ID: 1019748820

View in Genome Browser
Species Human (GRCh38)
Location 7:2716186-2716208
Sequence TCACAGCCATGCTATGATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019748817_1019748820 10 Left 1019748817 7:2716153-2716175 CCTTCTGAAGTGGCTAGAATACA 0: 1
1: 0
2: 1
3: 13
4: 177
Right 1019748820 7:2716186-2716208 TCACAGCCATGCTATGATGAAGG 0: 1
1: 0
2: 2
3: 16
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019748820 Original CRISPR TCACAGCCATGCTATGATGA AGG Exonic