ID: 1019748395

View in Genome Browser
Species Human (GRCh38)
Location 7:2713367-2713389
Sequence GCTTCTCGTGGAGTACAAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019748382_1019748395 25 Left 1019748382 7:2713319-2713341 CCGCTCCCAGGGGCCTGCACACA 0: 1
1: 0
2: 3
3: 44
4: 436
Right 1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1019748391_1019748395 -9 Left 1019748391 7:2713353-2713375 CCCTGATCCTGGGTGCTTCTCGT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1019748385_1019748395 19 Left 1019748385 7:2713325-2713347 CCAGGGGCCTGCACACATGGAGA 0: 1
1: 0
2: 3
3: 27
4: 237
Right 1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1019748381_1019748395 29 Left 1019748381 7:2713315-2713337 CCAGCCGCTCCCAGGGGCCTGCA 0: 1
1: 0
2: 1
3: 36
4: 398
Right 1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1019748392_1019748395 -10 Left 1019748392 7:2713354-2713376 CCTGATCCTGGGTGCTTCTCGTG 0: 1
1: 0
2: 0
3: 7
4: 124
Right 1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1019748384_1019748395 20 Left 1019748384 7:2713324-2713346 CCCAGGGGCCTGCACACATGGAG 0: 1
1: 0
2: 4
3: 16
4: 258
Right 1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1019748390_1019748395 -6 Left 1019748390 7:2713350-2713372 CCTCCCTGATCCTGGGTGCTTCT 0: 1
1: 0
2: 1
3: 20
4: 225
Right 1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 44
1019748387_1019748395 12 Left 1019748387 7:2713332-2713354 CCTGCACACATGGAGAGGCCTCC 0: 1
1: 0
2: 2
3: 19
4: 203
Right 1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG 0: 1
1: 0
2: 0
3: 1
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019748395 Original CRISPR GCTTCTCGTGGAGTACAAGC CGG Exonic
1067046501 10:42988295-42988317 GCTTTTCATGGAGCAGAAGCTGG + Intergenic
1067508494 10:46876320-46876342 GCTTCCCTTGGAGGACAAGTGGG + Intergenic
1067653754 10:48175529-48175551 GCTTCCCTTGGAGGACAAGTGGG - Intronic
1088332284 11:108666152-108666174 CCTTCTAGTGCAGTACAATCAGG + Intronic
1089489487 11:118872935-118872957 GCTTCTCCTCTAGAACAAGCAGG + Intergenic
1090110071 11:123898175-123898197 ATTTCTAGTGGAGTACAGGCAGG - Intergenic
1091362129 11:134986137-134986159 GCCTCTGATGGACTACAAGCTGG - Intergenic
1108510262 13:51149074-51149096 CCTTCTTGTGGAGCACAAGAAGG - Intergenic
1117301404 14:54432202-54432224 GGTACTCTGGGAGTACAAGCTGG + Exonic
1118473813 14:66099115-66099137 GCTCCTCGTGTACTGCAAGCAGG - Intergenic
1119776595 14:77253013-77253035 GCTTCTCCTGGAGTCAAAGCAGG + Intronic
1138183864 16:54961842-54961864 GCTTCTCCTAGAGTGCAAGAGGG - Intergenic
1139299698 16:65934462-65934484 ACTTGTGGTGGAGTAGAAGCAGG - Intergenic
1144067677 17:11639219-11639241 GCCTATCATGGAGGACAAGCAGG + Intronic
1146657233 17:34641810-34641832 GACCCTCGTGGAGTTCAAGCGGG + Intergenic
1148794946 17:50192494-50192516 GCTTCACCTGGAGGACCAGCAGG + Exonic
1156799022 18:41086063-41086085 CCTACTCCTGCAGTACAAGCAGG + Intergenic
1164694411 19:30232834-30232856 GCATCTAGTGGGGTAGAAGCTGG - Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1167391258 19:49196629-49196651 GCTGCTCGTGGATTTCCAGCCGG + Exonic
925011939 2:492541-492563 GCTTCACCTGGAACACAAGCAGG + Intergenic
941526157 2:166609565-166609587 ACTTCTCTTGGTGTACAGGCAGG + Intergenic
942950379 2:181714346-181714368 GCTGCTGCTGGAGCACAAGCAGG + Intergenic
1172744442 20:37195771-37195793 GCTACTCAAGGAGTCCAAGCAGG - Intronic
1176065676 20:63193259-63193281 GCTTCTGGTGGGTTACAGGCTGG - Intergenic
1184872849 22:47251884-47251906 GCTTATCCTGGAGCACAGGCTGG - Intergenic
950335441 3:12189259-12189281 TCCTCTCCTGGAGTACAGGCTGG + Intronic
954530122 3:51311173-51311195 GCTGCTCTTGCAGGACAAGCTGG - Intronic
961039062 3:123664141-123664163 ACTGCTGGTGGAGAACAAGCTGG - Exonic
965033930 3:163409601-163409623 ACTTCTCCTGGAGTCCCAGCAGG + Intergenic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
968631676 4:1655200-1655222 GCGCCTCGTGGAGGGCAAGCAGG + Exonic
971184538 4:24360998-24361020 GCTCCTGGTGGATTACAAGAAGG + Intergenic
993741956 5:91552937-91552959 GCTTCTCGTGGGGCAGAAGTGGG - Intergenic
1001245740 5:170104989-170105011 GCTTCTGGTGGGGTTCAAGGGGG - Intergenic
1001611669 5:173007831-173007853 GCCTCTTCTGGAGTACAGGCAGG + Intronic
1003125266 6:3351028-3351050 GCTTCTCCTGGAGGAAATGCAGG - Intronic
1004589124 6:17031717-17031739 GCTTCTACTTGAGGACAAGCAGG + Intergenic
1018934787 6:168266573-168266595 GCTTCTGGTGGAGGAAAATCCGG - Intergenic
1019748395 7:2713367-2713389 GCTTCTCGTGGAGTACAAGCCGG + Exonic
1042768855 8:72356812-72356834 GCTGCTGGTGGAGTACATTCAGG + Intergenic
1046461720 8:114547285-114547307 GCTTCTGGTGGAGTTCATGAAGG - Intergenic
1047417068 8:124673421-124673443 CCTGCACGTGGAGTAAAAGCTGG + Intronic
1057379988 9:94559036-94559058 GCTTCACGTCCAGTACAGGCTGG + Exonic
1195364550 X:104113755-104113777 GCCCCTCCTGGAGTACAGGCAGG + Exonic
1197766222 X:130060805-130060827 GCCTCTTTTGGAGTACAAGATGG + Intergenic