAGGGTAGAAGG + Intronic
1095134282 12:38579669-38579691 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1095329347 12:40939011-40939033 CAGAGGCTGAGGTGGGCAGATGG - Intronic
1095430667 12:42130840-42130862 AGGAGGCTGTGGTGGGAGGATGG + Intronic
1095753876 12:45741300-45741322 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1095811770 12:46379615-46379637 CTGAGGGAGTGGAGGGGAGGAGG - Intergenic
1095818867 12:46455101-46455123 TGGAGGCAGTGGAGGGAAGATGG - Intergenic
1095884588 12:47175963-47175985 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1096138325 12:49221285-49221307 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1096358884 12:50966503-50966525 CTGAGGGTGTGGAGGTGGGAAGG - Intronic
1096447883 12:51710552-51710574 CGGAGTCTGAGGCGGGAAGATGG + Intronic
1096468628 12:51863076-51863098 CGCAGGCTGTGAAGGGATGAAGG - Intergenic
1096673869 12:53216000-53216022 GTTAGACTGTGGAGGGTAGAGGG - Intronic
1096745657 12:53725309-53725331 CTGGAGCTGTGGGGGGAAGGAGG - Intronic
1096808519 12:54155304-54155326 CTAGAGCTCTGGAGGGAAGAGGG - Intergenic
1097214981 12:57403705-57403727 GTGAGGCTGAGGTGGGAGGAGGG + Intronic
1097215183 12:57405527-57405549 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1097619078 12:61918312-61918334 CTGAGGCTGGGAAGGGTAGTTGG - Intronic
1097874909 12:64634027-64634049 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1098311779 12:69156057-69156079 CAGAGGCTGAGGCGGGAGGATGG + Intergenic
1098360154 12:69646635-69646657 CTGATGCTCTGCAGGGAAAAAGG - Intronic
1098559128 12:71852265-71852287 CTGAGGTTGTGCAGGGCAGCAGG + Intronic
1098622525 12:72620416-72620438 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1098959385 12:76723410-76723432 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1099148060 12:79073204-79073226 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1099495677 12:83343251-83343273 CCGAGGCTGTACAGGGCAGAGGG - Intergenic
1100273922 12:93053381-93053403 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1100326283 12:93542963-93542985 AGGAGGCTGTGGCAGGAAGATGG - Intergenic
1100588230 12:95999266-95999288 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1100595478 12:96068237-96068259 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1100726517 12:97414569-97414591 CTGAGGTATTGGAGGGAGGAAGG - Intergenic
1101172328 12:102110738-102110760 AGGAGGCTGAGGTGGGAAGACGG + Intronic
1101207276 12:102501197-102501219 CGGAGGCTGAGGCGGGAGGATGG + Intergenic
1101242017 12:102848351-102848373 CTGAAGAGGTGGAGGGTAGACGG + Intronic
1101479776 12:105085087-105085109 GGGAGGCCGAGGAGGGAAGATGG + Intergenic
1101635927 12:106541278-106541300 TTGAGGCTGTGGAGAGCAGTGGG + Intronic
1101959135 12:109235082-109235104 CTAGGGCTGTGGTGGGGAGAGGG - Intronic
1102011031 12:109618500-109618522 CTGAGGCTGGGCAGGGGAGGTGG - Intergenic
1102016333 12:109650356-109650378 GAGAGGCTGAGGAGGGCAGATGG + Intergenic
1102050629 12:109859157-109859179 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1102123167 12:110458971-110458993 CTGAGGGTGAGGAAGGCAGAGGG - Intronic
1102243346 12:111339354-111339376 CTGAGGCAGAGGAGGGAGGGAGG - Intronic
1102611213 12:114114026-114114048 CTGAGGCTTAGAAGGGCAGAGGG - Intergenic
1102612509 12:114124852-114124874 CTGAGGCTCAGAAGGGCAGATGG - Intergenic
1102732096 12:115120631-115120653 TTGAGGGTGGGGGGGGAAGAGGG + Intergenic
1102832510 12:116017718-116017740 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1102847512 12:116202731-116202753 CAGAGGCTGTCAGGGGAAGAAGG - Intronic
1102989379 12:117303786-117303808 CTGAGTTTGTGCAGGGAGGATGG + Intronic
1103080426 12:118019609-118019631 CTGAGGATCAGGAAGGAAGAAGG - Intronic
1103198982 12:119070909-119070931 CAGAGGCAGTGGAGTAAAGACGG - Intronic
1103202251 12:119097252-119097274 GTGGGGCTGTGGAGGGCTGAGGG + Intronic
1103252080 12:119508655-119508677 CTGAAGCTGAGGAGGGAGGCAGG + Intronic
1103435563 12:120922797-120922819 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1103497961 12:121377499-121377521 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1103583809 12:121936340-121936362 GGGAGGCTGAGGCGGGAAGATGG + Intronic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103682032 12:122701840-122701862 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1103683780 12:122715301-122715323 CTGAGGCAGATGTGGGAAGAAGG + Exonic
1104073248 12:125366016-125366038 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1104079300 12:125416259-125416281 ATGAGACTGTGTAGGGAAGGCGG - Intronic
1104588938 12:130068968-130068990 CTGAGGCTGTGTGGGGAGGGAGG + Intergenic
1104666902 12:130653902-130653924 CTGAAGCTGTGCAGGGCAGCGGG + Intronic
1104698256 12:130880825-130880847 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1104742267 12:131186928-131186950 CGGAAGCTGGGGAGGGTAGAGGG + Intergenic
1104759688 12:131289479-131289501 CTGAGGCTGTGCAGGGAGGAGGG - Intergenic
1104772727 12:131373881-131373903 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104950712 12:132438715-132438737 CTGTGGCTGTGCAGGAAACAGGG - Intergenic
1105218230 13:18302821-18302843 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1105295274 13:19083681-19083703 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1105583737 13:21724701-21724723 CAGAGGCTGTGGAGTCAAGCCGG - Intergenic
1105643520 13:22291072-22291094 CGGAGGCTGAGGTGGGAAAATGG + Intergenic
1105774040 13:23639752-23639774 CTGAGGCAGTGGTGGGAGGGAGG + Intronic
1106117464 13:26829858-26829880 GTGGGGCTGGGGAGGGGAGATGG + Intergenic
1106233947 13:27845652-27845674 CTGAGGCGGTGGGGAGGAGAAGG - Intergenic
1106351707 13:28936990-28937012 CTGGGGTTGTGGAGGAAATAGGG + Intronic
1106588334 13:31076363-31076385 CAGATGGTGTGGAGGGGAGATGG + Intergenic
1106792521 13:33169993-33170015 CAGAGGCTGAGGAGGGTAGTGGG + Intronic
1106842711 13:33702255-33702277 CAGAAGCGGTGAAGGGAAGAGGG - Intergenic
1106960352 13:34990536-34990558 CTGAGGTTGTGTAGGGTAGCAGG + Intronic
1107112545 13:36713454-36713476 CAGAGGCTGGGGAGGGTGGAGGG - Intergenic
1107164125 13:37265479-37265501 CACAGGCTGTGGAGGGAGCATGG - Intergenic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1107621263 13:42232887-42232909 AGGAGGCTTAGGAGGGAAGATGG + Intronic
1107707966 13:43125700-43125722 CAGAGGCTGGGAAGGGAAGTCGG + Intergenic
1107851667 13:44577415-44577437 CGGAGGAGGAGGAGGGAAGATGG + Intergenic
1108552782 13:51563245-51563267 CAGAGGTTGTGGAGAGAAGGGGG + Intergenic
1108610958 13:52083466-52083488 CTGAAGCTGTGGCGGGGAAAAGG - Intronic
1108645325 13:52421356-52421378 CAGAGGCTGGGGAGGGTAGGTGG + Intronic
1108688222 13:52839168-52839190 TTGAGGCTGAGGAGGGAGGCAGG + Intergenic
1108981839 13:56523872-56523894 CTGAGGCTGAGAAGAGAAGCAGG + Intergenic
1110411189 13:75205168-75205190 CTGAGGCTGTGCAGGGCAGCAGG + Intergenic
1110804242 13:79736303-79736325 CTCAGGCTGGGGAAGGAAAAAGG - Intergenic
1110868604 13:80424214-80424236 CTGAGGCTATGAAGGGCAGCAGG + Intergenic
1110890166 13:80688935-80688957 CTGAGGCTGTACAGGGCAGTGGG + Intergenic
1111032062 13:82614255-82614277 GAGAGGCTGAGGTGGGAAGATGG + Intergenic
1111198970 13:84909288-84909310 GTGAGGCTGTGGAGAGAAATAGG + Intergenic
1111458071 13:88509104-88509126 CTGAGGCTGTGCAGGGCAATGGG + Intergenic
1111600303 13:90464795-90464817 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1111773023 13:92623059-92623081 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1111876381 13:93902220-93902242 CAGAGGCTGAGGAGGGGAGAGGG - Intronic
1111962287 13:94824849-94824871 GAGAGGCTGAGGTGGGAAGATGG - Intergenic
1112005374 13:95249114-95249136 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1112067856 13:95813820-95813842 TTGAGGCTGTGCAGGGCAGCAGG - Intronic
1112181972 13:97091921-97091943 CAGAGGCTGGGGAGGGAAGGAGG + Intergenic
1112373540 13:98816887-98816909 ATGAGGCTGTGGAGGTGGGAAGG + Intronic
1112598247 13:100829915-100829937 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1112601309 13:100858288-100858310 CAGAGGCTGAGGAAGGAAAATGG - Intergenic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113808572 13:113123820-113123842 CAGAGGCTGGGGAGGGCAGGGGG - Intronic
1114441002 14:22747528-22747550 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1114482561 14:23044701-23044723 CTGAGGCTGGGGAGTGAGCAAGG - Intergenic
1114716160 14:24827094-24827116 TGGAGGCTGAGGTGGGAAGATGG + Intronic
1115241477 14:31254559-31254581 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1115916582 14:38321603-38321625 CTGAGGCTGCACAGGGCAGAAGG + Intergenic
1115936624 14:38559867-38559889 CTGAGGCTGTGCAGGGCATTGGG + Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116448626 14:45039713-45039735 CTGAGCCTGTGGGGGGCAGGGGG + Intronic
1116560249 14:46369565-46369587 CTGAGGCAGTGAAGGGATCAGGG + Intergenic
1116577647 14:46595358-46595380 CAGAGGCTGGTCAGGGAAGAAGG - Intergenic
1116898129 14:50337111-50337133 GGGAGGCTGAGGTGGGAAGACGG - Intronic
1117127831 14:52650112-52650134 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117398025 14:55330684-55330706 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1117886706 14:60371747-60371769 CTGAGGCTGCACAGGGAAGTGGG - Intergenic
1118247793 14:64128256-64128278 GGGAGGATGTAGAGGGAAGAAGG + Intronic
1118837238 14:69485606-69485628 CTCAGGCTAAGGAGGGAGGAAGG + Intronic
1118888086 14:69883287-69883309 CAGAGGCTGAGGAAGGAAGAGGG - Intronic
1118985888 14:70754574-70754596 CTGAGGCTGAGGCGGGAGAATGG - Intronic
1119233445 14:72999480-72999502 CAGAGGCTGAGGTGGGAAGATGG + Intronic
1119456106 14:74756836-74756858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1119500488 14:75122901-75122923 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119671883 14:76526210-76526232 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1119743484 14:77028372-77028394 CCGACGCTGCGGAGGGGAGAAGG - Exonic
1119844269 14:77816790-77816812 CTGATGTTGTGGGGGGAAGTGGG + Intronic
1119869181 14:78000594-78000616 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1120017528 14:79490659-79490681 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1120515447 14:85464834-85464856 CTGAGGCTAAGCAGGGAAGTGGG - Intergenic
1120963152 14:90143310-90143332 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1121004522 14:90480671-90480693 GGGAGGCTGAGGCGGGAAGAGGG - Intergenic
1121021806 14:90584792-90584814 GAGATGCTGTGGAGGGCAGAGGG + Intronic
1121186691 14:91978601-91978623 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1121212502 14:92219241-92219263 CTGAGGCTGAGAAGGGTAGTGGG + Intergenic
1121384802 14:93510168-93510190 CTGAGGTTGTGCAGGGCAGTGGG + Intronic
1121435212 14:93914783-93914805 CTGAGGCAGTGGAGAAGAGATGG - Intergenic
1121553909 14:94822114-94822136 CCGAAGCTGTAGAGGGAAGATGG + Intergenic
1121561089 14:94876148-94876170 GGGAGGCTGGGAAGGGAAGATGG - Intergenic
1121641067 14:95485248-95485270 CTGATGCAGTTGAGGCAAGAAGG - Intergenic
1121695824 14:95911143-95911165 CTGAGGCTGGAGGGGGAAGCGGG - Intergenic
1121709464 14:96026843-96026865 CTGAGGGTGCAGAGGGAACATGG + Intergenic
1121914109 14:97820495-97820517 CTGAGGCTGTAGAGAGCAGTGGG - Intergenic
1122307444 14:100774701-100774723 GTGAGGCTGAGGCGGGAGGATGG - Intergenic
1122519517 14:102333686-102333708 GGGAGTCTGTAGAGGGAAGAAGG - Intronic
1122565823 14:102655048-102655070 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1122925649 14:104898261-104898283 AGGAGGCGGTGGAGGGCAGATGG + Intergenic
1123038416 14:105480614-105480636 GTGTGGCTGAGGAGGGAAGGGGG + Intergenic
1202880380 14_KI270722v1_random:53060-53082 CGGAGGCTGAGGTAGGAAGATGG + Intergenic
1123436645 15:20259377-20259399 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1123767389 15:23495143-23495165 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1123978087 15:25571557-25571579 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1124009541 15:25826455-25826477 GAGAGGCTGAGGTGGGAAGATGG + Intronic
1124029055 15:25992603-25992625 CATGGGCTGTGGAGGGTAGAGGG - Intergenic
1124031551 15:26016815-26016837 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
1124475407 15:30028902-30028924 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1124937327 15:34185657-34185679 CTGAGACAATGCAGGGAAGAAGG + Intronic
1124951714 15:34328776-34328798 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1125102135 15:35926463-35926485 GGGAGGCAGTGGTGGGAAGATGG + Intergenic
1125251771 15:37713270-37713292 GTGAGGCTGTGCAGGGCAGTGGG - Intergenic
1125594446 15:40875304-40875326 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1125624847 15:41099675-41099697 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1125796788 15:42409286-42409308 CTGTGGCTGTGGAGGCACAAAGG - Exonic
1126087294 15:45022466-45022488 CTGAGGCTGTGGGTGGAGCACGG - Intergenic
1126113621 15:45189337-45189359 CTGAGGCAGTGGGGGAAAGGGGG - Intronic
1126490676 15:49232331-49232353 TTGAGCCTGTGCAGGGAAGTGGG + Intronic
1126751053 15:51876956-51876978 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1126815023 15:52446213-52446235 CTGAGGCTGTGCAGGGTAGTGGG - Intronic
1127455801 15:59155051-59155073 CTGGGGATGGGGAGGGTAGAAGG + Intronic
1127456513 15:59160512-59160534 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1127653181 15:61029340-61029362 ATGAGACTGAGGAGGGAAGCAGG + Intronic
1127680819 15:61296184-61296206 CTAAAGATGTTGAGGGAAGAAGG - Intergenic
1127980176 15:64029313-64029335 CAGAGGCTGTGGATGAGAGAGGG - Intronic
1128083209 15:64868567-64868589 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1128184896 15:65636475-65636497 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1128514467 15:68333797-68333819 CAGAGGCTGGGGAGGGAGGCTGG - Intronic
1128543188 15:68551062-68551084 CTGACTCTCTGGGGGGAAGAGGG + Intergenic
1128569908 15:68726459-68726481 CCGGGGCTGCTGAGGGAAGAGGG - Exonic
1128575590 15:68772333-68772355 CAGATTCAGTGGAGGGAAGATGG - Intergenic
1128649306 15:69398824-69398846 CTGAGTCAGAGGAGGGCAGAGGG + Intronic
1128655735 15:69460659-69460681 CAGAGGCTAAGGTGGGAAGATGG - Intergenic
1129005486 15:72369640-72369662 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1129027438 15:72590684-72590706 AGGAGGCTGTGGCAGGAAGATGG - Exonic
1129102177 15:73275548-73275570 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1129126556 15:73446876-73446898 CTCTGGCTGTGGTGTGAAGATGG + Intronic
1129414361 15:75367005-75367027 CTGAGCCAGTGAAGGGAGGAAGG + Intronic
1129587712 15:76885586-76885608 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1129591665 15:76920579-76920601 CTGAGGATGTGGTGGAGAGAAGG - Intergenic
1129683316 15:77670774-77670796 CTGCTGCTGGGCAGGGAAGATGG + Intronic
1129793167 15:78355415-78355437 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1130095215 15:80850666-80850688 TTGAAGGTGTGGAGGGAAGGGGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130170405 15:81506470-81506492 ATCAGGCTGGGGAGGGAAGTAGG + Intergenic
1130225422 15:82054402-82054424 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1130261504 15:82357619-82357641 GGGAGGCTGAGGTGGGAAGACGG - Intergenic
1130279731 15:82511392-82511414 GGGAGGCTGAGGTGGGAAGACGG + Intergenic
1130333361 15:82938414-82938436 TTGAGGCTGTGGCCAGAAGAGGG - Intronic
1130512621 15:84601783-84601805 GGGAGGCCGAGGAGGGAAGATGG - Intronic
1130553735 15:84908660-84908682 GTGAGGCTGGGAAGGGAGGAGGG - Intronic
1130570569 15:85039459-85039481 GTGAGGATGTGGAGGAGAGAAGG + Intronic
1130843967 15:87726930-87726952 GTGAGTCAGAGGAGGGAAGATGG + Intergenic
1130857734 15:87856092-87856114 AAGAGGCAGTGGAAGGAAGAAGG - Intergenic
1130877588 15:88028039-88028061 GTGAGGGTGAGGAGGGAAAATGG + Intronic
1131054454 15:89367478-89367500 CTGAGGCTTCTGAGGGCAGAGGG + Intergenic
1131284853 15:91048376-91048398 CAGAGGCTGAGGAAGGAGGATGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131468058 15:92671389-92671411 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1131850787 15:96541314-96541336 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1132039185 15:98510889-98510911 CTGGGGCTGGGGAGGGTAGAAGG + Intronic
1132284712 15:100654509-100654531 GGGAGGCGGCGGAGGGAAGAAGG - Intergenic
1132444449 15:101899800-101899822 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1132451436 15:101970970-101970992 CTGAGACTGGGGAGGGACAAAGG - Intergenic
1132452847 15:101977804-101977826 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1132454050 16:12822-12844 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1132745563 16:1434794-1434816 CTCCGGCTGTGGAGTGAGGAGGG - Exonic
1132754483 16:1475919-1475941 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133012436 16:2921655-2921677 TGGAGGCTGAGGTGGGAAGATGG + Intronic
1133132739 16:3687741-3687763 CAGAGGCTGAGGAGGAAGGATGG + Intronic
1133142768 16:3760194-3760216 CTGAGGCTGAGGCAGGAGGATGG - Intronic
1133236806 16:4391181-4391203 GGGAGGCTGTGGTGGGAGGACGG + Intronic
1133279503 16:4657200-4657222 GTGAGGCTGCGGCAGGAAGAGGG - Intronic
1133299320 16:4772603-4772625 CAGAGGCTGAGGCGGGCAGATGG + Intergenic
1133742170 16:8659963-8659985 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1133748976 16:8709909-8709931 CTCAGGCGGCGGAGGGAGGATGG - Intronic
1133935668 16:10267332-10267354 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1134122781 16:11596656-11596678 GGGAGGATGTGGAGGGAAAAAGG + Intronic
1134186453 16:12088704-12088726 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1134604642 16:15560686-15560708 TGGAGGCTGAGGAGGGAGGATGG + Intronic
1135053780 16:19213767-19213789 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1135283921 16:21176793-21176815 AAGAGGCTGAGGAGGGAGGATGG + Intronic
1135711571 16:24721700-24721722 GTGAGGCTGAGGTGGGAAGATGG + Intergenic
1135738290 16:24951286-24951308 CTGAGGCTTGGGAGGGAACAGGG - Intronic
1136171625 16:28493404-28493426 GTGGGGCTGGGGAGGGGAGAAGG + Intronic
1136229474 16:28878139-28878161 GTGAGGCCGGGGATGGAAGAGGG + Intergenic
1136271229 16:29149538-29149560 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1136366849 16:29812947-29812969 CTTGGGGTGAGGAGGGAAGAGGG - Intronic
1136377823 16:29876068-29876090 CTGAGGTTGTGAAGAGCAGATGG - Intronic
1136471108 16:30480890-30480912 CGGAGGCTGACGAGGGAGGATGG + Intronic
1136495534 16:30641239-30641261 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1136579210 16:31141844-31141866 ATGAGTCTGCAGAGGGAAGAAGG + Exonic
1137409874 16:48219272-48219294 AGGAGGCTGAGGAAGGAAGATGG - Intronic
1137456095 16:48618965-48618987 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1137594649 16:49715638-49715660 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1137738955 16:50746140-50746162 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1137977926 16:53046578-53046600 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1138084174 16:54118736-54118758 CGGAGGCTGGGAAGGGAAGAAGG - Exonic
1138130184 16:54472739-54472761 CAGAGGCTGAGGAGTCAAGAAGG + Intergenic
1138143607 16:54588988-54589010 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1138245334 16:55463020-55463042 CTGATGCAGTGGAGGAATGAAGG - Intronic
1138346046 16:56320831-56320853 CTGGGACAGTGGTGGGAAGAGGG + Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138560781 16:57799904-57799926 CTGAGCCTGTGGAGGGAGAAGGG + Intronic
1138569458 16:57859915-57859937 AGGAGGCTGAGGAGGAAAGATGG + Intronic
1138659306 16:58508247-58508269 GTGCTGCTGGGGAGGGAAGAGGG - Intronic
1138674002 16:58637751-58637773 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1139139687 16:64246198-64246220 CTGAAAGTGTGGAGGGAGGAAGG + Intergenic
1139449006 16:67015526-67015548 GGGAGGCTGTGGCGGGCAGATGG + Intergenic
1139559963 16:67735654-67735676 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1139939730 16:70596562-70596584 CTGAGGCAGTGGTGGGAAATGGG - Intronic
1140050919 16:71480286-71480308 CTGAGGCAGTGCTGGGATGAGGG - Intronic
1140338124 16:74130854-74130876 CTGAGGCTGGGAAGGGTAGAGGG + Intergenic
1140566512 16:76049063-76049085 GGGAGGCTGTGGTGGGAGGAGGG + Intergenic
1141236364 16:82221462-82221484 CAGAGGCTGGGGAGGGAAGGAGG - Intergenic
1141558855 16:84853673-84853695 CTGATGCTTTCCAGGGAAGATGG - Intronic
1141651435 16:85395119-85395141 CTGAGGATGAGGAGGAAGGATGG + Intergenic
1141834510 16:86529842-86529864 TGGAGGCTGAGGAGGGAGGATGG + Intergenic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141924310 16:87157331-87157353 CAGAGGCTGGGGAGGGGAGTGGG + Intronic
1141956594 16:87376079-87376101 CTGTGGCAGTGGAGGGCAGGGGG - Intronic
1141991339 16:87612226-87612248 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1142357901 16:89612264-89612286 TTGAGGCTGTGAAGGAAAGTGGG - Intergenic
1142521454 17:507667-507689 TTGGGGCTGTGGAGGGAGGGAGG + Intergenic
1142524017 17:525587-525609 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1142620815 17:1164769-1164791 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1142632242 17:1232551-1232573 CGCAGGCTGAGGAGGGAGGATGG - Intergenic
1142658992 17:1414608-1414630 ATGAGGCTGGGAAGGGAAGGAGG + Intergenic
1142737983 17:1913656-1913678 GGGAGGCTGGGGAGGGAGGATGG + Intergenic
1142743790 17:1945008-1945030 CTGCGGCTGGGGAGGGAAGGAGG - Intronic
1142857655 17:2740859-2740881 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1142990754 17:3729210-3729232 ATGACGCTGTGGAGGGAAGAAGG - Intronic
1143028370 17:3953895-3953917 CTGAGTCGGGGGAGGGTAGAGGG - Intronic
1143136826 17:4716796-4716818 CTGGGGATGAGAAGGGAAGAAGG - Intronic
1143272110 17:5683474-5683496 CTGGGGCCGTGGAGGGCAGGGGG + Intergenic
1143329317 17:6121840-6121862 GTGAGGCTGTGGAGGCCAGGAGG + Exonic
1143462762 17:7114588-7114610 CTGAGGCTGGGGAGGCAACTGGG - Intronic
1143943678 17:10570407-10570429 CAGAGGCTGGGAAGGGAAGTAGG - Intergenic
1144526462 17:15994545-15994567 CTAAAGCTGTGGAGGGAACTGGG - Intronic
1144643510 17:16952767-16952789 CTGAGGCTGGAGAGGGGAGGTGG - Intronic
1144805122 17:17960436-17960458 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1145205241 17:20981309-20981331 CTGAGGCTGGAGAGGGGAGGTGG + Intergenic
1145246515 17:21273255-21273277 CTGAGGCTGTGGTGGCAGGTAGG - Intergenic
1145262135 17:21360839-21360861 CTAAGGCTGGGGAGGGCAGTGGG - Intergenic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1145310766 17:21700069-21700091 CTGAGGCTGTGCTGGGAAAGGGG - Intronic
1145923686 17:28630259-28630281 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1146003108 17:29143335-29143357 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1146026512 17:29326217-29326239 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1146049168 17:29535204-29535226 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1146137638 17:30337258-30337280 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1146327457 17:31899190-31899212 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1146329497 17:31916369-31916391 CGGAGGCTGTGGAGGGAGAATGG - Intergenic
1146406098 17:32539506-32539528 TAGAGGCTCTGGAGGGAACATGG - Intronic
1146646156 17:34578901-34578923 CTGTTGCTGGGGAAGGAAGACGG - Exonic
1146798237 17:35798062-35798084 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1147748417 17:42710734-42710756 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1147786468 17:42981719-42981741 CTGAGGCTGAGGCGGGAGGATGG - Intronic
1148242076 17:46006421-46006443 CAGAGGCTGAGGAGGGTGGAGGG + Intronic
1148813110 17:50307472-50307494 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1149110335 17:53020293-53020315 CTGAGACTGGGAAGAGAAGAAGG + Intergenic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149261285 17:54882549-54882571 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
1149358672 17:55870159-55870181 CTGAGGCTGTGCAAGGCAGTGGG + Intergenic
1149401538 17:56301459-56301481 CTGATGCTGTGTAGTGAAAATGG - Intronic
1149432510 17:56605636-56605658 CTGAGGGCGAGGATGGAAGATGG - Intergenic
1149438827 17:56657512-56657534 ATGAAGCTGTGAGGGGAAGAAGG + Intergenic
1149628633 17:58100129-58100151 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149685671 17:58533153-58533175 CTCAGCCAGGGGAGGGAAGAGGG + Intronic
1149737903 17:59013765-59013787 TGGAGGCTGAGGTGGGAAGATGG - Intronic
1149758035 17:59204289-59204311 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1149853203 17:60054115-60054137 CCAAGGCTGTGCAGGGAAGTGGG - Intronic
1149879275 17:60271914-60271936 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1150009446 17:61490630-61490652 GTCAGGCTGTGAAGGGATGAAGG - Intergenic
1150023053 17:61640240-61640262 CAGAGGCTGAGAAGGGTAGAGGG + Intergenic
1150386467 17:64765519-64765541 CTGAGAATGGGGAGGGAGGAGGG - Intergenic
1150710146 17:67524201-67524223 GTGAGGCTGTGGCGGGAGGATGG + Intronic
1150737347 17:67751824-67751846 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1150752932 17:67882891-67882913 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1150963551 17:69940876-69940898 CTGAGGCTGTGCAGGGAAGCAGG - Intergenic
1150979451 17:70125163-70125185 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1151397262 17:73831747-73831769 CAGAGGCTGTAGAAGGCAGACGG - Intergenic
1151595098 17:75073618-75073640 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1151693154 17:75699766-75699788 AGGAGGCTGTTGAGAGAAGAAGG - Exonic
1151775364 17:76197671-76197693 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1152163694 17:78686713-78686735 CAAAGGCAGGGGAGGGAAGATGG + Intronic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152217237 17:79040797-79040819 GTGAGGCTGAGGTGGGAGGATGG + Intronic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152272221 17:79331388-79331410 CAGAGGCTTTGGAGGCAGGAAGG - Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152548031 17:81012742-81012764 CTGAGGCTGTATAGGGAAGTGGG - Intergenic
1152574704 17:81134865-81134887 CTGGGGCTGGGAAGGGAACATGG + Intronic
1152585942 17:81189484-81189506 CTCAGGCTGCGGAGGGGAGTGGG + Intergenic
1152660067 17:81537945-81537967 CTGTGGATGTGGACGGAAGTGGG - Intergenic
1152701928 17:81823651-81823673 GTGAGGCTGGGGTGGGCAGAGGG - Intronic
1153236467 18:2993038-2993060 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1153699993 18:7683272-7683294 GAGAGGCTGAGGAGGGAGGATGG - Intronic
1153804798 18:8702836-8702858 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1154308915 18:13252780-13252802 CTGTGGATGTGGAGGGCCGACGG - Intronic
1155075729 18:22352593-22352615 CAGAGGCTGGGGAAGGTAGAGGG - Intergenic
1155241780 18:23870820-23870842 CAGGGGCTGGGGAGGGAAAAAGG + Intronic
1155416591 18:25605627-25605649 CATAGGCTGTTGAGGGAAGGTGG - Intergenic
1155454430 18:25996260-25996282 CAGAGGCTGAGGCGGGAAAATGG + Intergenic
1156114105 18:33766486-33766508 ATGGGGCTTTGGAAGGAAGAAGG + Intergenic
1156292401 18:35759450-35759472 CAGAGGCTGGGGAGGGGGGAGGG + Intergenic
1156347524 18:36271064-36271086 GGGAGGCTGTGGCGGGAGGATGG - Exonic
1156500414 18:37554061-37554083 TTGTGGCTGAGGAGGGGAGAGGG + Intronic
1156551470 18:38023627-38023649 CTGAGGCTGTGGTGGGAGTGGGG - Intergenic
1156610014 18:38714766-38714788 CTGCGTATGTGGAGGGAAGCTGG + Intergenic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1156737464 18:40277896-40277918 CAGAGGCTTTGGAGGGAGCATGG + Intergenic
1156819292 18:41353026-41353048 AGGAGGCTGAGGCGGGAAGATGG + Intergenic
1157264563 18:46206879-46206901 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1157294301 18:46431514-46431536 CTGGGGCTGTGGAGGGTGCAGGG + Intronic
1157547943 18:48560673-48560695 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1157622791 18:49025902-49025924 CAGAGGCCGTGGAGGCCAGAGGG - Intergenic
1158481034 18:57821990-57822012 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1158597092 18:58826082-58826104 TGGAGGCTGAGGCGGGAAGATGG - Intergenic
1158900643 18:61958620-61958642 TCGAGGCTGCGGAGGGAAGCAGG + Intergenic
1159063111 18:63537910-63537932 ATGAGACTGTGGTGGGATGAAGG + Intergenic
1159196424 18:65122282-65122304 CTGAGGCTGCGCAGAGAAGCAGG - Intergenic
1159202858 18:65209757-65209779 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1159657350 18:71048073-71048095 CTGAGATTGAGGAAGGAAGAAGG - Intergenic
1159784689 18:72698814-72698836 CTGTGACTCTGGAGGCAAGAAGG + Intergenic
1159883778 18:73885066-73885088 CTCAGGCTCTGCAGGGAACAGGG - Intergenic
1159948584 18:74461858-74461880 AGGAGGCTGGGGTGGGAAGATGG - Intergenic
1160242650 18:77133952-77133974 CTGAAGGTGAGGAGGGAAAAGGG + Intergenic
1160321451 18:77900076-77900098 CTGAGGCTGGGGAGGGTCTAAGG - Intergenic
1160396229 18:78574279-78574301 CCGAGGCTGTGCAGGGCAGCAGG - Intergenic
1160428898 18:78797865-78797887 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1160433962 18:78832013-78832035 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160433999 18:78832155-78832177 CAAAGGCTGAGGAGGGAAGGAGG - Intergenic
1160434013 18:78832201-78832223 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434038 18:78832297-78832319 CAAAGGCTGAGGAGGGAAGGAGG - Intergenic
1160434061 18:78832389-78832411 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434096 18:78832527-78832549 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434145 18:78832757-78832779 CAGAGGCTGAGAAGGGAAGGGGG - Intergenic
1160434160 18:78832803-78832825 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434188 18:78832899-78832921 CAGAGGCTGAGAAGGGAAGGAGG - Intergenic
1160434211 18:78832991-78833013 CAGAGGCTGAGAAGAGAAGAAGG - Intergenic
1160535626 18:79589938-79589960 CTGAGGCCCTGGGAGGAAGAGGG - Intergenic
1160633828 19:61577-61599 CTGAGACTGGGGAGGGACAAAGG + Intergenic
1160640905 19:135015-135037 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1160799366 19:960660-960682 CTGAGGCCCTGGTGGGAAGAGGG - Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161205377 19:3038311-3038333 CGGAGGCTGAGGCAGGAAGACGG - Intronic
1161220414 19:3115736-3115758 CCGAGGCTGTGAGGGGAGGAGGG + Intronic
1161220458 19:3115864-3115886 CTGAGGCTGTGAGGGGAGGAGGG + Intronic
1161220480 19:3115929-3115951 CCGAGGCTGTGAGGGGAGGAGGG + Intronic
1161226682 19:3150206-3150228 CAGTGGCTGTGGAGGGATGCCGG + Exonic
1161323950 19:3654104-3654126 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1161369410 19:3902071-3902093 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1161413275 19:4129309-4129331 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
1161749256 19:6082535-6082557 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1161833897 19:6631717-6631739 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1161926154 19:7301679-7301701 CTGGGGCTGGGGAGGGGAGGTGG - Intergenic
1162041482 19:7973550-7973572 AGGAGGCTGAGGAGGTAAGATGG - Intronic
1162164144 19:8740836-8740858 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162165215 19:8748305-8748327 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162166280 19:8755759-8755781 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162167346 19:8763215-8763237 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162168287 19:8769515-8769537 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162169354 19:8776968-8776990 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162170034 19:8782280-8782302 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162171119 19:8789933-8789955 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162202104 19:9028029-9028051 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1162318272 19:9954490-9954512 CTCAGGAGGTGGAGGCAAGAGGG + Intergenic
1162355889 19:10184571-10184593 AGGAGGCTGTGGTGGGAGGATGG + Intronic
1162376193 19:10306708-10306730 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1162418561 19:10552870-10552892 CTGAGGACCTGGCGGGAAGAGGG - Exonic
1162535980 19:11262845-11262867 CTGAGCCTGAGGAGGGAGGGAGG + Intergenic
1162687432 19:12399746-12399768 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162691745 19:12439589-12439611 CTGAGGCTGAGGTGGGATGATGG - Intronic
1162716141 19:12635574-12635596 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163096409 19:15060754-15060776 CAGAGGCTGGGAAGGGAAGCGGG + Intergenic
1163245743 19:16092957-16092979 GGGACGCTGAGGAGGGAAGATGG - Intronic
1163276739 19:16289520-16289542 GGGAGGCTGAGGCGGGAAGATGG - Intergenic
1163299292 19:16433582-16433604 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1163324996 19:16597825-16597847 GTGAGGCTGAGGTGGGAAGATGG - Intronic
1163344375 19:16730787-16730809 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1163400617 19:17090246-17090268 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1163414443 19:17177580-17177602 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1163709120 19:18835100-18835122 CAGGGGCTGTGGAGGTAGGACGG - Intronic
1164404110 19:27927162-27927184 GTGAGGCAGTGGAGAGAGGAAGG + Intergenic
1164531485 19:29051656-29051678 TTGAGGGTGTGGAGGGGAGGAGG - Intergenic
1164543442 19:29139716-29139738 CAGAGGCTGAGGAAGGGAGATGG + Intergenic
1164634726 19:29784191-29784213 CTGAAGGTGTGGGGAGAAGAGGG + Intergenic
1164755882 19:30689114-30689136 CTGAGGCTTTGGAAGGAAAGAGG + Intronic
1164808999 19:31141402-31141424 CGGAGGCTGGGAGGGGAAGACGG - Intergenic
1165183582 19:33995834-33995856 CGGAGGCTGAGATGGGAAGATGG + Intergenic
1165185601 19:34018245-34018267 AAGAGGCTGAGGTGGGAAGATGG + Intergenic
1165258777 19:34596246-34596268 CTGTGGCTGAGCAGGGAGGATGG + Exonic
1165329216 19:35132037-35132059 ATGAAGCTGTGGAGGGAAGCTGG + Exonic
1165464657 19:35966495-35966517 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1165601483 19:37058533-37058555 CCTAGGCTGTGGAGGGGTGAGGG + Intronic
1165671450 19:37682816-37682838 AGGAGGCTGTGGCGGGAGGATGG + Intronic
1165735697 19:38174078-38174100 CTGAGGCTGGGGAAGGATGCAGG + Intronic
1165780244 19:38428927-38428949 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1165843219 19:38801949-38801971 CTGAGGCCCTGGAAGGAAGTGGG + Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165915029 19:39253238-39253260 GTGAGGCTGGGGTGGGAGGATGG - Intergenic
1165988945 19:39794951-39794973 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166215427 19:41331505-41331527 CGGAGGCTGAGGCGGGAGGATGG - Intronic
1166289028 19:41849970-41849992 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1166516264 19:43449295-43449317 CCAAGGCTGAGGAGGGAGGATGG + Intergenic
1166527858 19:43524415-43524437 CTAAGGCTGAGGGGGGAAAAGGG + Intronic
1166529100 19:43532131-43532153 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1166566949 19:43771162-43771184 CTGGGTCTATGGAGGGAAGGAGG + Intronic
1166626606 19:44363072-44363094 TGGAGGCTGAGGTGGGAAGATGG - Intronic
1166692400 19:44830911-44830933 AGGAGGCTGTGGCGGGAAGAGGG + Intergenic
1166698499 19:44867965-44867987 ATGAGGCAGTGGGGGGCAGAGGG + Intronic
1166704602 19:44901630-44901652 CTGAGGCTGAGGCGGGAAAATGG + Intronic
1166975629 19:46603515-46603537 ATGAGGTGGGGGAGGGAAGAGGG - Intronic
1167041478 19:47025248-47025270 CTGTGGCAGTTGAGGGAAGGAGG + Intronic
1167084249 19:47298301-47298323 CTGAGGCTGAGAAGGGAAGGTGG - Intronic
1167538149 19:50068596-50068618 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1167633476 19:50639751-50639773 CTGGGGCTGTGGCAGGAGGAGGG + Intronic
1167662921 19:50806706-50806728 GTGAGGCTGAGGTGGGTAGATGG - Intergenic
1167824124 19:51956554-51956576 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1168283457 19:55318910-55318932 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1168318000 19:55492434-55492456 TTGAGGCTCTGGAGAGGAGAGGG + Intronic
1168432246 19:56290617-56290639 GGGAGGCTGTGGTGGGAGGAAGG + Intronic
1168688071 19:58360454-58360476 CGGAGGCTGAGGTGGGAAGATGG - Intronic
1168713857 19:58516156-58516178 CTGAGGCTGGGTAGGGAAGCAGG - Intronic
924963619 2:56925-56947 CAGGGGCTGTGGTGGGAAGTGGG + Intergenic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925393096 2:3512432-3512454 CTGAGGCTCTGTAGGGCAGAGGG - Intronic
925636404 2:5945444-5945466 CTAAGTCTGTGGAAGGAATATGG + Intergenic
925702235 2:6650409-6650431 AAGAGGCTGAGAAGGGAAGATGG + Intergenic
925866885 2:8235894-8235916 GGGAGGCTGAGGCGGGAAGATGG + Intergenic
926025827 2:9543755-9543777 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
926113743 2:10198068-10198090 ATGGGCCTGGGGAGGGAAGAGGG - Intronic
926265182 2:11309874-11309896 AGGAGGCTGAGGTGGGAAGACGG + Intronic
926940305 2:18128838-18128860 CAGAGGCTGGGAAGGGTAGACGG + Intronic
927182636 2:20457792-20457814 CTGAGGCAGTAGAGGGCAGGAGG - Intergenic
927517264 2:23679780-23679802 CAGAGGGTGTGGGAGGAAGAGGG + Intronic
927543238 2:23930617-23930639 GGGAGGCTGAGGTGGGAAGATGG + Intronic
927661950 2:25000879-25000901 CGGAGGCTGTGCAGGGGAGGTGG + Intergenic
927770118 2:25853319-25853341 CAGAGCCTTTGGAGGAAAGAGGG + Intronic
927830979 2:26349866-26349888 CGGAGGCTGAGGTGGGAGGATGG + Intronic
928101849 2:28442880-28442902 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
928384797 2:30857972-30857994 CAGAGGCTGGGAAGGGAAGTTGG + Intergenic
928448686 2:31357539-31357561 CAGAGGCTGGGGAGGGTAGGGGG + Intronic
928927757 2:36596705-36596727 GAGAGGCTGTGGTGGGAGGATGG - Intronic
928949984 2:36805903-36805925 CTGGGGCTGTGGAAGGAGCAAGG - Intronic
929077491 2:38090462-38090484 TGGAGGCTGAGGTGGGAAGATGG - Intronic
929503223 2:42507824-42507846 CAGAGGCTGAGGTGGGATGATGG + Intronic
929621949 2:43364117-43364139 GGGAGGCTGAGGAGGGAGGATGG + Intronic
929736485 2:44555441-44555463 GTGAGGATGGGGAGGGAGGATGG + Intronic
929881065 2:45837767-45837789 GTGAGGCTGAGGTGGGAGGAAGG + Intronic
930638494 2:53831227-53831249 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
930763282 2:55059456-55059478 CGGAGGCTGAGGTGGGAGGATGG - Intronic
930807563 2:55506631-55506653 ATGAGGCTGAGGAGGAAGGAAGG - Intergenic
930889900 2:56372603-56372625 CTAAGTCTGGGGAGGGAGGATGG + Intronic
931001421 2:57788360-57788382 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
931308860 2:61059337-61059359 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
931706295 2:64949029-64949051 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
931979740 2:67681837-67681859 GTGAGGCTGGGGAGGTCAGAAGG - Intergenic
932010397 2:67971958-67971980 TTTAGGATGTGGAGAGAAGAAGG - Intergenic
932035756 2:68245255-68245277 GGGAGGCTGAGGAGGGAGGATGG + Intronic
932186385 2:69699795-69699817 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
932238516 2:70140003-70140025 CGGAGGCTGAGGTGGGAGGATGG - Intergenic
932503817 2:72209407-72209429 CTGAGGCTGAGGTGGGAGGATGG + Intronic
933217322 2:79645085-79645107 CGGAGGCTGAGGTGGGAAGATGG - Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933538691 2:83610621-83610643 CTGAGGCTGGGGTGGGGAAAAGG + Intergenic
933606608 2:84390171-84390193 CTGAGCCTGTGGAGGCATGGGGG + Intergenic
933711597 2:85330170-85330192 CAGAGGCTGGGAAGGGAAGATGG + Intergenic
933758259 2:85657546-85657568 CAGAGGCTGTGGGGAGAAGATGG + Intronic
933788955 2:85868404-85868426 AGGAGGCTGAGGTGGGAAGATGG - Intronic
933854482 2:86400027-86400049 CTGAGGGTGTGGGGGGCAGCAGG + Intergenic
934151733 2:89153999-89154021 CTCAGGCTGTGTAGTGATGAAGG - Intergenic
934215527 2:90027907-90027929 CTCAGGCTGTGTAGTGATGAAGG + Intergenic
934324990 2:92005108-92005130 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
934463371 2:94235820-94235842 ATGAGGCCGAGGTGGGAAGATGG - Intergenic
934695907 2:96400012-96400034 CTGTTGCTGAGGAGGGAAGAGGG - Intergenic
934744361 2:96749257-96749279 GGGAGGCTGAGGAGGGAAGATGG + Intergenic
934748481 2:96775963-96775985 AGGAGGCCGAGGAGGGAAGATGG - Intronic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935332468 2:101987059-101987081 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
935580618 2:104753067-104753089 CTGTGGCTGGGAAGGGTAGAGGG + Intergenic
935726022 2:106024629-106024651 CTGAGGGTGTGGAGTCAAGAGGG + Intergenic
935803351 2:106722159-106722181 CAGAGGCTGTGCAGTGAATAAGG + Intergenic
935831529 2:107005699-107005721 CTGAAGCTAAGGAGGGAAGGAGG - Intergenic
935913896 2:107927867-107927889 GTGAGGCTATGGGGAGAAGATGG - Intergenic
936376214 2:111943432-111943454 GGGAGGCTGAGGTGGGAAGATGG + Intronic
936444691 2:112586352-112586374 CTGCAACTGTGGAGGTAAGAGGG + Exonic
936554292 2:113479924-113479946 ATGAGTCTGAGGTGGGAAGACGG - Intronic
936567648 2:113593436-113593458 CTGAGACTGGGGAGGGACAAAGG - Intergenic
936569060 2:113600276-113600298 CTGAGGCTGAGGAGGGAGAAGGG - Intergenic
936600529 2:113890355-113890377 CTGAGGCGGAGGAAGGAAGATGG + Intronic
937104108 2:119294382-119294404 ATTTGGCTGTGAAGGGAAGATGG + Intergenic
937104533 2:119297609-119297631 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
937197682 2:120174214-120174236 GGGAGGCTGAGGAGGGCAGATGG + Intronic
937216101 2:120314600-120314622 AGGAGGCTGGGGAGGGAAGGAGG - Intergenic
937233160 2:120413412-120413434 CGGAGGCTGGGAAGGGTAGAGGG + Intergenic
937339164 2:121079968-121079990 CTGAGGGTCTGGAGGGTAGGAGG + Intergenic
937347752 2:121137174-121137196 CAGAGGCTTGGGAGGGCAGAGGG - Intergenic
937413917 2:121699324-121699346 CAGAGGCTGAGGTGGGAGGACGG + Intergenic
937483352 2:122287174-122287196 CAGAGGCTGGGAAGGGAAGCAGG + Intergenic
937514465 2:122637864-122637886 ATGGGGCAGTGGAGTGAAGAGGG + Intergenic
937662864 2:124450924-124450946 GGGAGGCTGAGGAGGGAGGATGG + Intronic
937759318 2:125581418-125581440 GAGAGGCTGTGCTGGGAAGAAGG - Intergenic
937772984 2:125743919-125743941 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
937878914 2:126850542-126850564 CTGAGGCCGGGAGGGGAAGAAGG - Intergenic
937900680 2:127016717-127016739 ATGGGGCTGCGGAGGGGAGAAGG - Intergenic
938014698 2:127857884-127857906 GTGGGGCTGGGGAGGGAACATGG - Intronic
938250985 2:129815571-129815593 CTGAGGCTGTGGGGGGCAGTGGG - Intergenic
938405382 2:131030005-131030027 GTGAGGCTGTGCAGGGCTGATGG + Intronic
938467551 2:131533252-131533274 CTCAGGCTGGGGCGGGTAGAGGG - Exonic
940184286 2:150965785-150965807 CAGAGGCTGGGAAGGGTAGAAGG - Intergenic
940310015 2:152268635-152268657 GGGAGGCTGAGGAGGGCAGATGG - Intergenic
940488891 2:154331405-154331427 GAGAGGCTGAGGTGGGAAGATGG - Intronic
940694372 2:156959866-156959888 CTGAGCCTGTGGAGGGAGGGAGG + Intergenic
940778057 2:157905270-157905292 GTGAGGCTGAGGTAGGAAGATGG - Intronic
940800724 2:158129868-158129890 TGGAGGCTGAGGTGGGAAGATGG - Intronic
940882122 2:158957190-158957212 CAGAGCCTCTGGAGGGAGGATGG + Intergenic
940888405 2:159011638-159011660 AGGAGGCTAAGGAGGGAAGATGG - Intronic
941207920 2:162597523-162597545 CAGAGGCTGGGGAGGTATGAAGG + Intronic
941356875 2:164504634-164504656 ATGAGGCTGAAGAGGGAAGGAGG - Intronic
941456839 2:165719123-165719145 CTGAGGCTCTGAAAGGAATAAGG + Intergenic
941745252 2:169080323-169080345 CTGAGCCTGTGGAAGGGAGAGGG - Intronic
942233108 2:173878098-173878120 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
942372096 2:175296038-175296060 CTGAGGCTGCAGAGGGAAAGGGG - Intergenic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
942803626 2:179903617-179903639 GTGAGGCTGTGAAGGGCAGTGGG + Intergenic
942848159 2:180451056-180451078 CTGAGGCTGGGAAGGGTAGAAGG - Intergenic
943019703 2:182557605-182557627 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
943043729 2:182833097-182833119 GGGAGGCTGAGGAAGGAAGACGG - Intergenic
943226430 2:185185026-185185048 CTGAGTCTGCGGTGGGAGGAGGG - Intergenic
943813854 2:192225938-192225960 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
943876144 2:193070810-193070832 CTGAGGCTGTGCAGGGCAGTGGG - Intergenic
944084349 2:195827380-195827402 AGGAGGCTGAGGTGGGAAGATGG - Intronic
944371221 2:198985708-198985730 CTGAGGCTGCAGAGAGAAGCTGG + Intergenic
944714018 2:202361114-202361136 CTGAAGCTTTGTAGGGGAGAGGG - Intergenic
945019980 2:205560637-205560659 CTGAGGCTGATGAGGGACAAAGG + Intronic
945452830 2:210013549-210013571 AGGAGGCTGAGGAGGGAGGATGG - Intronic
945711570 2:213303527-213303549 CAGAGGCTGGGGAGGGGAGAGGG - Intronic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946409826 2:219510424-219510446 CTGAGGCTGCAGAGGGCAAAGGG - Intergenic
946437426 2:219666691-219666713 CTGAGGCTGAGGTGGGAGGATGG + Intergenic
946846825 2:223866636-223866658 GGGAGGCTGGGGAGGGAGGATGG - Intronic
946848876 2:223885805-223885827 CTGTGGCTGGGAAGGGAAGGGGG - Intronic
947030513 2:225787928-225787950 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
947038526 2:225887806-225887828 CAGAGGCTGGGAAGGGTAGAAGG + Intergenic
947342915 2:229158920-229158942 CAGAGGCTGTGAAGGGTAGGGGG + Intronic
947489172 2:230579084-230579106 CTCATGGTGTGGAGGGAGGAAGG - Intergenic
947549050 2:231033463-231033485 AAGAGGCTGAGGTGGGAAGAGGG - Intergenic
947976088 2:234367748-234367770 GGGAGGCTGAGGGGGGAAGATGG - Intergenic
948115361 2:235491407-235491429 CGGAGGCTGTGCAGGGAGGATGG - Intergenic
948209852 2:236184932-236184954 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948481507 2:238253233-238253255 CTGAGGCTGGCTGGGGAAGAAGG + Exonic
948513750 2:238489951-238489973 CTGAGGCTGCAGAGGGAAATAGG - Intergenic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948617094 2:239206221-239206243 AGGAGGCTGAGGCGGGAAGATGG + Intronic
948712906 2:239836352-239836374 CTGAGCCTGTGGGGGCAAAAGGG - Intergenic
948717969 2:239877871-239877893 TTCAGGCTGTGGTGGGAAGGTGG - Intergenic
948807306 2:240458628-240458650 CTGAGGATGGGGAAGGAGGAAGG - Intronic
948825285 2:240570913-240570935 CTGAGGCTGTGGGGTGGACATGG + Intronic
948825424 2:240571484-240571506 ATGTGGCTGTGGTTGGAAGAGGG + Intronic
948874920 2:240821056-240821078 CTGGGACGGTGGAGGGAGGACGG - Intergenic
948903636 2:240967879-240967901 GTGAGGCAGTGGGGGGCAGAAGG - Intronic
1168983501 20:2027275-2027297 CTGAGCCTGTGGGGGTAAGAGGG + Intergenic
1169004755 20:2197197-2197219 ATGAGGTTGGGGATGGAAGAGGG - Intergenic
1169042827 20:2509634-2509656 CTGAGGCTGAGGCTGGAGGATGG + Intronic
1169087440 20:2836130-2836152 CTGGGGCAGGGGTGGGAAGAGGG + Exonic
1169118546 20:3082518-3082540 CTCAGTCTCTGGCGGGAAGAGGG - Intergenic
1169165759 20:3422165-3422187 CTGAGGGAGTGGAGGGACAATGG + Intergenic
1169236570 20:3934409-3934431 GGGAGGCTCTGGAAGGAAGAGGG - Intronic
1169304617 20:4477679-4477701 CTGAGGCTGTGGAGGAAGGAGGG + Intergenic
1169740259 20:8885757-8885779 CAGAGGCTGGGGAGGGTAGTTGG - Intronic
1170477032 20:16725807-16725829 CAGAGGCTGAGGTGGGAAGGTGG - Intergenic
1170601488 20:17844783-17844805 CCGAGGCTGAGGTGGGAAGATGG - Intergenic
1170803096 20:19606679-19606701 CTGAGAATGCAGAGGGAAGAAGG + Intronic
1170934852 20:20800711-20800733 GTGAGGCTGAGGTGGGAGGATGG - Intergenic
1171431868 20:25087964-25087986 CTGTGGCTGTGGAATAAAGATGG - Intergenic
1171727603 20:28639572-28639594 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1171875746 20:30574050-30574072 TGGAGGCTGAGGTGGGAAGATGG + Intergenic
1171877767 20:30594272-30594294 CTCAGGCGCTGGAGGGAGGACGG - Intergenic
1172093643 20:32450274-32450296 CTGAGGCTGGGGAGGCCAGTGGG + Intronic
1172186913 20:33036625-33036647 CTAGGGCTGTGGAGGGAGGGAGG + Intronic
1172392998 20:34578977-34578999 CTGAGGCTCTGAAGGGAAAGTGG - Intronic
1172789217 20:37490980-37491002 CAGAGAGTGTAGAGGGAAGATGG - Intergenic
1172797160 20:37548501-37548523 CAGAGGCTGGGAAGGGTAGAGGG - Intergenic
1173038489 20:39436039-39436061 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1173362097 20:42353947-42353969 CAGGGGCTGAGGTGGGAAGATGG + Intronic
1173365276 20:42379542-42379564 CTGAGCCTGTGGAGGGCAGCAGG + Intronic
1173399291 20:42710375-42710397 CTGAGGCTGGGCAGGGCAGAAGG - Intronic
1173438485 20:43054312-43054334 CGGAGGCTGAGGTGGGCAGATGG + Intronic
1173549782 20:43924562-43924584 TTGAGGCTGGGCAGGGCAGATGG - Intronic
1173620316 20:44431247-44431269 CTGAGGCTGTAGAAGGGAGCCGG - Exonic
1173677133 20:44845645-44845667 AAGAGGCTGAGGTGGGAAGATGG + Intergenic
1173688648 20:44941879-44941901 TTGATGCAGTGGAGGGAAGGGGG - Intronic
1174010697 20:47447281-47447303 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1174087493 20:48019531-48019553 CTGAGGTTGAGGAGGGAAGAGGG + Intergenic
1174128798 20:48327440-48327462 CTGAGGATGAGGAGATAAGAAGG - Intergenic
1174130816 20:48342188-48342210 GTGAGGATGACGAGGGAAGAAGG - Intergenic
1174149899 20:48478554-48478576 CTGAGGCCGGGGAGGGGAGGGGG - Intergenic
1174171238 20:48619473-48619495 CTGAGGCTGGGGAGACATGAGGG - Intergenic
1174206055 20:48840117-48840139 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1174474596 20:50787499-50787521 GGGAGGCTGTGGTGGGAGGATGG + Intergenic
1174503371 20:51001546-51001568 CTGGGGTTGTGCAGGGAAGCCGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174827908 20:53785534-53785556 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1174917501 20:54668874-54668896 CAGAGGCTGAGGAGGCAGGATGG + Intergenic
1174940990 20:54927045-54927067 ATGAGGCTGAGGTGGGAATATGG - Intergenic
1175124814 20:56743292-56743314 GTGGGGCTGAGGCGGGAAGATGG - Intergenic
1175259750 20:57667069-57667091 ATGGGCCTGTGGAGTGAAGATGG + Intronic
1175603015 20:60290067-60290089 CTGAGGCTGTGCAGGGTAGCGGG + Intergenic
1175610013 20:60342910-60342932 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1175739898 20:61413130-61413152 CTGAGGCTGGGATGGGAAGGGGG - Intronic
1175958463 20:62623191-62623213 CGGAGGCTGTGGAGGGAGGACGG - Intergenic
1176010056 20:62888434-62888456 CTGAGGCTGTGGAATGGAGCTGG + Intronic
1176243682 20:64086867-64086889 GTGAGCCTGTGGAAGGAGGAGGG + Intronic
1176264876 20:64203872-64203894 CGGAGCCTGTGAAGGGAGGAAGG - Intronic
1176374428 21:6080135-6080157 CAGAGGCTGAGAAGGGAAGGCGG + Intergenic
1177169612 21:17640722-17640744 CCGAGGCTGTGCAGGGCAGTGGG + Intergenic
1177246490 21:18531810-18531832 CAGAGGCTGGGAAGGGAAGTAGG + Intergenic
1177529465 21:22340962-22340984 CTGAGGCTGTGTAGGGCAGTGGG + Intergenic
1177998443 21:28131373-28131395 CTAAGGCTGTGCAGGGCAGCAGG + Intergenic
1178096033 21:29216917-29216939 CTGAGACTGTGAGGAGAAGATGG + Intronic
1178349905 21:31865322-31865344 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1178797521 21:35758630-35758652 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
1179050917 21:37888009-37888031 CTGGAGCTGTGTAGGGAAGGTGG + Intronic
1179059313 21:37965115-37965137 CAGAGGCTGGGGAGAGAAGGGGG + Intronic
1179104094 21:38383271-38383293 CTGGGGCTGGGGAAGGAAGCCGG - Exonic
1179123941 21:38575064-38575086 CTGAGGCTCTGGAGGTGAGAGGG - Intronic
1179141925 21:38733339-38733361 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1179385457 21:40937668-40937690 CTGGGGCAGAGGAGGGTAGAGGG - Intergenic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179609982 21:42543923-42543945 TTCAGGCTGTGGTGGCAAGATGG - Intronic
1179749049 21:43458110-43458132 CAGAGGCTGAGAAGGGAAGTCGG - Intergenic
1179885016 21:44310148-44310170 CTAAGGGTGTGGAGAGGAGAAGG - Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180081654 21:45490119-45490141 CAGGGGCTGTGGAGGGATGGAGG - Intronic
1180119408 21:45736874-45736896 CAGTGGCTGTGGAGGAAACAGGG + Intronic
1180584495 22:16874893-16874915 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1180641249 22:17301358-17301380 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1180692862 22:17731985-17732007 GTGGGGCTGTGGAGTGAAGTAGG + Intergenic
1180825486 22:18858161-18858183 ATGAGGATGTGGTGGGCAGAGGG - Intronic
1181022887 22:20112789-20112811 CAGAGGCTGTGGGGGGAAAAGGG + Exonic
1181187246 22:21116386-21116408 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181211952 22:21294107-21294129 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181316383 22:21973379-21973401 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1181397545 22:22632779-22632801 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181594196 22:23903787-23903809 AAGAAGCTGTGGCGGGAAGATGG - Intergenic
1181651861 22:24263279-24263301 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
1181705516 22:24647460-24647482 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1181789557 22:25253773-25253795 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1181812734 22:25413840-25413862 CTGAGGCTGTGCAGGGCAGTAGG + Intergenic
1181819627 22:25465577-25465599 CAGAGGCTGGGAAGGGAAGGTGG - Intergenic
1181830091 22:25553617-25553639 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1181979122 22:26753484-26753506 ATGAGGCTGCTGAGGGAAGCAGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182643486 22:31788376-31788398 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1182671996 22:32004169-32004191 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1183017550 22:35001647-35001669 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1183029791 22:35094869-35094891 CTAAGGCTGGGGAGGCAGGAGGG + Intergenic
1183063624 22:35349690-35349712 CTAAGGCTGCTGAGGTAAGATGG + Intergenic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1183127882 22:35802703-35802725 TTGAGGCTGTGGTCTGAAGAGGG + Intronic
1183177902 22:36237888-36237910 CTGAGGCTGGGGATGGGAGTGGG - Intronic
1183194500 22:36344147-36344169 CTGAGGCTCAGGTGGGAGGAAGG + Intronic
1183316769 22:37141368-37141390 CTGAGCCTGCGGAGGCAAGGGGG - Intronic
1183327495 22:37202388-37202410 CTGAGGCCTTGGAGGGATGGTGG + Intergenic
1183498270 22:38162911-38162933 CTGAGGCTCTGGAGGACACACGG + Intronic
1183775417 22:39961048-39961070 GAGAGGCTGAGGTGGGAAGATGG - Intronic
1183945845 22:41325260-41325282 CTGGGGCTGTGGCTGGAAGTGGG + Intronic
1184153435 22:42651425-42651447 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
1184325589 22:43781426-43781448 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184510446 22:44930242-44930264 CTGCCCCTGTGGAGGGGAGAGGG + Intronic
1184742773 22:46438681-46438703 CAGAGGCTGGGGAGGGAGCAGGG + Intronic
1184765313 22:46569204-46569226 CAGAGGCTGGGGAGGGAGGATGG + Intergenic
1185015872 22:48342232-48342254 GTGAGGATGAGGAGGGAAGGAGG + Intergenic
1185034970 22:48469722-48469744 CAGAGGCTGGGAAGGGAAGTCGG - Intergenic
1185070643 22:48654004-48654026 CGGCGGCTCTGGAGGGAAGGGGG + Intronic
1185070667 22:48654111-48654133 CCGCGGCTCTGGAGGGAAGAGGG + Intronic
1185089844 22:48760040-48760062 CTGAGACGTTCGAGGGAAGATGG - Intronic
1185310057 22:50149360-50149382 CTAGAGATGTGGAGGGAAGAAGG - Intronic
1203215002 22_KI270731v1_random:1325-1347 ATGAGGATGTGGTGGGCAGAGGG + Intergenic
1203275634 22_KI270734v1_random:84064-84086 ATGAGGATGTGGTGGGCAGAGGG - Intergenic
949115498 3:316144-316166 ATGTGGCTGGGAAGGGAAGATGG + Intronic
949345360 3:3071692-3071714 GGGAGGCTGAGGTGGGAAGATGG - Intronic
950077975 3:10200655-10200677 GTGAGGCTGAGGCGGGAGGATGG + Intronic
950199159 3:11030642-11030664 CTGAGGCATTTGAGGGACGAGGG + Intronic
950327204 3:12121953-12121975 CTGAGGTTTTGCAGAGAAGAAGG - Intronic
950564900 3:13763079-13763101 TGGAGGATGTGGAGGGAAGCAGG - Intergenic
950833720 3:15900036-15900058 CAGTGGCTGAGGTGGGAAGATGG - Intergenic
950965656 3:17144073-17144095 CTGAGGCTGTGGAAAGACGTTGG - Intergenic
950965674 3:17144138-17144160 CAGGGGCTGAGGAGGGAAGAAGG - Intergenic
951037838 3:17952883-17952905 GGGAGGCTGAGGTGGGAAGATGG - Intronic
951209588 3:19960402-19960424 AGGAGGCTGAGGTGGGAAGATGG - Intronic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952178515 3:30893527-30893549 CAGAGGCTGGGGAGCGGAGAGGG - Intronic
952474432 3:33692062-33692084 GGGAGGCTGTGGTGGGAGGATGG + Intronic
952776355 3:37050184-37050206 AGGAGGCTGAGGTGGGAAGATGG + Intronic
953310707 3:41875525-41875547 AGGAGGCTGAGGTGGGAAGATGG + Intronic
953606425 3:44415887-44415909 CTCAGACTGTTGGGGGAAGATGG - Intergenic
953937932 3:47062571-47062593 CTGAGTCTTTGGAGGGAAAGAGG - Intronic
953972699 3:47359518-47359540 CTGAGGGTGTGCAGGGCAGCAGG - Intergenic
954126031 3:48529847-48529869 AGGAGGCTGAGGTGGGAAGATGG + Intronic
954134545 3:48575952-48575974 CTGAGGCCGTGCGGGGCAGAAGG - Intronic
954187601 3:48930559-48930581 GGGAGGCTGAGGTGGGAAGATGG - Intronic
954241181 3:49294839-49294861 TTGAGGCCGTGGTTGGAAGAAGG - Intronic
954271349 3:49512134-49512156 GGGAGGCTGAAGAGGGAAGAAGG - Intronic
954318813 3:49817002-49817024 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
954345832 3:49998441-49998463 CTGAGGCAGTGGAGGAAGCATGG + Intronic
954722508 3:52577324-52577346 GGGAGGCTGAGGTGGGAAGATGG + Intronic
954788486 3:53113118-53113140 TGGAGGCTGAGGGGGGAAGATGG - Intronic
954937906 3:54343727-54343749 CTTGGGCTGTGGGGGGTAGAGGG - Intronic
955286230 3:57644408-57644430 ATGAGGCTGAGGTGGGAGGATGG - Intronic
955324179 3:57997027-57997049 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
955508221 3:59653303-59653325 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
955799285 3:62669292-62669314 ATGGGGCTGTGGAGGAAAGGAGG - Intronic
956452403 3:69387237-69387259 CCGTGGCTGAGGTGGGAAGATGG - Intronic
956511813 3:70001083-70001105 ATGAGGCGGTTTAGGGAAGAGGG + Intergenic
956746998 3:72318216-72318238 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957179731 3:76861060-76861082 CTGATGTTGCAGAGGGAAGAGGG - Intronic
957354500 3:79063926-79063948 CAGAGGCTGGGGAGGAGAGATGG + Intronic
957785564 3:84877800-84877822 CTGAGGCTGAGGCAGGAGGATGG + Intergenic
958108239 3:89105150-89105172 GTAAGTCTGTGGTGGGAAGAAGG + Intergenic
958841453 3:99209890-99209912 CTGAGGCTGTGTATGGCAGGGGG + Intergenic
958925311 3:100150789-100150811 CTGATGCTGAAGAGGGAAGAGGG - Intronic
959535878 3:107484132-107484154 GGGAGGCTGAGGTGGGAAGACGG + Intergenic
959613922 3:108326016-108326038 CTGAGGCAGTGGCAAGAAGAGGG - Intronic
959707964 3:109356921-109356943 TGAAGGCTGTGAAGGGAAGACGG - Intergenic
960244078 3:115380401-115380423 CTGAGGCTGCACAGGGAAGTGGG + Intergenic
960391108 3:117078602-117078624 GGGAGGCTGTGGTGGGAGGATGG - Intronic
960586740 3:119327033-119327055 CGGAGGCTGAGGTGGGAGGATGG + Intronic
960831686 3:121856416-121856438 CGGAGGCTGAGGAAGGAAGATGG - Intronic
961169231 3:124784558-124784580 TTAAGGCAGTGGAGGGAAGATGG + Intronic
961314962 3:126028288-126028310 CTGAGGCTGTGCAGGGCAGCAGG - Intronic
961420078 3:126796243-126796265 AGGAGGCTGAGGTGGGAAGATGG + Intronic
961621821 3:128230392-128230414 GGGAGGCTGAGGAGGGAGGATGG - Intronic
961624853 3:128254771-128254793 CTGAGAGTGGGGAGGGGAGAGGG + Intronic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961643981 3:128382760-128382782 CTGAGACTACGGAGGGAAAAAGG - Intronic
962005339 3:131343798-131343820 CCGAGGCTGTGCAGGGCAGTGGG + Intronic
962468602 3:135684880-135684902 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
962538385 3:136352264-136352286 GGGAGGCTGAGGTGGGAAGATGG - Intronic
962720743 3:138172488-138172510 GGGAGGCTGTGGTGGGAGGATGG + Intronic
964116919 3:153146233-153146255 CTGAGGCTGTGTAGCAAAGTTGG + Intergenic
964148310 3:153493172-153493194 CAGAGGCTGTGAAGGGTAGAAGG + Intronic
964297970 3:155254595-155254617 CTGAGAGTGTGGGTGGAAGAAGG - Intergenic
964323534 3:155523077-155523099 CGGAGGCTGAGGCGGGAAAATGG - Intronic
964616354 3:158670827-158670849 GGGAGGCTGAGGTGGGAAGATGG + Intronic
964810328 3:160656494-160656516 CAGAGGCTGTGAAGGGTAGTAGG + Intergenic
965290481 3:166872778-166872800 CTGAGGCTGTGCAGGGCAGCGGG - Intergenic
965378878 3:167962719-167962741 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
965520521 3:169664849-169664871 CAAAGGCTGTGGAGGGAAAGGGG + Intergenic
965621344 3:170644950-170644972 GTGAAGCTGTAGAGGGAGGAGGG - Intronic
965825899 3:172729505-172729527 CGGAAGCATTGGAGGGAAGAAGG + Intergenic
965857271 3:173103611-173103633 CTGAGGCTGTGCAGGGCAGTGGG + Intronic
965891390 3:173518981-173519003 CTGAGGCTGTGCAGGACAGCAGG - Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
966054062 3:175660661-175660683 CAGAGGCTGGGAAGGGAAAAGGG - Intronic
966144271 3:176791760-176791782 CAGAGGCTGAGGCGGGAAGATGG + Intergenic
966338009 3:178892480-178892502 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
966434544 3:179868831-179868853 TTGAGGTTGTGGAGAGAATATGG - Intronic
966693228 3:182762673-182762695 CTGAGGCTGGGGAGGGGTAAAGG - Intergenic
967004137 3:185367699-185367721 CGGAGCCTGAGGTGGGAAGATGG - Intronic
967098529 3:186196902-186196924 CACAGGCTGGAGAGGGAAGATGG + Intronic
967116209 3:186341405-186341427 GGGAGGCTGAGGAAGGAAGATGG + Intronic
967193824 3:187009525-187009547 GGGAGGCTGAGGAGGGAGGATGG + Intronic
967481446 3:189977847-189977869 GGGAGGCTGAGGAGGGAGGATGG - Intronic
967664793 3:192158263-192158285 CTGAGTCTGTGGAGGGGCTAAGG - Intronic
967715391 3:192756855-192756877 GGGAGGCTGAGGTGGGAAGATGG - Intronic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968470238 4:777698-777720 AGGAGGCTGAGGAAGGAAGATGG + Intergenic
968555431 4:1244417-1244439 CTGAGGCTGGGGAAGGAACAGGG - Intronic
968611113 4:1557574-1557596 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
968611143 4:1557671-1557693 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
968611159 4:1557719-1557741 TTGAGGCTCTGGAGGGGAGTGGG - Intergenic
968658299 4:1787954-1787976 CGGAGGCCGCGGAGGGAGGAGGG + Intergenic
968720050 4:2195720-2195742 CTCAGGCTGAGGTGGGAGGATGG - Intronic
968973529 4:3809439-3809461 CGGAGGCTGTGGAGGGACTTTGG + Intergenic
969053191 4:4386853-4386875 CTGAGCCGGGGGAGGGAACAGGG - Exonic
969086466 4:4660165-4660187 GCGAGGCTGGGGAGGGAACAGGG + Intergenic
969147707 4:5138787-5138809 CTGAGGATGTAGAGAGAACAAGG + Intronic
969278541 4:6153379-6153401 ACAAGGCTGTGGAGAGAAGAAGG - Intronic
969342405 4:6550362-6550384 CTGAGGCTGCAGAGGGTAGTGGG - Intronic
969368938 4:6718845-6718867 AGGAGGCTGTGGCGGGAAAATGG + Intergenic
969498151 4:7537879-7537901 AGGAGGCTGAGGTGGGAAGATGG + Intronic
969512194 4:7624844-7624866 CTGAGGCTCTAGAGTGAATACGG - Intronic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969545085 4:7820746-7820768 GTGAGGATGTGGAGGGAAGAGGG + Intronic
969586392 4:8096709-8096731 CAGGGGCTGGGGAGGGAAGGGGG + Intronic
969591481 4:8124418-8124440 CAGGGGCTGCGGAGGGAAAACGG - Intronic
969639322 4:8387612-8387634 CGGGGGCTGTGGTGGGAGGAAGG + Intronic
970097434 4:12479680-12479702 CTGAGACTGTGCAGGGCAGAGGG + Intergenic
970372174 4:15418878-15418900 CTGAGACTGTGTAGGGAATTGGG + Intronic
970559976 4:17273143-17273165 CTGAGGCTGCAGAGAGAACAAGG + Intergenic
970616678 4:17774261-17774283 GGGAGGCTGAGGTGGGAAGATGG + Intronic
970619084 4:17798489-17798511 ATGAGGCTGAGGTGGGAGGATGG + Intergenic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
971156368 4:24087573-24087595 ATGAGGACTTGGAGGGAAGATGG - Intergenic
971468459 4:26991414-26991436 CAGAGGCTGGGAAGCGAAGAGGG + Intronic
971961525 4:33493544-33493566 CAGAGCCTGTGGATGGTAGAAGG + Intergenic
971991681 4:33906053-33906075 ATGAAGCTGTGGAGGAAAAAGGG + Intergenic
972051711 4:34743260-34743282 CAGAGGCTTAGGAGGGAAAATGG - Intergenic
972498148 4:39652990-39653012 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
972531402 4:39964462-39964484 CGGAGGCTGAGGTGGGAGGATGG + Intronic
972540169 4:40032035-40032057 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
972604095 4:40598349-40598371 AGGAGGCTGTGGTGGGAGGATGG - Intronic
972839435 4:42913803-42913825 CTGAGGCTGTATAGAGAAGCGGG - Intronic
972976607 4:44643668-44643690 CTGAGGCTATGAAGGGAAGAGGG - Intronic
973317367 4:48776225-48776247 GGGAGGCTGAGGCGGGAAGATGG - Intronic
973620171 4:52718245-52718267 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
973771817 4:54213715-54213737 CTAAGGCCCTGGAGGCAAGAAGG + Intronic
973890938 4:55366708-55366730 CTGAGGCTCTGGAGCCAAGGGGG - Intronic
974887106 4:67833302-67833324 CTGAGGCTGAGGAGGGAAGCTGG - Exonic
975034955 4:69668759-69668781 CTGCTGCTGTGGAGTGAGGAGGG - Intergenic
975145418 4:70962117-70962139 CAGAGGCTGAGGTGGGAGGATGG + Intronic
975254423 4:72216594-72216616 CTGAGCCTGTGGGGGCAAAAGGG + Intergenic
975299620 4:72774821-72774843 CTGAGCCTGTAGGGGGAAGGGGG - Intergenic
975336072 4:73176556-73176578 CAGAGGCTGGGGAGGGTAGTTGG + Intronic
975507223 4:75150821-75150843 CAGAGGCTGGGAAGGAAAGAAGG - Intergenic
975596489 4:76051642-76051664 AGGAGGCTGAGGTGGGAAGATGG - Intronic
975651747 4:76600045-76600067 AGGAGGCTGAGGTGGGAAGATGG + Intronic
976038188 4:80849705-80849727 CAGAGGCTAGGGAGGGTAGAGGG + Intronic
976077090 4:81312144-81312166 CTGAGGATTTGGAGGCAAGAAGG + Intergenic
976098863 4:81539122-81539144 CTGAGGCCTTGGAGGCAAGAAGG - Intronic
976141949 4:82002201-82002223 CTGAGGTTGTGCAGGGCAGTGGG - Intronic
976171130 4:82305626-82305648 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
976298152 4:83492723-83492745 CTGAGGCTGTAGTGAGAAGCTGG - Intronic
976340241 4:83939184-83939206 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
976474499 4:85468303-85468325 CTCAGGCTGGGGAGGGCAAATGG - Intergenic
977152295 4:93527873-93527895 CTAAGGCCTTGGGGGGAAGAGGG - Intronic
977355226 4:95937982-95938004 AGGAGGTTGGGGAGGGAAGAGGG + Intergenic
977433360 4:96960899-96960921 CTGAGGATGGGGAAGGAATATGG - Intergenic
978206898 4:106090321-106090343 CTGAGGCTGTGCAGGGAAGTGGG + Intronic
978507163 4:109471245-109471267 GTGAGGCTGAGGTGGGAGGATGG - Intronic
978740695 4:112134809-112134831 TGGAGGCTGTGGCGGGAGGATGG + Intergenic
978749201 4:112228139-112228161 CGGAGGCTGAGGTGGGCAGATGG - Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978913234 4:114091381-114091403 GGGAGGCTGAGGTGGGAAGAGGG - Intergenic
978924919 4:114231600-114231622 CAGCAGCTGTGGAGGGATGAAGG - Intergenic
979009967 4:115355228-115355250 CTAAGGCTGTGCAGAGAACAGGG - Intergenic
979027572 4:115596871-115596893 CTGAGGCTGTGCAGGACAGCAGG - Intergenic
979306855 4:119155580-119155602 GTGGGGCTGAGGAGGGCAGAGGG + Intronic
979610189 4:122681787-122681809 CTGAGGCTGTGCAGAGCAGTGGG - Intergenic
979703080 4:123689534-123689556 CTGAGGCTGTGCAGGGCAGTGGG + Intergenic
979879466 4:125936921-125936943 CTGAGGCTGGGAAGAGTAGAAGG + Intergenic
979993934 4:127408527-127408549 CTCATCCTGTGGAAGGAAGATGG + Intergenic
980044726 4:127974746-127974768 GGGAGGCTGAGGAGGGTAGAGGG + Intronic
980691877 4:136305698-136305720 GAGAGGCTGAGGTGGGAAGATGG + Intergenic
980894566 4:138849887-138849909 TGGAGGCTGTGGAGGCAGGAGGG - Intergenic
980967083 4:139532332-139532354 AGGAGGCTGAGGTGGGAAGATGG + Intronic
981340759 4:143618789-143618811 CAGAGGCTGAGGTGGAAAGATGG + Intronic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
981702499 4:147622180-147622202 GTGAGGCTGAGGAGGGCAGATGG - Intronic
981730021 4:147887329-147887351 CTGGAGCAGTGGAGAGAAGATGG - Intronic
982064663 4:151643592-151643614 CAGAGGCTGGGAAGGGAAGGGGG - Intronic
982101301 4:151970885-151970907 GTGAGGATGTGGCGGGAAAAGGG - Intergenic
982176814 4:152713443-152713465 CAGAGGCTGGGAAGGGAAGAGGG + Intronic
982306328 4:153935062-153935084 AAGAGGCTGAGGTGGGAAGATGG - Intergenic
982566902 4:156997085-156997107 CTGAGGCTGTGCAAGGCAGCAGG + Intergenic
982718801 4:158838323-158838345 GTGAGGCTGAGGTGGGAGGATGG - Intronic
982805224 4:159755014-159755036 CTGAGGCTGTGCAGAGCAGTGGG - Intergenic
982927488 4:161357169-161357191 CAGAGGCTGGGAAGGGGAGAAGG + Intergenic
983282179 4:165694900-165694922 CTCAGCCTGTGGAGGGCATATGG + Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984763228 4:183379948-183379970 GTGAGGATGTGGTGAGAAGATGG + Intergenic
984877981 4:184386323-184386345 CTGAGTCTGTGTTGGGAAGAAGG + Intergenic
985283790 4:188313466-188313488 GTCAGGCGGTGGAGGGAAAAGGG - Intergenic
985427369 4:189843902-189843924 CAGATGCAGTGGAGGGAAGAAGG - Intergenic
985643614 5:1074869-1074891 CTGTGGCTGTGGAGGGAACGAGG + Intronic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985864481 5:2503526-2503548 TTGCAGCTGTGAAGGGAAGAGGG + Intergenic
985885617 5:2675437-2675459 CTGATACTCTGGAGGGAACATGG - Intergenic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
987492122 5:18594413-18594435 CTGAGGCTGTGCAAGGCAGTGGG + Intergenic
987764129 5:22203248-22203270 CAGAGGCTGTGGCGGGGGGAGGG - Intronic
987901355 5:24015855-24015877 ATGAGGCTGAGGTGGGAGGATGG + Intronic
988067846 5:26245152-26245174 CTGGGGCTGTGGATGGAAACTGG - Intergenic
988487478 5:31678709-31678731 GAGAGGCTGAGGTGGGAAGATGG - Intronic
989396607 5:40963718-40963740 CTGAGCCTGGGGATGGATGAAGG - Intronic
989427482 5:41313504-41313526 CTGAGTCTCTGAAGGGAATAGGG - Exonic
989642466 5:43596391-43596413 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
989685658 5:44083762-44083784 CTAAGGAAGTGGAGGCAAGATGG - Intergenic
990569238 5:57061131-57061153 CGGAGCCTTTGGAGGGAGGATGG - Intergenic
990575428 5:57119433-57119455 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
990625282 5:57603871-57603893 CTGAGGCAGTGAAGGATAGAGGG + Intergenic
990815840 5:59783951-59783973 GGGAGGCTGAGGTGGGAAGATGG + Intronic
991380359 5:66016559-66016581 CAGAGGCTGAGGAGGGTAGTGGG - Intronic
991898859 5:71436332-71436354 CAGAGGCTGTGGCGGGGGGAGGG - Intergenic
992025066 5:72662159-72662181 CTGGGTCTGTGGAGGGCAGTGGG - Intergenic
992248584 5:74854605-74854627 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
992325091 5:75652544-75652566 CTGAGACTGAGGTGGGAGGATGG - Intronic
992465886 5:77003981-77004003 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
992587793 5:78259361-78259383 CAGAGGCTGAGAAGGGAAGTGGG + Intronic
992648402 5:78833549-78833571 GGGAGGCAGTGGAGGGAGGAAGG + Intronic
992832540 5:80608337-80608359 GGGAGGCTGTGGTGGGAAGATGG + Intergenic
993026410 5:82652214-82652236 CACAGGCTGTGGAGGGTAGTTGG - Intergenic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993391959 5:87329335-87329357 GGGAGGCTGTGGTGGGAAGATGG + Intronic
993429105 5:87809925-87809947 CAGAGGCTGGGAAGGGGAGAAGG - Intergenic
993453810 5:88104459-88104481 ATGAAGCTGTGAAGGAAAGAAGG + Intergenic
993472138 5:88319054-88319076 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
993507876 5:88733327-88733349 CAGAGGCTCTGGAGGGATGCAGG + Intronic
993768169 5:91889208-91889230 CAGAGGCTGGGGAGGGTAGTTGG + Intergenic
994073775 5:95629056-95629078 CTTAGGCTGTGCAGGGCAGGGGG + Intergenic
994296002 5:98089332-98089354 CTCAGCCTCTGGAGGGAGGAGGG - Intergenic
994692464 5:103035075-103035097 CTAAGCCTGTGGGGGCAAGAAGG + Intergenic
995132726 5:108647523-108647545 CTGAGGCTGCTCAGGGAAGCAGG - Intergenic
995683383 5:114745105-114745127 TTGACGCTGTGCAGGGCAGAGGG - Intergenic
995712015 5:115045387-115045409 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
995751072 5:115453799-115453821 CTGAGGCTGGGCAGGGTGGAAGG - Intergenic
995947970 5:117672906-117672928 CTTTGGCTGTGAAGGGAAAAGGG - Intergenic
996352145 5:122556277-122556299 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
996770211 5:127077774-127077796 CTGACACTGTTGAGGAAAGATGG + Intergenic
996798665 5:127378555-127378577 GGGAGGCTGAGGTGGGAAGATGG - Intronic
996883927 5:128333325-128333347 CTGAATCTGGGCAGGGAAGAAGG - Intronic
997002577 5:129779764-129779786 CAGAGGCTGAGAAGGGAAGTGGG + Intergenic
997060461 5:130495357-130495379 CAGAGGCTGGGAAGGGAAGTAGG + Intergenic
997264254 5:132485951-132485973 CTGAGGGTGAGGAAGGAAGTAGG - Intronic
997477735 5:134155897-134155919 GAGAGGCTGAGGTGGGAAGATGG - Exonic
997503716 5:134398918-134398940 CGGAGGCTGAGATGGGAAGATGG + Intergenic
997601242 5:135139990-135140012 CAGAGGCTGTGGATGGAAAGTGG + Intronic
998146691 5:139733329-139733351 CTGAGGCAGCGGAGGGAAGGGGG - Intergenic
998305259 5:141069804-141069826 GGGAGGCTGAGGAGGGCAGATGG + Intergenic
998316303 5:141185640-141185662 GGGAGGCTGAGGAGGGAGGATGG - Exonic
998378927 5:141710243-141710265 CTGAGCCTGTGGGCAGAAGAGGG + Intergenic
998380951 5:141724945-141724967 CTGAGGCTGTGCAGGGGAGTGGG + Intergenic
998401993 5:141852993-141853015 CTGAGGCTGTGGGGGGCAGCTGG - Intergenic
998989085 5:147795252-147795274 CTGAAGGTGTGGATGGAGGAGGG - Intergenic
999186040 5:149709699-149709721 CTGTGGCAGTGGAGGTAAGTGGG + Intergenic
999187018 5:149718936-149718958 AGGAGGCTGTGGTGGGAGGATGG - Intergenic
999229538 5:150053517-150053539 GTGAGGCTGTGGAGTGAAGGCGG + Exonic
999367352 5:151031764-151031786 CAGAGGCCGTGGTGGGAGGAGGG - Intronic
999375657 5:151084983-151085005 CTTAGGCTGAGGAGAGAAGCTGG - Intronic
999443062 5:151617369-151617391 CTGGGCCTGTGGAGGAAGGAAGG + Intergenic
999486743 5:152004463-152004485 CTCAGGCTGAGGCTGGAAGAAGG + Intergenic
999590623 5:153141629-153141651 AAGAGGCTGAGGTGGGAAGATGG - Intergenic
1000009882 5:157220961-157220983 CGGAGGCTGAGGAGGGAGGATGG - Intronic
1000126925 5:158254530-158254552 CTGAGACTGTGGAGAGAAGCTGG + Intergenic
1000136113 5:158352656-158352678 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1000145948 5:158453473-158453495 CTGAGGCTTAGGAGGGTGGAGGG + Intergenic
1000269723 5:159672587-159672609 CTGAGGCTGTGCAGGACAGTGGG - Intergenic
1000315522 5:160086719-160086741 CAGAGGCTGAGGCAGGAAGATGG - Intronic
1000440807 5:161260891-161260913 AGGAGGCTGAGGAGTGAAGATGG + Intergenic
1000622920 5:163505659-163505681 CTGAGGCTGCGGCGTGAAGACGG + Exonic
1000999635 5:167993743-167993765 CAGAGGCTGTGGAAGGGATATGG - Intronic
1001670490 5:173469452-173469474 CTGTCTCTGTGGATGGAAGAGGG - Intergenic
1001776369 5:174331958-174331980 CTGACCCTGTGGAAGGGAGAGGG + Intergenic
1001810688 5:174625757-174625779 AGGAGGCCGAGGAGGGAAGATGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1001953925 5:175835047-175835069 CTGAGGCTGTGAAGGCAAGCAGG + Intronic
1002130034 5:177075296-177075318 ATGAGGCTGAGGCGGGAAAATGG + Intronic
1002200338 5:177524399-177524421 CTGAGGCTGGAGAGGGGAGCCGG - Exonic
1002355651 5:178626993-178627015 CAGCGGCCGAGGAGGGAAGACGG - Exonic
1002399651 5:178984551-178984573 CTGAGGCTGGGGAGGAGAGCTGG + Intronic
1002736445 5:181391406-181391428 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1002748252 6:83418-83440 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1003010880 6:2426547-2426569 CGGAGGCTGGGAAGGGAAGCGGG - Intergenic
1003053475 6:2799617-2799639 CAGAGGCTGTGGAGAGAGCATGG + Intergenic
1003130664 6:3392756-3392778 CTGAGGATGTGGGAGGAAGGAGG + Intronic
1003317329 6:5024466-5024488 CAGAGGCTCTGGAGGAGAGAGGG + Intergenic
1003324373 6:5081584-5081606 CTAAAGCTGAGAAGGGAAGAGGG - Intergenic
1003403032 6:5806638-5806660 CTGAGGCTGCACAGGGCAGAGGG - Intergenic
1003493578 6:6644409-6644431 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003829181 6:9987817-9987839 CTGAGGTGGGGGAGCGAAGATGG + Intronic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004125143 6:12865949-12865971 CTTAGGGTGGGGAGGGAGGAGGG - Intronic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004225542 6:13781225-13781247 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004565189 6:16789454-16789476 CTAAGGCTGTGCAGGGAATCAGG + Intergenic
1004704955 6:18116209-18116231 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1004755787 6:18608767-18608789 CTGAGGCTGTGTAGAGCAGTGGG + Intergenic
1004893009 6:20119913-20119935 ATGAGGCTGGAGATGGAAGAAGG - Intronic
1005460951 6:26070026-26070048 CTTAGGCAGTGGAGAGAAGGAGG + Intergenic
1005473466 6:26184643-26184665 GTGAGGCGGTAGAGGGAAGAGGG - Intergenic
1005908214 6:30284168-30284190 CTGAGGTTGTGCAGGGCAGCAGG + Intergenic
1006086062 6:31596164-31596186 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006459575 6:34150606-34150628 CTGAGGCTGGGGAAGGAAAGAGG - Intronic
1006461009 6:34158073-34158095 CTGAGGAAGTGGAAGGGAGAGGG + Intergenic
1006662452 6:35658964-35658986 CAGAGGCTGAGGTGGGAAGACGG + Intronic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1006796386 6:36734984-36735006 CTCAGGCTGTGGAGTGAGAAGGG + Intergenic
1006897612 6:37480934-37480956 CTGCTGCTGTGGGGGAAAGACGG - Exonic
1007245764 6:40461165-40461187 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1007361510 6:41360101-41360123 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1007455142 6:41971368-41971390 CAGAGGCTGAGGCGGGAGGATGG - Intronic
1007460111 6:42011746-42011768 CTGAGGCAGTGGAGGGAGAGGGG + Intronic
1007551953 6:42736567-42736589 CAGAGGCTGAGGTGGGAGGATGG + Intergenic
1007825413 6:44596191-44596213 CTAAGGATATGGAGGGAGGAAGG - Intergenic
1008210586 6:48719534-48719556 CTGAGGCTGGGAAGAGAAGTGGG - Intergenic
1008715792 6:54288345-54288367 CTGAGTCTGAGCAGGGATGAGGG + Intergenic
1009268835 6:61592084-61592106 TGGAGGCTGAGGTGGGAAGATGG + Intergenic
1009329214 6:62394985-62395007 CAGAGGCTGGGAAGGGTAGAAGG - Intergenic
1010517429 6:76790141-76790163 CTGAGGCTGCACAGGGAAGTAGG + Intergenic
1010661625 6:78578079-78578101 CAAAGTCTTTGGAGGGAAGAGGG + Intergenic
1011032679 6:82940675-82940697 CTGAGAGTGGGTAGGGAAGAAGG - Intronic
1011135902 6:84100366-84100388 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1011221436 6:85058355-85058377 TTGAGTTTGAGGAGGGAAGAAGG + Intergenic
1011325968 6:86150408-86150430 CTGAAGCTGTATAGGGAAGTTGG + Intergenic
1011494225 6:87922825-87922847 GGGAGGCTGTGGAGGAGAGATGG + Intergenic
1011653954 6:89532804-89532826 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1011681910 6:89791730-89791752 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1011870424 6:91886085-91886107 CTGAGGCTTAGGAGGAAAAATGG + Intergenic
1011997623 6:93613120-93613142 GTGGGGCGGTGGGGGGAAGAGGG + Intergenic
1012063111 6:94512062-94512084 CTGAGCCCCTGGAGGGAAGGGGG + Intergenic
1012142100 6:95636816-95636838 CTGAGCCTGTGCGGGGCAGAGGG + Intergenic
1013327446 6:109061697-109061719 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1013413073 6:109898739-109898761 GAGAGGCTGAGGTGGGAAGATGG - Intergenic
1013480307 6:110547172-110547194 GGGAGGCTGGGGTGGGAAGATGG + Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013743604 6:113318769-113318791 CTGGGGCTGGGGAGGAAGGAAGG - Intergenic
1014159717 6:118154002-118154024 CTGAGGATGAGGTGGGAATATGG + Intronic
1014639996 6:123897801-123897823 CAGAGGCAGTGAAGGGAAGAGGG - Intronic
1014778513 6:125537435-125537457 CTGGTGCTGTGGAGTGAAGAAGG - Intergenic
1014864746 6:126514914-126514936 CGGAGGCTGGGAAGGGAAGTAGG - Intergenic
1015042524 6:128739462-128739484 GTGAGGCTGAGGTGGGTAGATGG - Intergenic
1015142463 6:129950436-129950458 CACAGGCTTTGGAGGGAAGAGGG + Intergenic
1015591880 6:134830069-134830091 CTGTGGCTGTGGCTGGAACATGG - Intergenic
1015822666 6:137280647-137280669 TGGAGGCTGTGGTGGGAGGATGG - Intergenic
1016292157 6:142537961-142537983 CTGAGGCTTTGAAGGGAGAAGGG - Intergenic
1016390161 6:143566396-143566418 GTGAGGCTGAGGTGGGAGGATGG - Intronic
1016848337 6:148591485-148591507 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1016982453 6:149864894-149864916 CTGAGGCTGAGTTGGGAGGATGG + Intergenic
1017108954 6:150914190-150914212 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1017385276 6:153875875-153875897 GTGAGGGTGTGGAGGGGTGAGGG - Intergenic
1017510783 6:155112833-155112855 CTGAAGCTCTGGAGGGCCGAAGG - Intronic
1018345539 6:162895163-162895185 TGGAGGCTGAGAAGGGAAGATGG + Intronic
1018609109 6:165629636-165629658 GGGAGGCTGGGGTGGGAAGATGG - Intronic
1018650034 6:165985848-165985870 TTGAAGCTGTGTGGGGAAGAAGG - Intronic
1018663640 6:166113474-166113496 CTGAGGCTGTGCAGAAAAGAGGG - Intergenic
1018841152 6:167518092-167518114 CTGAGGCTGTGGGAGGAACTAGG - Intergenic
1018866480 6:167750542-167750564 TTCAGGCTGTGATGGGAAGAGGG + Intergenic
1018882090 6:167894166-167894188 CAGTGGCTGTGGAGGGATGCTGG + Intronic
1018897172 6:168027697-168027719 GTGGGGATGTGGAGGGAAGCCGG - Intronic
1018996160 6:168712012-168712034 CTGACCCTGAGGAGGGGAGAAGG + Intergenic
1019107156 6:169677757-169677779 CTGAGGCTGTGTGGGGCAGCAGG - Intronic
1019241543 6:170666935-170666957 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1019314257 7:377246-377268 CTGGGGCAGTGGATGGAAGGGGG + Intergenic
1019347188 7:536898-536920 GGGAGGCTGAGGCGGGAAGATGG + Intergenic
1019358436 7:592929-592951 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1019406383 7:886250-886272 CTGGGGCTGTGGGTGGCAGAGGG + Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019576282 7:1739197-1739219 CTCTGGCTGTGGAGGGAGAATGG + Intronic
1019729028 7:2620192-2620214 CTGAGGCTGAGGGGTGAAGAAGG - Intergenic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019797204 7:3059584-3059606 GGGAGGCTGAGGCGGGAAGACGG + Intergenic
1019900989 7:4020498-4020520 CTGGGGAGGTGAAGGGAAGACGG + Intronic
1019993002 7:4705290-4705312 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1019997218 7:4732395-4732417 GGGAGGCTGAGGAGGGAAGATGG - Intronic
1020012715 7:4815445-4815467 AGGGGCCTGTGGAGGGAAGAAGG + Exonic
1020022241 7:4876091-4876113 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1020040911 7:5000207-5000229 TTGAGGCTTTCAAGGGAAGAGGG + Intronic
1020108266 7:5432827-5432849 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1020258035 7:6513317-6513339 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1021037969 7:15824833-15824855 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1021355600 7:19650691-19650713 CTGAGGCTCTGGAGTGAGCATGG + Intergenic
1021730260 7:23588655-23588677 AGGAGGCTGAGGAGGGAGGATGG + Intergenic
1021732789 7:23612566-23612588 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1021932464 7:25595370-25595392 CAGAGGCTCAGGAGGGAAGGAGG - Intergenic
1022159532 7:27695297-27695319 ATGATGCTGTGGAGGGCAGAGGG - Intergenic
1022190487 7:28012927-28012949 CTTAGGTTGTGGTGGGAAAAAGG - Intronic
1022209181 7:28191956-28191978 CAGAGGCTGGGGAGGAAAAAGGG + Intergenic
1022309838 7:29186465-29186487 GGGAGGCTGAGGAGGGAGGATGG + Exonic
1022324388 7:29317877-29317899 CGGAGGCTGAGGAGGGAGGATGG + Intronic
1022733420 7:33053554-33053576 GGGAGGCTGAGGGGGGAAGACGG + Intronic
1023105445 7:36759432-36759454 TTGTAGCTGTGGAGGGAAAAGGG - Intergenic
1023275862 7:38517993-38518015 GTGAGCCTGTGGAGGGTGGAGGG - Intronic
1023425569 7:40032159-40032181 AGGAGGCTGAGGTGGGAAGACGG - Intronic
1023591339 7:41783635-41783657 CTGTAGATGTGGAGAGAAGACGG + Intergenic
1023630351 7:42157458-42157480 CTGGGGCTGTGGTGTGAGGAAGG - Intronic
1023956600 7:44891650-44891672 CTGAGGCTGAGGAGAGGAGAGGG + Intergenic
1023974852 7:45021150-45021172 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1024145603 7:46513535-46513557 GTGAGGATGTGGAGGAATGAGGG - Intergenic
1024189428 7:46990672-46990694 CAGGGGCTGGGGAGGGAAAATGG + Intergenic
1024229903 7:47355847-47355869 CTGAGGCTCTGCTGGGAAGTGGG + Intronic
1024368575 7:48552967-48552989 CAGAGGCTGGGGAGGGTAGTGGG - Intronic
1024556617 7:50608858-50608880 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1024578483 7:50782998-50783020 AGGAGGCAGTGGAGGGAACAAGG - Intronic
1024729190 7:52235710-52235732 CTGAGGTTGTGCAGGGTAGCAGG - Intergenic
1025056599 7:55770405-55770427 GGGAGGCTGAGGAGGGAGGATGG - Intergenic
1025069931 7:55888945-55888967 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1026309040 7:69167816-69167838 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1026355396 7:69552962-69552984 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1026468714 7:70676325-70676347 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1026828894 7:73599961-73599983 CTGGGGCTGGGGAGGGGAGGGGG - Intronic
1026949887 7:74339987-74340009 AGGAGGCTGTGGTGGGAGGATGG + Intronic
1027130247 7:75585568-75585590 CTGAGAGTGTGGAGGGGAGGGGG - Intronic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027371832 7:77514320-77514342 ATGTGGTTGGGGAGGGAAGAAGG - Intergenic
1027395307 7:77747432-77747454 CTGAGGCTGTGCAGAGCAGCAGG - Intronic
1027399036 7:77788461-77788483 CAGAGGCTGAGGTGGGGAGATGG + Intergenic
1027695477 7:81404762-81404784 CTGAGGCTGTACAGAGAAGTGGG + Intergenic
1028207203 7:88031788-88031810 CTGAGGTTGTGCAGGGCAGTGGG - Intronic
1028447000 7:90935807-90935829 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1028600903 7:92599467-92599489 CTGAGACTGAGGTGGGAGGATGG - Intergenic
1028846326 7:95484225-95484247 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1029098367 7:98107080-98107102 CTGAGGCAGCGGAGGGAGGCAGG + Exonic
1029159557 7:98541777-98541799 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1029248788 7:99221555-99221577 AGGAGGCTGAGGAGGGAGGATGG - Intergenic
1029438752 7:100576145-100576167 CAGAGGATGTGGAGGGAGGCTGG + Intronic
1029459557 7:100687133-100687155 CTGAGGCAGTGGAGGGAGGAAGG + Intronic
1029473591 7:100769647-100769669 AGGAGGCTGTGGTGGGAGGATGG - Intronic
1029492325 7:100878205-100878227 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1029547564 7:101218376-101218398 CGGAGGCTGAGGTGGGAGGATGG - Intronic
1029661020 7:101961769-101961791 CAGAGGCTGAGGCAGGAAGATGG + Intronic
1030185315 7:106755932-106755954 CTCAGGCTGTAATGGGAAGAGGG - Intergenic
1030328741 7:108250319-108250341 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1030881519 7:114886211-114886233 ATGATGCAGGGGAGGGAAGAAGG + Intergenic
1031284146 7:119843053-119843075 CCGAGGCTGTGCAGGGTAGCAGG - Intergenic
1031726732 7:125249320-125249342 CTGAGGCTGGGAAGGGTAGTGGG - Intergenic
1031894648 7:127335288-127335310 CAGAGGCTGGGGAAGGAATAGGG + Intergenic
1032003522 7:128282188-128282210 CTGAGGATGAGGAGTGAAGGAGG + Intergenic
1032350607 7:131159554-131159576 CAGAGGCTGGGAAGGGAAGGGGG + Intronic
1032447733 7:131999136-131999158 CCGAGGCTATGGAGGAAGGAGGG - Intergenic
1032511829 7:132478908-132478930 CTGAGGCTTTGGTGGCAAGGAGG - Intronic
1032853423 7:135814539-135814561 CTGCGGCTGTGAAAGCAAGAGGG - Intergenic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033273476 7:139953687-139953709 CTGGGTCTGTGGAGGTCAGAGGG - Intronic
1033475560 7:141688787-141688809 CTGTGGCAGGGCAGGGAAGATGG - Intronic
1033521731 7:142167675-142167697 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1033554805 7:142479567-142479589 GTGAGGCTGTCGAAGGGAGAGGG + Intergenic
1033646231 7:143306733-143306755 GAGAGGCTGAGGCGGGAAGATGG - Exonic
1034040239 7:147870242-147870264 CTGACCCTATGGAGGAAAGAGGG + Intronic
1034218848 7:149429108-149429130 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1034276854 7:149827656-149827678 CTGTGGCTGAGAAGGCAAGATGG + Intergenic
1034313495 7:150110443-150110465 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313514 7:150110512-150110534 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034313532 7:150110581-150110603 CTGAGGGTGGGGCTGGAAGAGGG + Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034518180 7:151598287-151598309 CAGAGGCTGGGGAGGGAATGGGG + Intronic
1034793365 7:153990221-153990243 CTGAGGGTGGGGCTGGAAGAGGG - Intronic
1034816560 7:154176936-154176958 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1034823675 7:154240485-154240507 CTGAGGCATGGGATGGAAGATGG - Intronic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035121628 7:156573163-156573185 CTGCGGCAATGGAGGGCAGAGGG + Intergenic
1035127018 7:156616307-156616329 CTGAGACTGTGGAGGGGTGACGG - Intergenic
1035128576 7:156629827-156629849 CAGAGGCTGTGCAGGGCAGCAGG - Intergenic
1035132425 7:156668454-156668476 CAGAGGCTGTTGAGGGGAGGCGG + Intronic
1035438538 7:158877978-158878000 ATGAGGCTGTGGAGGCCAGGAGG + Intronic
1035506573 8:141161-141183 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1035524042 8:298439-298461 CTCACGCAGTGGATGGAAGATGG + Intergenic
1035837419 8:2769684-2769706 CTGAGGCTGGGAAGGCAAGCTGG + Intergenic
1035987540 8:4451224-4451246 GGGAGGCTAAGGAGGGAAGATGG + Intronic
1036634161 8:10537449-10537471 CAGAGGCTGGGGAGGAAAGCAGG + Intronic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1036756825 8:11476714-11476736 CAGAGGCTTTGGAGGGAGGTGGG - Intergenic
1036930573 8:12951841-12951863 CTGCGGCCGCGGCGGGAAGAAGG + Intronic
1038153961 8:24969851-24969873 CAGAGGCTGGGAAGGGTAGAGGG - Intergenic
1038174407 8:25167033-25167055 CTGAGGCTGAGGTGGAAGGATGG - Intergenic
1038211356 8:25521807-25521829 TGGAGGCTGAGGTGGGAAGATGG + Intergenic
1038461358 8:27720062-27720084 CAGAGGATGGGGAGGGATGAGGG + Intergenic
1038663078 8:29513831-29513853 ATGAGGCTCTGGAAGGAAGCAGG - Intergenic
1038705144 8:29886439-29886461 CTGGGGCTGGGGAGGTGAGATGG + Intergenic
1038969989 8:32622505-32622527 GGGAGGCTGAGGAAGGAAGATGG - Intronic
1039612077 8:38928037-38928059 CAGAGGCTGGGGAGGGGAGAGGG + Intronic
1039651211 8:39340909-39340931 CTGAGCCTGTGATGGGATGATGG + Intergenic
1039675039 8:39653971-39653993 CAGAGGCTGGGAAGGGAAGTGGG - Intronic
1039855474 8:41408590-41408612 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1040041695 8:42922444-42922466 TGGAGGCTGAGGTGGGAAGATGG + Intronic
1040433132 8:47363561-47363583 CAGAGCCTGGGGCGGGAAGAAGG - Intronic
1040661180 8:49577643-49577665 CTGAGGAATGGGAGGGAAGAAGG - Intergenic
1041005976 8:53497335-53497357 CTGAGGCTCTGCAGGGCAAAGGG - Intergenic
1041309930 8:56506266-56506288 CTGAGCCAGTGGAGGGAAAAGGG - Intergenic
1041368907 8:57139399-57139421 CTAAGGTTGGGAAGGGAAGAGGG - Intergenic
1041682192 8:60605072-60605094 CTGAGGCTGTGCAGGGTGGTGGG - Intronic
1041747694 8:61226735-61226757 CTGAGGCTGGGGAGGGAAGAGGG + Intronic
1041782170 8:61589087-61589109 CAGAGGCTGTGGTGGGAAAAGGG + Intronic
1042081151 8:65052927-65052949 CTTAGGGAGGGGAGGGAAGATGG - Intergenic
1042274182 8:66986007-66986029 CTGAGGCTGTAGGAGGAAGGCGG - Intronic
1042604404 8:70531169-70531191 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1042820052 8:72920536-72920558 CTGAGGCTGAGGTGGGAGGATGG + Intronic
1042983556 8:74557641-74557663 CAGAGGCTGGGAAGGAAAGAAGG + Intergenic
1043127413 8:76417117-76417139 TTTAGGCTGTGGAGTGCAGAGGG + Intergenic
1043153363 8:76746298-76746320 GGGAGGCTGTGGTGGGAGGATGG + Intronic
1043213855 8:77560165-77560187 CAGAGGCTGTGGAGGACAGGGGG + Intergenic
1043539146 8:81239762-81239784 CAGAGGCTGAGGCGGGAGGATGG - Intergenic
1043912649 8:85880954-85880976 CTAAAGCTCTGTAGGGAAGATGG + Intergenic
1044028888 8:87210535-87210557 CTGAGGCTATGCAGGGCAGCAGG - Intronic
1044192516 8:89335723-89335745 CAGAGGCTGGGAAGGGAAGTGGG - Intergenic
1044281873 8:90365941-90365963 CAGATGCTGTGGAGGAAAAATGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044493550 8:92849283-92849305 CAGAGTCTGAGGAAGGAAGAAGG + Intergenic
1044510934 8:93077681-93077703 CAGAGGCTGTGAAGGGAAGAGGG + Intergenic
1044530556 8:93302171-93302193 CGGAGGCTGAGGTGGGAAGATGG - Intergenic
1044602050 8:94015092-94015114 CAGAGGGTGTGGATGGAAAAAGG - Intergenic
1044659582 8:94582117-94582139 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1044667711 8:94647900-94647922 GGGAGGCTGAGGAGGGAGGATGG + Intronic
1044843239 8:96355842-96355864 GGGAGGCTGCGGTGGGAAGATGG + Intergenic
1044874645 8:96653034-96653056 AGGAGGCTGAGGAGGGAGGATGG - Intronic
1044974905 8:97654985-97655007 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1045048114 8:98298333-98298355 ATGAGGCTGAGGTGGGAGGATGG - Intergenic
1045179915 8:99769917-99769939 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1045274616 8:100691832-100691854 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1045791304 8:105987886-105987908 CTGAGGCTGTGTAGGGCACCAGG - Intergenic
1045844301 8:106615501-106615523 CGGAGGCTGAGGTGGGAGGATGG + Intronic
1046116502 8:109791005-109791027 CAGAGGCTGGGGAGGGTAGTAGG + Intergenic
1046888924 8:119400363-119400385 CTGAGGCTGCGCAGGGCAGCAGG - Intergenic
1046910951 8:119626116-119626138 GGGAGGCTGAGGCGGGAAGATGG + Intronic
1047048494 8:121082113-121082135 TAGAGGCTGTGAAGGGTAGAGGG - Intergenic
1047072818 8:121366025-121366047 CAGAGGCTGGGGAGGGGAGTGGG + Intergenic
1047318640 8:123757502-123757524 CTGAGGCTGAAGAGGGGAGAGGG + Intergenic
1047430177 8:124784376-124784398 CAGAGGCTGAGAAGGGTAGAGGG - Intergenic
1047507190 8:125489152-125489174 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1047676633 8:127209562-127209584 GGGAGGGTGGGGAGGGAAGATGG + Intergenic
1048087656 8:131201574-131201596 CCAAGGCTGTGCAGGGCAGAAGG - Intergenic
1048200132 8:132365924-132365946 AGGAGGCTGAGGAGGGAGGATGG + Intronic
1048226525 8:132592495-132592517 CTGAGGTTGTGGATGTAAGCAGG + Intronic
1048608338 8:135993855-135993877 CTGAGGCTGGGAAGGGTAGTGGG + Intergenic
1048831544 8:138482249-138482271 GTGAGGAAGTGTAGGGAAGAGGG + Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1049032961 8:140050708-140050730 TGGGGGCTGGGGAGGGAAGAAGG + Intronic
1049097628 8:140558227-140558249 GTGAGGCTCAGGAAGGAAGAGGG + Intronic
1049188579 8:141272790-141272812 CTGGTGTTGTGGAGGGAAGGGGG - Intronic
1049589315 8:143449059-143449081 CTGGGGCTGTGCAGGGCAGTGGG + Intronic
1049592037 8:143466961-143466983 CTAAGGCCAAGGAGGGAAGAAGG + Intronic
1049597702 8:143492338-143492360 CTGAGGCCCTGGTGGGAGGAGGG - Intronic
1049722153 8:144123376-144123398 CTGAGGCTGGGAAGGGAGGTGGG + Intergenic
1049807108 8:144546074-144546096 CTGAGGGTGAGGCGGGAGGAAGG + Intronic
1049883470 9:13254-13276 CTGAGGCTGAGGAAGGAGAAGGG + Intergenic
1049884885 9:20082-20104 CTGAGACTGGGGAGGGACAAAGG + Intergenic
1049898715 9:137254-137276 ATGAGTCTGAGGTGGGAAGACGG + Intronic
1050006961 9:1141734-1141756 CTGAGGCTGGGCATGGAAGCTGG + Intergenic
1050160343 9:2712211-2712233 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1050415137 9:5408806-5408828 CCAAGGCTGTGCAGGGAAGTGGG - Intronic
1050572516 9:6956090-6956112 CAGAGGCTGAGGAGGGTAGTTGG + Intronic
1051297339 9:15610660-15610682 GAGAGGCTGAGGTGGGAAGATGG - Intronic
1051543131 9:18243733-18243755 CTGGGTCTGTGGACAGAAGATGG - Intergenic
1051559599 9:18425613-18425635 AGGAGGCTGAGGAGGGAAGATGG + Intergenic
1051580642 9:18670081-18670103 CTGAGGTTGTCTAGAGAAGATGG + Intronic
1051888657 9:21921729-21921751 GTGAGGCTGAAGAGGGCAGATGG + Intronic
1052104575 9:24497141-24497163 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1052165450 9:25320645-25320667 CGAAGGCTGAGGTGGGAAGATGG + Intergenic
1052179406 9:25505756-25505778 CTGAGGTTGTGTAGGGCAGTGGG + Intergenic
1052546384 9:29886022-29886044 CAGAGGCTGAGGTGGGAAGATGG + Intergenic
1053003680 9:34591093-34591115 CCCAGGCCGTGGCGGGAAGAAGG - Intergenic
1053084993 9:35211854-35211876 CGGAGGCTGAGGCGGGAGGATGG + Intronic
1053184985 9:36008493-36008515 CAGAGGCTGAGGAGGGAGGATGG - Intergenic
1053693436 9:40612462-40612484 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1053722141 9:40957526-40957548 CTGAGGTTTTGTAGGGAGGAAGG + Intergenic
1053741765 9:41147566-41147588 ATGAGTCTGAGGTGGGAAGATGG + Intronic
1053940424 9:43242856-43242878 ATGAGGCTGAGGTGGGAAGACGG - Intergenic
1054271394 9:63027623-63027645 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1054304679 9:63411690-63411712 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054343832 9:63894468-63894490 CTGAGGTTTTGTAGGGAGGAAGG - Intergenic
1054347029 9:63977376-63977398 ATGAGTCTGAGGTGGGAAGATGG + Intergenic
1054403426 9:64735711-64735733 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054437048 9:65221199-65221221 ATGAGGCTGAGGTGGGAAGATGG - Intergenic
1054444759 9:65303713-65303735 ATGAGTCTGAGGTGGGAAGATGG + Intergenic
1054485512 9:65717790-65717812 ATGAGTCTGAGGTGGGAAGATGG - Intronic
1054493350 9:65800793-65800815 ATGAGGCTGAGGTGGGAAGATGG + Intergenic
1054686576 9:68283734-68283756 ATGAGTCTGAGGTGGGAAGATGG - Intronic
1054720185 9:68596104-68596126 TTGAGGCTGAAGAGGGCAGAGGG - Intergenic
1054902141 9:70380568-70380590 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1054909088 9:70437689-70437711 CGGAGGCTGAGGTGGGAGGACGG - Intergenic
1055407431 9:75989387-75989409 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1056021248 9:82440640-82440662 CTGAGGCTGTGCAGGGAAGCTGG - Intergenic
1056040061 9:82656128-82656150 CAGAGGCTGGGAAGGGAAGAAGG + Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1056210944 9:84364668-84364690 CAGAGGCTGGGGAGGGTAGTGGG - Intergenic
1056410328 9:86319935-86319957 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1056710675 9:88990336-88990358 CTGATCCTCTGGAGGCAAGAGGG + Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1056981999 9:91322426-91322448 CTGAAGCTGGGGAGAGAAGCAGG + Intronic
1057149873 9:92787177-92787199 GGGAGGCTGAGGTGGGAAGATGG - Intergenic
1057519362 9:95749083-95749105 GGGAGGCTGTGGTGGGAGGATGG - Intergenic
1057791885 9:98130183-98130205 GGGAGGCTGAGGCGGGAAGATGG - Intronic
1057810823 9:98255552-98255574 CGGAGACTGCGGAGGGACGAGGG + Exonic
1057857707 9:98614721-98614743 TTGTTTCTGTGGAGGGAAGAAGG + Intronic
1058127811 9:101215636-101215658 CAGAGGCTGGGAAGGGAAGCAGG - Intronic
1058412147 9:104745979-104746001 CTGAGGCTGAGGAGGGAAGAAGG - Intergenic
1058545893 9:106059916-106059938 CTGAGCCTGTGGGGGCAAGAGGG + Intergenic
1058989892 9:110245512-110245534 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059108410 9:111531784-111531806 ATGAGGCTGAGGAGGGAGGATGG - Intronic
1059639618 9:116203949-116203971 TTGAGGTTGTAGAAGGAAGAAGG + Intronic
1059976524 9:119723852-119723874 CTCAGGCTCTGGAGGGCAGCAGG + Intergenic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060414483 9:123420851-123420873 CAGAGGCGGGGGAGGGAGGAGGG + Intronic
1060446113 9:123689882-123689904 AGGAGGCTGAGGTGGGAAGATGG + Intronic
1060571989 9:124650424-124650446 CAGAGGCTGGGAAGGGTAGAGGG + Intronic
1060721792 9:125984486-125984508 CTGGGACTCTGGAGGGAAGGAGG - Intergenic
1060882142 9:127124675-127124697 TTGTGGCTGAGGAGAGAAGATGG + Intronic
1061001387 9:127904821-127904843 CAGAGGCTGGAGAGGGCAGACGG + Intronic
1061073873 9:128328843-128328865 CTGTCGCTGTGGAGGGGAGGGGG + Intronic
1061136822 9:128739395-128739417 CTGAGGCTGAGGCAGGAAAATGG + Intronic
1061287739 9:129633719-129633741 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1061292411 9:129658694-129658716 CGGAGGCTGAGGTGGGAGGATGG + Intergenic
1061328758 9:129879509-129879531 CTGCTGCTGTGGAGGGTGGAGGG + Intronic
1061681894 9:132246653-132246675 CAGAGGCTGAGGTGGGATGATGG - Intergenic
1061897931 9:133658267-133658289 CTGAGGCTGGAGGGGCAAGATGG - Intronic
1062141348 9:134960831-134960853 CTGAGGCTGGGCCGGGAAGGAGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062271992 9:135714060-135714082 CTCAGGCTGTTGAGGGGTGAGGG - Intronic
1062304440 9:135895392-135895414 CTGAAGCTATGGAGGCCAGAGGG + Intronic
1062444385 9:136587576-136587598 CTGAGGCTGGGGTGAGATGACGG - Intergenic
1062601687 9:137321187-137321209 CTGAGGCTGTGGGGGCAGAAGGG + Intronic
1062720457 9:138040041-138040063 CAGAGGCTGAGGTGGGAGGATGG - Intronic
1203601735 Un_KI270748v1:16169-16191 CAGAGGCTGTGAAGGGTAGTGGG - Intergenic
1185505666 X:630966-630988 CGGAGGCGGCGGAGGTAAGAAGG + Exonic
1185854225 X:3519396-3519418 CGGAGGCTGAGGCGGGAGGATGG - Intergenic
1185859209 X:3562016-3562038 CAGGGGCTGGGGAGGGGAGAAGG - Intergenic
1186480485 X:9893205-9893227 GGGAGGCTGAGGTGGGAAGATGG - Intronic
1186494099 X:9998125-9998147 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1186782677 X:12929083-12929105 CTGAGGCAGTAGAGGGTTGAGGG + Intergenic
1186961707 X:14743752-14743774 CAGAGACTTTGGAGGGAACATGG - Intergenic
1187178770 X:16922322-16922344 CAGAGGCTGGGAAGGGAAGAGGG + Intergenic
1187342444 X:18433121-18433143 GGGAGGCTGAGGTGGGAAGATGG + Intronic
1187361072 X:18628301-18628323 ATAAGGCTGGGGAGGGAAGGGGG - Intronic
1188625508 X:32279654-32279676 CAGAGGCTGTGAAGGGTAGTGGG + Intronic
1188801830 X:34541720-34541742 CTGAGAGAGTGGAGGGAAGTTGG - Intergenic
1188966450 X:36559331-36559353 CTGAGGGTGTGGGGAGAGGAGGG - Intergenic
1189247117 X:39571810-39571832 GGGAGGCTGAGGAGGGAGGATGG + Intergenic
1189495087 X:41501398-41501420 AAGAGGCTGAGGTGGGAAGATGG - Intergenic
1189872397 X:45397656-45397678 GTGACACTGTGGAAGGAAGAGGG + Intergenic
1189899427 X:45690586-45690608 CTGAGGCTGTGCAGGGCAGCAGG - Intergenic
1190081590 X:47360854-47360876 AGGAGGCTGAGGAGGGGAGATGG - Intergenic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190210434 X:48442370-48442392 CTGAGGCTGAGGCAAGAAGAGGG - Intergenic
1190360651 X:49645317-49645339 CTGAGCCTGTGGGGGGACGGGGG + Intergenic
1190464808 X:50715697-50715719 GTGAGGCTGTGGAGGAAAGGTGG + Intronic
1190475410 X:50822164-50822186 CAGAGGCTGGGAAGGGTAGAGGG + Intergenic
1190574610 X:51820923-51820945 CAGAGGCTGAGGAGAGTAGAGGG - Intronic
1190575032 X:51827156-51827178 CAGAGGCTGAGGTGGGAGGATGG + Intronic
1191796279 X:65025251-65025273 GGGAGGCTGTGGTGGGAGGATGG - Intronic
1191953487 X:66619494-66619516 CTTAGGTTGTGGAGGTGAGAGGG - Intronic
1192171586 X:68858896-68858918 CTGGGGCTGTGGTGAGATGACGG + Intergenic
1192185626 X:68945003-68945025 CAGTGGCTGTGGAGTAAAGACGG + Intergenic
1192633474 X:72794889-72794911 CAGAAGCTGGGGAGGGAAGGGGG - Intronic
1192648235 X:72925912-72925934 CAGAAGCTGGGGAGGGAAGGGGG + Intronic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1193527536 X:82612057-82612079 CTGAGGCTGCAAAGGGCAGAGGG - Intergenic
1193601661 X:83513928-83513950 CAGAGGTTGTGGAGGGAGGTAGG + Intergenic
1193680429 X:84512387-84512409 CAGAGGCTGAGAAGGGTAGAGGG + Intergenic
1193822980 X:86188935-86188957 TAGATGCTGTGGAGGGAAAATGG - Intronic
1193824452 X:86205663-86205685 GGGAGGCTGAGGAGGGAGGATGG - Intronic
1193965126 X:87975772-87975794 CTGAGCCTGTGCAGGGCAGTGGG - Intergenic
1194064153 X:89241439-89241461 CTGAGACTGTGCAGGGTAGCAGG - Intergenic
1194306820 X:92258191-92258213 CTGAGGCTGTGCAGTGCAGCAGG + Intronic
1194655589 X:96569656-96569678 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1194863042 X:99028056-99028078 CAGAGGCTGGGAAGGGAACAGGG + Intergenic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1195035068 X:100965057-100965079 CCGAGGCTGTGCAGGGCAGCAGG - Intergenic
1195115241 X:101691034-101691056 GGGAGGCTGAGGTGGGAAGACGG - Intergenic
1195380916 X:104269947-104269969 CAGAGACTGGGAAGGGAAGAAGG + Intergenic
1195596089 X:106691526-106691548 CAGAGGCTGGGAAGGGAAGGAGG - Intergenic
1195619583 X:106939607-106939629 ATGAGGCTTTAAAGGGAAGAAGG - Intronic
1195917582 X:109951041-109951063 CAGAGGTTGAGAAGGGAAGAGGG + Intergenic
1196301988 X:114058379-114058401 TTGAGGCTGTGATGGGAAGTGGG + Intergenic
1196374760 X:115020931-115020953 CAGAGGCTGGGGAGGGAATAAGG - Intergenic
1196401384 X:115320517-115320539 CAGAGGCTGTGAAGGGTAGTGGG + Intergenic
1196883187 X:120218995-120219017 CAGAGGCTGTGAAGGGTAGAGGG + Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1197209600 X:123817978-123818000 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1197235231 X:124054859-124054881 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1197617110 X:128705517-128705539 CTGAGGCTGGGGAGGGTTGGGGG - Intergenic
1197642335 X:128980783-128980805 CAGAGGCTGGGAAGGGAAGTGGG + Intergenic
1197739973 X:129883347-129883369 CAGAGGCTGAGGTGGGAGGATGG - Intergenic
1197876058 X:131108382-131108404 CAGAGGCTGTAAAGGGAAGTGGG - Intergenic
1197894636 X:131298781-131298803 ATGAGGCTGAGGTGGGAGGATGG + Intronic
1198045325 X:132896109-132896131 CAGAGGCTGGGAAGGGAAGTGGG + Intronic
1198407674 X:136330994-136331016 CAGAGGCTGGGAAGGGTAGAGGG - Intronic
1198627686 X:138596856-138596878 CTGGGGCTGTGCAGGGGAAAAGG + Intergenic
1198654206 X:138895982-138896004 CAGAGGTTGGGGATGGAAGAAGG + Intronic
1198670457 X:139074737-139074759 CTGAGGCTGAGGAGTTGAGAAGG - Intronic
1198689751 X:139268101-139268123 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1198723725 X:139653797-139653819 CAGAGGCTGGGAAGGGTAGAGGG - Intronic
1198981361 X:142399958-142399980 CAGAGGCTGTGAAGGGTAGTAGG - Intergenic
1199134445 X:144234210-144234232 CTGAGGCTGCCCAGGGAAGTGGG - Intergenic
1199207148 X:145161996-145162018 GTGAGGCTGAGGTGGGAGGATGG + Intergenic
1199421542 X:147650240-147650262 CTAAGGCTGTGCAGGGCAGTGGG - Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1199871718 X:151904388-151904410 CTGATGGTGGGGAGGGAGGAAGG - Intergenic
1200034812 X:153320348-153320370 CTGGGGCTGTGCAGGGAAACTGG + Intergenic
1200120951 X:153790287-153790309 CGGAGGCTGTGGGAGGCAGAGGG + Exonic
1200255315 X:154578888-154578910 AGGAGGCTGAGGTGGGAAGATGG + Intergenic
1200262454 X:154625516-154625538 AGGAGGCTGAGGTGGGAAGATGG - Intergenic
1200402346 X:156026895-156026917 CTGAGGCTGAGGAAGGAGAAGGG - Intergenic
1200415636 Y:2907025-2907047 AGGAGGCTGAGGTGGGAAGATGG - Intronic
1200718327 Y:6575538-6575560 CTGAGACTGTGCAGGGTAGCAGG - Intergenic
1201400476 Y:13599229-13599251 CTGAGGCTCTGGAGGGCAACAGG - Intergenic
1201584823 Y:15548863-15548885 CTTTGGCTGTGTTGGGAAGAGGG + Intergenic
1201586524 Y:15567184-15567206 GGGAGGCTGAGGTGGGAAGATGG + Intergenic
1201760087 Y:17527445-17527467 CTGAGGCTGGGAAGGGCAGTGGG - Intergenic
1201841467 Y:18378545-18378567 CTGAGGCTGGGAAGGGCAGTGGG + Intergenic
1201947830 Y:19531106-19531128 CTAAGGCTGTGCAGGGAAGTAGG - Intergenic
1202582649 Y:26398330-26398352 AGGAGTCTGAGGAGGGAAGATGG - Intergenic