ID: 1019748735

View in Genome Browser
Species Human (GRCh38)
Location 7:2715440-2715462
Sequence TGCCTGGCTCATGCTGAGGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 368}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019748730_1019748735 21 Left 1019748730 7:2715396-2715418 CCGCTGGAGTGATGCGAGATTAA 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG 0: 1
1: 0
2: 0
3: 28
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019748735 Original CRISPR TGCCTGGCTCATGCTGAGGG TGG Exonic
900310618 1:2031644-2031666 TGCCTGGGTCCTGCAGAGGATGG - Intergenic
900463148 1:2810884-2810906 GGCCTGGCTCACGCTCTGGGAGG + Intergenic
900682670 1:3925408-3925430 TGCCTTGCTCCTGCTTTGGGAGG + Intergenic
900682683 1:3925458-3925480 TGCCTTGCTCCTGCTTTGGGAGG + Intergenic
900764117 1:4492580-4492602 CGCCAGGGTCATGCTGAGAGGGG - Intergenic
901194550 1:7433120-7433142 TGCCTGCCTCCTGCTCATGGAGG + Intronic
901202490 1:7474640-7474662 TGCCTGGCTCAGGCTTTGGGAGG - Intronic
901400127 1:9010157-9010179 TGCCTGCCTGGTGCTGACGGTGG - Exonic
902315795 1:15617574-15617596 GGCCTGGCTGGTGCTGCGGGAGG - Exonic
902460970 1:16576348-16576370 TGTCTGGCTCATCCGGAGTGAGG + Exonic
902878668 1:19356413-19356435 TGCTGGCCTCCTGCTGAGGGAGG - Intronic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
904330599 1:29755726-29755748 AGCCTCCCTCAGGCTGAGGGAGG + Intergenic
904490868 1:30858279-30858301 TGGGTGTCTCTTGCTGAGGGAGG - Intergenic
905256145 1:36686745-36686767 TGCCTGGTAGATGCTGAGGAGGG + Intergenic
905868386 1:41388763-41388785 TGCCTGCCGCAAGCTGAGTGTGG - Intergenic
906100676 1:43258610-43258632 TGGCTGCTTCATGCTGAGGAGGG + Intronic
906540711 1:46583690-46583712 TGCCTTTCTGATGCTGAGGCTGG - Intronic
906671460 1:47658270-47658292 GGCCTGGCACATGCTGGGGAGGG - Intergenic
907243921 1:53095233-53095255 AGCCAGGCGCATGCTGATGGGGG + Intronic
907250395 1:53134265-53134287 TGCCCTGCTCCTGCTGTGGGTGG - Intronic
913026063 1:114841871-114841893 TTGCTGGCTCAGGCTTAGGGTGG + Intergenic
914688427 1:150003501-150003523 TGCCTTGGGCATGCTGAGGTTGG - Intronic
917930470 1:179819079-179819101 CAGCTGGCTCATGCTGAGGATGG + Intergenic
918247376 1:182671848-182671870 TGCCTGGCTCAAGTGGTGGGAGG - Intronic
918290307 1:183101011-183101033 TGCCTGGTTCTTTCAGAGGGTGG + Intronic
921064952 1:211616244-211616266 CTTCTGGCTCATGCTGAGAGGGG - Intergenic
921213757 1:212920637-212920659 TGCCCGGCTCATCCAGAGGAAGG - Intergenic
921265247 1:213416480-213416502 TGGCTGGATCACGCTGTGGGAGG + Intergenic
922240210 1:223750795-223750817 CTCCTGGCTCATGCGGAAGGGGG + Intronic
922844119 1:228669348-228669370 TGCCTGGGTGATGCTGAGCCTGG + Intergenic
923109096 1:230876787-230876809 TGGCTGGCATGTGCTGAGGGAGG - Intergenic
924450038 1:244169802-244169824 TGCCTCAGTCATGCTGGGGGTGG - Intergenic
924822041 1:247502568-247502590 TATCTGGCTCATGGTAAGGGTGG - Intergenic
1063879296 10:10514536-10514558 TTCCTGGCACTTCCTGAGGGAGG + Intergenic
1065826216 10:29574286-29574308 TGCCTGGGAGAGGCTGAGGGAGG + Intronic
1065951156 10:30652332-30652354 TGCCTGGGAGAGGCTGAGGGAGG - Intergenic
1067332820 10:45337747-45337769 TGCCTGGCAACTGCTCAGGGGGG - Intergenic
1067711656 10:48655658-48655680 TGCGTGGCCCATGCTGCTGGCGG - Intronic
1068021349 10:51589198-51589220 TTGCTGGCTTCTGCTGAGGGAGG + Intronic
1068097026 10:52504207-52504229 TGGCTGCTTCATGCTGAGGAGGG + Intergenic
1068476130 10:57528493-57528515 TGCCTGGCCTATGCTCAGGAGGG + Intergenic
1069932593 10:71892617-71892639 TGCCTGAATCATCCTGAAGGGGG - Intergenic
1069936824 10:71923285-71923307 TGCCTGGCCCGTGCTCAGGAGGG - Intergenic
1070088128 10:73256321-73256343 TGCCTGCCCCATGTTAAGGGTGG - Intronic
1070312436 10:75283514-75283536 GGCCTGCCTCTTCCTGAGGGTGG + Intergenic
1070675854 10:78410735-78410757 GGCCTTGCTCATGCTGTGGGCGG + Intergenic
1071226832 10:83540174-83540196 TGGCTGGCTCCAGCTGGGGGAGG - Intergenic
1071829825 10:89360648-89360670 TGCCTGGCTCATGCCTTGGGAGG - Intronic
1074610638 10:115017705-115017727 TTCCAGGCTGATGCTGATGGTGG - Intergenic
1074910650 10:117905630-117905652 TGTTTGGCTCCTGCTTAGGGAGG - Intergenic
1075015749 10:118908962-118908984 GGCCTGGCCCAGGCTGGGGGAGG + Intergenic
1075624402 10:123951168-123951190 TCCCTGCTTCCTGCTGAGGGGGG - Intergenic
1076600908 10:131656407-131656429 GGGCTGGCTCAGGCTGAGGCAGG - Intergenic
1076726562 10:132416711-132416733 TGCCGGGCTCATGGTGTGGAAGG - Intronic
1078579188 11:12525663-12525685 TGCCTTGCTAATGCTGAGCCAGG - Intronic
1083299336 11:61732139-61732161 TGCCTGGCATGAGCTGAGGGCGG - Intronic
1083363747 11:62129019-62129041 TGCGTGGGCCATGCTGAGAGGGG + Intronic
1083853545 11:65380994-65381016 TGCCTGACACCTGCAGAGGGCGG - Intronic
1085837971 11:79976728-79976750 TGAATGGCTCATGGTGAGTGAGG - Intergenic
1086818689 11:91406595-91406617 TGCCTGGCACCAGCGGAGGGTGG + Intergenic
1087572579 11:99948739-99948761 TGCCTGGCACATTCTAAGTGTGG + Intronic
1088222808 11:107587768-107587790 TGCCTGGATCATTTTGTGGGTGG - Intergenic
1089379302 11:118016135-118016157 CACCTGGCTCATGCTGAGGCTGG - Intergenic
1089599444 11:119604520-119604542 ATGCTGGCTCAGGCTGAGGGTGG + Intergenic
1089682695 11:120128220-120128242 TGCCTGGCTCAGACTGAGAAGGG + Intronic
1089741811 11:120589746-120589768 TGCCTGTCTCCTGTTGAGGCCGG - Intronic
1089911461 11:122105111-122105133 TGTCTGGCTCTGGCTGAGGCAGG + Intergenic
1090211434 11:124923540-124923562 TGCCTGGCTGATGCTGGTGGTGG + Intronic
1090361003 11:126172628-126172650 TGCCAGGCTAATGATGAGAGTGG + Intergenic
1090804842 11:130196473-130196495 TGCCGGGCCCATGCTGCAGGGGG + Intronic
1090807823 11:130213375-130213397 TGCCTGGCTCAGGGTGAGCATGG + Intergenic
1091692633 12:2607377-2607399 ATCGTGGCTCATGCTGAGGTTGG - Intronic
1092168095 12:6355269-6355291 TGCCTTCCTCATGCTGATGGAGG + Exonic
1093493123 12:19726582-19726604 TGTCTGCCTCATGGTGTGGGAGG + Intergenic
1094057446 12:26281465-26281487 TGGTTGGCTCAAGCTGAGGCAGG + Intronic
1095508146 12:42920490-42920512 TGTCTGGCCCATGCTGAGCTGGG - Intergenic
1099896459 12:88654056-88654078 TGGCTGCTTCATGCTGAGGAGGG - Intergenic
1100436786 12:94578468-94578490 TGGCTGTCTCATGCTGATGCAGG + Exonic
1101080208 12:101173852-101173874 TCTCTGGCTCCTGCTGTGGGAGG - Intronic
1102033727 12:109759307-109759329 TGCCTGGCTCACTCTGCGGTAGG + Intronic
1102185076 12:110941476-110941498 GGACTTGCTCATGGTGAGGGGGG + Intergenic
1102509037 12:113402014-113402036 TGTCTGGCTCATTCTGGGAGCGG - Intronic
1104000591 12:124857470-124857492 TGTGTGGCTCTGGCTGAGGGAGG + Intronic
1104354507 12:128073520-128073542 TGCCTAGGACATGCTAAGGGAGG + Intergenic
1104378049 12:128282540-128282562 TGACTGGATCATGAGGAGGGGGG - Intronic
1108193023 13:47962696-47962718 TGGCTGCTTCATGCTGAGGAAGG - Intronic
1109950067 13:69489840-69489862 TGGCTGCTTCATGCTGAGGAGGG - Intergenic
1112807959 13:103183762-103183784 TGGGTGGCTCATGCAAAGGGAGG + Intergenic
1113671814 13:112180812-112180834 TTCGTGGCTCAGGCAGAGGGAGG + Intergenic
1115739611 14:36374184-36374206 TGCCTTGCACATGCTCAGAGAGG - Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1117809607 14:59532750-59532772 TGTTAGGCTCATGCTGAGGATGG + Intronic
1118711246 14:68521313-68521335 TGCCTGGCTCATGAGAAGGGAGG - Intronic
1120671332 14:87365805-87365827 AGTCTGGCTCATGCTAAGAGGGG + Intergenic
1120844830 14:89116525-89116547 TGCCTGGCACAGGCTGGGAGTGG + Intergenic
1120999290 14:90440018-90440040 GGCCTGGCTCAGGCTGAGGAGGG - Intergenic
1121588284 14:95079008-95079030 GGACAGGCTCAGGCTGAGGGTGG + Intergenic
1123776368 15:23584508-23584530 TCTCTGCCTCATGCTGAGGAGGG + Intronic
1124937390 15:34186143-34186165 TGGCTGCTTCATGCTGAGGAGGG + Intronic
1125847268 15:42868564-42868586 TGCCTGTCTCAGGCTGGGTGTGG + Intronic
1126696350 15:51329311-51329333 TGCCTGGCTCCTGCTGAGTCTGG - Intronic
1128544145 15:68556056-68556078 TGCCTGGCTCAGGATAAGGTGGG + Intergenic
1128984655 15:72210601-72210623 TGCATGGATCGTGCTGAGGATGG - Intronic
1130849746 15:87781274-87781296 TGCCTGCCTCATGCTGGGCTAGG - Intergenic
1132621623 16:870590-870612 TGCCTGGGTCAGGCTGGGGTGGG + Intronic
1132923121 16:2410399-2410421 TGGCTGGCTGAGGTTGAGGGTGG - Intergenic
1133807937 16:9139299-9139321 TGCCTTGCTCATGCCCACGGAGG - Intergenic
1134207976 16:12253125-12253147 TGCCTGGCACATGCTGCTGAGGG - Intronic
1136369923 16:29830054-29830076 TGCCTGGCTCCTCCAGAGGGAGG - Intronic
1136626417 16:31464802-31464824 GGCCTGGCTGGTGCTGGGGGTGG + Exonic
1136682993 16:31978750-31978772 TTCCTGGCTTGGGCTGAGGGAGG + Intergenic
1136783633 16:32922306-32922328 TTCCTGGCTTGGGCTGAGGGAGG + Intergenic
1136886157 16:33931500-33931522 TTCCTGGCTTGGGCTGAGGGAGG - Intergenic
1138505952 16:57478372-57478394 TCCCTGGCTCAGCCTGAGTGGGG - Intronic
1139231096 16:65283278-65283300 GGCCTGTCTGGTGCTGAGGGGGG + Intergenic
1141220353 16:82063787-82063809 CTGCTGGCTCAGGCTGAGGGTGG + Intronic
1141727116 16:85796961-85796983 TGCCAGGCCCGTGCTGAGGAGGG - Intronic
1141765037 16:86052459-86052481 AGCCTGGAACATGCTGGGGGAGG + Intergenic
1142219123 16:88844460-88844482 TACCAGGCTCCTGCTGAGGTGGG - Intronic
1203086279 16_KI270728v1_random:1186300-1186322 TTCCTGGCTTGGGCTGAGGGAGG + Intergenic
1143351198 17:6289467-6289489 TGCCTGGCACACGCTTAGTGTGG + Intergenic
1143545486 17:7592789-7592811 CGCCTGGCACTTGCTGGGGGGGG + Exonic
1143563857 17:7709847-7709869 TGCCTGGGTCATGGTCAGAGAGG - Exonic
1143866906 17:9930527-9930549 TACCTGGCTCCTGCTGAAGAAGG - Intronic
1146745433 17:35324461-35324483 TGGCTGCTTCATGCTGAGGAGGG - Intergenic
1147143898 17:38474459-38474481 TTCCTGGCTTGGGCTGAGGGAGG + Intronic
1147790830 17:43013523-43013545 TGCCAGCCTCAGGCTGAGTGAGG + Exonic
1147982363 17:44282447-44282469 TGCCTGGAGCATTCTGAAGGTGG - Intergenic
1148084869 17:44987958-44987980 TGCCTGGCTCATGCTCACGTGGG + Intergenic
1148957303 17:51364479-51364501 TTCCTGTCTCAGGCTAAGGGAGG + Intergenic
1151679193 17:75614839-75614861 TGCCCGACTCACGCTGAGGCCGG - Intergenic
1152366451 17:79859388-79859410 TGCCCAGCTAATGCTGAGGTGGG - Intergenic
1152748844 17:82053255-82053277 TGCCTGGCCCATGTTGCAGGGGG + Exonic
1153329822 18:3862500-3862522 TACTTGGCTGATGGTGAGGGAGG + Intronic
1153488862 18:5628892-5628914 GGCCTGGCTGGTGCTGCGGGAGG - Intronic
1154111246 18:11570276-11570298 TGACTGGCTGTGGCTGAGGGTGG - Intergenic
1154172625 18:12062195-12062217 CACCTGGCTCATGCAGAGGAGGG - Intergenic
1155361862 18:25011082-25011104 TGCTTGGCTAATGCCCAGGGAGG + Intergenic
1156448398 18:37253420-37253442 TGGCAAGCTCAGGCTGAGGGAGG - Intronic
1157617014 18:48992950-48992972 TGCCTGGCCCAGGCTGGTGGAGG - Intergenic
1158963911 18:62607430-62607452 GGGCTGGCTCCTCCTGAGGGCGG + Intergenic
1158975461 18:62707541-62707563 AGCCAGGCTCATGCTCAGGTGGG - Intergenic
1159266128 18:66082058-66082080 TATCTTGCTCATGCAGAGGGAGG - Intergenic
1160200247 18:76789565-76789587 AGCCTGGCTCTTGCTCAGGCTGG - Intergenic
1160308172 18:77760774-77760796 TGCCTGCCTGAAGCTGAGGAAGG + Intergenic
1160855359 19:1214851-1214873 TAGCCGGCTCCTGCTGAGGGAGG + Intronic
1160931828 19:1574466-1574488 TGTGTGTCTCTTGCTGAGGGTGG + Intronic
1161060096 19:2210521-2210543 AGCCTGGCTCCTGCTGCTGGAGG + Intronic
1161228162 19:3157594-3157616 TGCCTGGCTGGGGCTGAGGCGGG - Intronic
1161343772 19:3757254-3757276 TGCCTGGCTAATTTTGGGGGGGG + Intronic
1162020129 19:7864535-7864557 GGCCTGGCTCTGGCTGAGGGTGG - Intronic
1162087655 19:8258191-8258213 TGCCTGGACCATGCAGTGGGAGG + Intronic
1164201010 19:23018570-23018592 TGCCTGGCTCTTGCTCACAGCGG - Intergenic
1164632167 19:29768971-29768993 GGCCGGGCTCCTGCTCAGGGAGG - Intergenic
1164822934 19:31264223-31264245 TGCCTGTCACTGGCTGAGGGTGG - Intergenic
1164834439 19:31348853-31348875 GGCCTGGCTCTTTCTGTGGGTGG - Intronic
1165496226 19:36153356-36153378 TGCGTGGCTCACGATGAGGCCGG - Intergenic
1165631989 19:37309128-37309150 TGTCTGGCACATGCAGTGGGAGG + Intergenic
1202677401 1_KI270711v1_random:20088-20110 TGTCTGGCTCATCCGGAGTGAGG + Intergenic
925835865 2:7946309-7946331 TGCCTGGCTGATGCAGACTGCGG + Intergenic
926146271 2:10398727-10398749 TGCCTTCCTCTTCCTGAGGGAGG + Intronic
927135391 2:20092992-20093014 TGCCTGCCCCAGGCTTAGGGTGG + Intergenic
927147690 2:20177808-20177830 TGCCTGGCTCCTGCTGGAGATGG - Intergenic
927643227 2:24859157-24859179 TGCAAGGCTGATGCTGGGGGTGG + Intronic
927966090 2:27269697-27269719 TGCCTGGCTAATTCTGACTGTGG - Intronic
929561328 2:42958248-42958270 TGCCTGGCACACCATGAGGGCGG - Intergenic
929734202 2:44528231-44528253 TGCCTGGCTCATTCTAAGTTAGG - Intronic
932259586 2:70315815-70315837 TGTGTGGCTCAGGCTCAGGGTGG + Intergenic
932477081 2:72013097-72013119 TGCCTGGCTGATACTGGGGGTGG - Intergenic
932601385 2:73128953-73128975 TGCCTGGGTCATTGTGAGGCTGG - Intronic
933530914 2:83510677-83510699 TGTATGGCTTAGGCTGAGGGTGG - Intergenic
934608160 2:95713662-95713684 TGTCAGCCTCAGGCTGAGGGAGG + Intergenic
936541497 2:113355548-113355570 TGTCAGCCTCAGGCTGAGGGAGG + Intergenic
937525262 2:122760647-122760669 AGCCTGGCTTTTGCTGAGGTAGG - Intergenic
938252382 2:129825965-129825987 TGCCTGCCTCATGCTGGTGTTGG - Intergenic
938399578 2:130978244-130978266 TGGCTGCTTCATGCTGAGGAGGG + Intronic
938945899 2:136211856-136211878 TGACTTCCTCATGCTGTGGGTGG - Intergenic
942251592 2:174051875-174051897 TGCCTGGCCCAAGCTGGGTGGGG + Intergenic
946064620 2:216975848-216975870 TTCCTGGGTTATGCTGAGAGGGG - Intergenic
946170763 2:217893985-217894007 GGCCTGGCTCAGGCTGCGAGAGG + Intronic
947524832 2:230871625-230871647 TGCCTGGCCCATGAGGAGGCCGG - Intronic
948267097 2:236642985-236643007 TGCCTCCCTCCAGCTGAGGGAGG + Intergenic
1171194556 20:23187092-23187114 AGCCTGGCTCTTCCTGAGGGTGG + Intergenic
1172480211 20:35267127-35267149 TGCCTGGGTGATGCTGAGACTGG + Intronic
1172598475 20:36167254-36167276 TGACAGGCTCATGGTGATGGTGG + Intronic
1173000026 20:39098930-39098952 GGCCTGGGTCATGCTGGGGCCGG - Intergenic
1173808452 20:45941245-45941267 AACCTGGCTCATGCTAAAGGTGG - Intronic
1174191917 20:48747013-48747035 TGCATGGCTCCTCCTGGGGGTGG - Intronic
1174274433 20:49393429-49393451 TGCCTGTCTCACTCTGAGGCTGG + Intronic
1174485682 20:50859724-50859746 GGCCTGGCGCAGGTTGAGGGGGG + Intronic
1175261493 20:57677011-57677033 TGGCTGGCGCATGGTGAGCGAGG - Intronic
1175644401 20:60658780-60658802 TGGCTGGCAGCTGCTGAGGGAGG - Intergenic
1175787059 20:61718338-61718360 TTCCTGGATCATGCCAAGGGTGG + Exonic
1176141741 20:63547855-63547877 TGCCTGGGCCTTGCAGAGGGCGG - Intergenic
1176164961 20:63668014-63668036 GGCCGGGCACATGCTGTGGGGGG - Intronic
1176177044 20:63733618-63733640 TGACTCGCTGCTGCTGAGGGAGG + Exonic
1176598831 21:8773532-8773554 TGCGTCGCTCATGCTGGGAGCGG + Intergenic
1178007903 21:28243543-28243565 TGCCCTGCACATGCTGAGGAGGG - Intergenic
1179177507 21:39019699-39019721 TGCCAGGCTGATCCTGAGGGTGG - Intergenic
1179655943 21:42844851-42844873 TGCCAGCCTCATGGTGGGGGCGG - Intronic
1179873892 21:44257816-44257838 TGCCTGGCGCCTTCTGAGGGAGG - Intronic
1180075119 21:45458136-45458158 GGCCTGGCTGAGCCTGAGGGGGG + Intronic
1180202370 21:46232287-46232309 TGTCTGGCTCATGCTGATGATGG - Intergenic
1181903114 22:26171062-26171084 TGCCTGATTTATGCTGAGGGGGG - Intronic
1183704391 22:39468104-39468126 TGCCTTGTTCCAGCTGAGGGCGG + Intronic
1183712156 22:39511372-39511394 TGCCCGGCTGGTGCTGGGGGTGG + Exonic
1184908887 22:47512323-47512345 TTGCTGGCTCAGGCTGAAGGAGG + Intergenic
1185289803 22:50017626-50017648 GGCCTGGACCCTGCTGAGGGAGG + Intronic
1185293554 22:50041188-50041210 TGCCTGTCTCGGGCTGTGGGGGG + Intronic
949976725 3:9467581-9467603 TGGCAGGCACATGCTGAGGTAGG - Intronic
950708963 3:14801794-14801816 TGTGTGGCTCCTGCTGGGGGTGG + Intergenic
950718944 3:14868820-14868842 TGCCTGGCTCATTGTCAGGGAGG + Intronic
950964204 3:17134835-17134857 TGCCTGGTTATGGCTGAGGGAGG + Intergenic
952729859 3:36627396-36627418 TGCTTGGCTCTTGATGGGGGAGG - Intergenic
953213522 3:40897253-40897275 TGCCTGCCTTACACTGAGGGGGG + Intergenic
953365330 3:42339772-42339794 CTCCTGGCTTATGCTGAGGTTGG + Intergenic
953607193 3:44419715-44419737 GGCCTGGCTGCTTCTGAGGGTGG - Intergenic
954717684 3:52534389-52534411 TGCCAGGCCCACGCTGGGGGAGG + Intronic
954755021 3:52834414-52834436 AGCCTGGCCCAGGCTGAGCGAGG - Intronic
956707688 3:72013348-72013370 TGGCTGGAACATGGTGAGGGAGG + Intergenic
958185791 3:90117841-90117863 TGCCTGACACAGGCTGATGGTGG + Intergenic
960230892 3:115226155-115226177 TGCCTGGCTCATAAGGAGTGGGG - Intergenic
961077592 3:123996352-123996374 TGCTTGGATCATGGTGAGGCTGG + Intergenic
961306986 3:125964928-125964950 TGCTTGGATCATGGTGAGGCTGG - Intergenic
961636342 3:128335349-128335371 TGCCTGTCTCTTGCTGGGTGGGG + Intronic
964512846 3:157472046-157472068 AGCCTGGCTCCCGCTGAGGAAGG - Intronic
967195983 3:187026013-187026035 TGCATGGCTCATGGTGGGGAGGG - Intronic
967390066 3:188946960-188946982 TGACAGGATTATGCTGAGGGAGG + Intergenic
968642026 4:1719799-1719821 GGCCTGCCTCATGGAGAGGGTGG - Intronic
969029721 4:4202313-4202335 TGTCTGGCTGATGCTGAGTTGGG + Intronic
969693554 4:8721858-8721880 TGCCTGATTCATATTGAGGGTGG + Intergenic
972304412 4:37818340-37818362 TGATTGGATCATGGTGAGGGGGG + Intergenic
972398183 4:38674828-38674850 TGCCTGCCCCTTCCTGAGGGAGG - Intronic
972594355 4:40516871-40516893 GGGCTGGCCCGTGCTGAGGGAGG - Intronic
974751797 4:66151845-66151867 TGGCTGCTTCATGCTGAGGAGGG - Intergenic
975870762 4:78776328-78776350 TGCCCGGCTCCCGCAGAGGGCGG - Intronic
978016204 4:103749517-103749539 TGCCTGGTTCATGCTAGGGATGG - Intergenic
978385012 4:108169384-108169406 TCCCTGGCTCTGGCAGAGGGAGG + Intergenic
981623342 4:146728990-146729012 TGCCTGGCATTGGCTGAGGGAGG - Intronic
982036554 4:151351958-151351980 TGCTTGGTCCATGGTGAGGGGGG - Intergenic
987183910 5:15396168-15396190 TGCGTCGCTCATGCTGGGAGTGG - Intergenic
988011210 5:25488514-25488536 TGGCTGCTTCATGCTGAGGAGGG + Intergenic
989267185 5:39489466-39489488 AGCCTGTCTCAAGCTGAGGTAGG - Intergenic
991398069 5:66225328-66225350 TGTCTGCCTCAGGGTGAGGGAGG + Intergenic
992104156 5:73436667-73436689 TGCCGGGCTCCGGCTGTGGGCGG - Intergenic
992497829 5:77310501-77310523 TGACAGGCTCATGTTGAGTGTGG - Intronic
993939420 5:94040687-94040709 TGCCTGTGGCATGCTGAGGAAGG - Intronic
997590036 5:135066869-135066891 AGCCTGGCACATGCCGAGGCCGG - Intronic
998737128 5:145155069-145155091 TGGCTGGGTCTTCCTGAGGGTGG - Intergenic
1000039968 5:157478248-157478270 TTGCTGGCTCAGGCTGAGGATGG - Exonic
1000568016 5:162875202-162875224 TGGCTGCTTCATGCTGAGGAGGG + Intergenic
1001462027 5:171924628-171924650 TGCCTGGCACCGGCAGAGGGTGG - Intronic
1002712357 5:181203025-181203047 TCCCTGGCTCTGGCAGAGGGAGG - Intronic
1006188226 6:32192226-32192248 AGCCTTCCTCATCCTGAGGGGGG + Exonic
1006514010 6:34536063-34536085 TGCCTGGCACACCCTGAGGTTGG - Intergenic
1006770111 6:36546422-36546444 TGCCTGGCTAATTCAGAGGCAGG + Intronic
1006985019 6:38170251-38170273 TGCTGGGCTCATGCAGAGGCAGG - Exonic
1007074336 6:39057308-39057330 TGCTTGGCTCTTGCTGGGTGGGG + Intronic
1007358950 6:41341868-41341890 TGTCTGGCTCCTGCAGTGGGAGG - Exonic
1010989850 6:82468590-82468612 TGGCTGCTTCATGCTGAGGAGGG - Intergenic
1012413634 6:98988346-98988368 TGCCAGGCTGATGCTGGGGAGGG + Intergenic
1013077181 6:106781868-106781890 TGGCTGCTTCATGCTGAGGAGGG + Intergenic
1014830735 6:126099958-126099980 TGCCAGGCTCATGCTCAGCCAGG - Intergenic
1015925360 6:138304321-138304343 TGGTTGCCTCAGGCTGAGGGTGG + Intronic
1017945879 6:159095887-159095909 TGCCAGGCTCTTCCTGAGGGCGG + Intergenic
1019738416 7:2661454-2661476 GGTCTGGCTGAGGCTGAGGGAGG - Intronic
1019748735 7:2715440-2715462 TGCCTGGCTCATGCTGAGGGTGG + Exonic
1020094899 7:5362751-5362773 TGGCAGCCACATGCTGAGGGAGG - Exonic
1021791642 7:24211837-24211859 TACCTGGCTGAGGCTGAGTGAGG - Intergenic
1022469292 7:30672256-30672278 TGCCTGGCTCATGCTAGGCTGGG + Intronic
1022943502 7:35260671-35260693 TGCCTGGCACATGCTAAGCGTGG - Intergenic
1023636300 7:42214250-42214272 TGCCTGGCGAATGATGAGGCAGG + Intronic
1024439443 7:49398939-49398961 TGTCTGACTCATGCAGAGGCTGG + Intergenic
1024534180 7:50416499-50416521 TGCCTGGCACAAGGTGAGGGGGG + Intergenic
1025176458 7:56804668-56804690 GGCCTCTCTCATGCTGAGAGAGG + Intergenic
1025178082 7:56811933-56811955 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025178512 7:56813672-56813694 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025178521 7:56813720-56813742 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025178941 7:56815414-56815436 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025178950 7:56815462-56815484 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025178959 7:56815510-56815532 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179379 7:56817204-56817226 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179388 7:56817252-56817274 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179397 7:56817300-56817322 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179406 7:56817348-56817370 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179415 7:56817396-56817418 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179837 7:56819090-56819112 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179846 7:56819138-56819160 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179855 7:56819186-56819208 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025179864 7:56819234-56819256 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025180286 7:56820928-56820950 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025180312 7:56821072-56821094 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025180321 7:56821120-56821142 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025180330 7:56821168-56821190 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025180339 7:56821216-56821238 GGCCTCTCTCACGCTGAGGGAGG - Intergenic
1025180757 7:56822910-56822932 GGCCTCTCTCACGCTGAGGGAGG - Intronic
1025180782 7:56823054-56823076 GGCCTCTCTCACGCTGAGGGAGG - Exonic
1025181209 7:56824805-56824827 GGCCTCTCTCACGCTGAGGGAGG - Intronic
1025181622 7:56826451-56826473 GGCCTCTCTCACGCTGAGGGAGG - Intronic
1025181631 7:56826499-56826521 GGCCTCTCTCACGCTGAGGGAGG - Intronic
1025181640 7:56826547-56826569 GGCCTGTCTCACGCTGAGGGAGG - Intronic
1025181649 7:56826595-56826617 GGCCTCTCTCACGCTGAGGGAGG - Intronic
1025181658 7:56826643-56826665 GGCCTCTCTCACGCTGAGGGAGG - Intronic
1025690270 7:63750400-63750422 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025690279 7:63750448-63750470 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025690290 7:63750496-63750518 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025690299 7:63750544-63750566 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025690717 7:63752223-63752245 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025690728 7:63752271-63752293 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025690739 7:63752319-63752341 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025690748 7:63752367-63752389 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025691168 7:63754046-63754068 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025691177 7:63754094-63754116 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025691188 7:63754142-63754164 GGCCTCTCTCAAGCTGAGGGAGG + Intergenic
1025691589 7:63755774-63755796 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025691598 7:63755822-63755844 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025691609 7:63755870-63755892 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025691620 7:63755918-63755940 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025691629 7:63755966-63755988 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025692033 7:63757597-63757619 GGCCTCTCTCACGCTGAGGGAGG + Exonic
1025692042 7:63757645-63757667 GGCCTCTCTCACGCTGAGGGAGG + Exonic
1025692053 7:63757693-63757715 GGCCTCTCTCACGCTGAGGGAGG + Intronic
1025692064 7:63757741-63757763 GGCCTCTCTCACGCTGAGGGAGG + Intronic
1025692073 7:63757789-63757811 GGCCTCTCTCATGCTGAGGGAGG + Exonic
1025692483 7:63759420-63759442 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025692492 7:63759468-63759490 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025692501 7:63759516-63759538 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025692512 7:63759564-63759586 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025692521 7:63759612-63759634 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025692927 7:63761243-63761265 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693343 7:63762922-63762944 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693352 7:63762970-63762992 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693361 7:63763018-63763040 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693372 7:63763066-63763088 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693381 7:63763114-63763136 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693786 7:63764745-63764767 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693795 7:63764793-63764815 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693805 7:63764841-63764863 TGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693813 7:63764889-63764911 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025693822 7:63764937-63764959 GGCCTCTCTCACGCTGAGGGAGG + Intergenic
1025695333 7:63771718-63771740 GGCCTCTCTCATGCTGAGAGAGG - Intergenic
1026326455 7:69314819-69314841 TGCCTGGCTAATTTTGGGGGTGG + Intergenic
1027266716 7:76498675-76498697 TGCCCTACTCAGGCTGAGGGGGG - Intronic
1027318096 7:76996792-76996814 TGCCCTACTCAGGCTGAGGGGGG - Intergenic
1029172059 7:98637731-98637753 CACCTGGCTAAGGCTGAGGGAGG + Intergenic
1031253512 7:119417887-119417909 TGGCTGCTTCATGCTGAGGAGGG - Intergenic
1033088178 7:138361510-138361532 ATACTGGCTCAGGCTGAGGGTGG - Intergenic
1034342010 7:150363532-150363554 TGCCTGACTCATGATGAGGCCGG + Intergenic
1034491574 7:151395826-151395848 TGCCTGGGACATCCTGAGTGGGG - Exonic
1036544199 8:9750600-9750622 GGCCTGGTTATTGCTGAGGGAGG - Intronic
1037817221 8:22118619-22118641 TGCCTGCCTCATGGGGCGGGGGG + Intronic
1038330498 8:26604499-26604521 TGCCTGCCTCATCTTGAGAGAGG + Intronic
1038537136 8:28361214-28361236 TTCCTGGCTCCTGCTGTGTGGGG - Intronic
1040847486 8:51859086-51859108 CAACTGGCTCGTGCTGAGGGAGG - Intronic
1041234860 8:55790264-55790286 TGCTTGGCTTATGCTCAGGTGGG - Exonic
1041503044 8:58560117-58560139 TGCTGGTTTCATGCTGAGGGAGG - Intronic
1042137291 8:65644675-65644697 AGCCTGGCTCAGGCTTGGGGCGG + Intergenic
1042320583 8:67471108-67471130 TGTCTGGCTAGAGCTGAGGGAGG - Intronic
1043823891 8:84901734-84901756 ATCCTGGCTCAGGCTGAGGATGG + Intronic
1044052455 8:87524277-87524299 TGACTTTCTCATGGTGAGGGAGG - Intronic
1045546914 8:103138150-103138172 TGCCTGGCTAAGGTTGAGTGTGG - Intronic
1045643014 8:104272674-104272696 TGGCTGCTTCATGCTGAGGAGGG + Intergenic
1047331589 8:123893968-123893990 TGGCTGCTTCATGCTGAGGAGGG - Intronic
1047670764 8:127143605-127143627 TGGCTGCTTCATGCTGAGGAGGG + Intergenic
1047839701 8:128737915-128737937 TGCCTGGCTGTGGATGAGGGAGG + Intergenic
1048791936 8:138112359-138112381 GGGCTGCCTTATGCTGAGGGAGG - Intergenic
1049367363 8:142246864-142246886 TGCCTCGCACATTCTCAGGGTGG - Intronic
1049488415 8:142878443-142878465 TTCCTGGCCCGTGCAGAGGGTGG - Intronic
1053174632 9:35913008-35913030 AGCCTGTCTCCTGCAGAGGGAGG - Intergenic
1053414768 9:37940215-37940237 TGCCAGTCTAATGTTGAGGGTGG + Intronic
1056874397 9:90313993-90314015 TGACTGGCTCATGGGGAGTGGGG + Intergenic
1057929504 9:99181332-99181354 TCAGTGCCTCATGCTGAGGGTGG + Intergenic
1060204598 9:121675077-121675099 TGCCTGGCTCTGGGTGGGGGTGG + Intronic
1060592921 9:124830620-124830642 TGCCAGGCCCATCCTGAGTGTGG + Intergenic
1060776681 9:126379808-126379830 TGCCTGTCACAGGCTCAGGGCGG - Intronic
1061267234 9:129514005-129514027 TGCCTGCTTCATGCAGTGGGAGG - Intergenic
1061924451 9:133799064-133799086 AGCCTGGCTTCTGCGGAGGGTGG + Intronic
1062596411 9:137301917-137301939 GGCCTGGCTCATGCTGCCGCCGG + Exonic
1062617764 9:137405744-137405766 AGCCAGGCTCATGCTGAGTCAGG - Intronic
1185990528 X:4889928-4889950 TGGCTGGGTCTTCCTGAGGGTGG - Intergenic
1186953853 X:14658467-14658489 TGCATTGCTTATGATGAGGGAGG - Intronic
1187000080 X:15167654-15167676 TGACTGGCTTATGCTGGAGGAGG - Intergenic
1188858751 X:35230676-35230698 TGGCTGCTTCATGCTGAGGGAGG - Intergenic
1190049572 X:47139842-47139864 TGGCTGGGCCATGATGAGGGAGG + Intergenic
1190157895 X:48008381-48008403 TGCATGGCTCATTATGAGAGTGG + Exonic
1190173667 X:48131266-48131288 TGCATGGCTCATTATGAGAGTGG + Exonic
1190325577 X:49205072-49205094 TGCCTGCCTCCTGCTGGGGAGGG + Exonic
1190444968 X:50515028-50515050 TGCCTGGCTCATGGAGCGGGAGG + Intergenic
1190741054 X:53289040-53289062 GGCCTGGGTCATGCCAAGGGTGG + Intronic
1192051672 X:67729957-67729979 TGCGTGGGTCATTCTGATGGTGG - Exonic
1192796421 X:74427313-74427335 TGCCTGGATCCTGCTGTGGTGGG + Intronic
1195553656 X:106197025-106197047 TGCTAGGCTCATGGTGAGGTAGG + Intronic
1195945059 X:110200809-110200831 TGGCAGGGTCATACTGAGGGTGG - Intronic
1196933028 X:120700156-120700178 TTCCTGGCTCAGGCTTAGGAGGG - Intergenic
1198720328 X:139611213-139611235 TCACTGGCTCCTGCTGAGGAGGG - Intronic
1198999423 X:142616649-142616671 ATGCTGGCTCAGGCTGAGGGAGG + Intergenic