ID: 1019748887

View in Genome Browser
Species Human (GRCh38)
Location 7:2716565-2716587
Sequence CCTCCCCCTTTGAACTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019748887_1019748894 12 Left 1019748887 7:2716565-2716587 CCCACCAAGTTCAAAGGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1019748894 7:2716600-2716622 AGGGACACACCTACACGCAGAGG 0: 1
1: 0
2: 2
3: 23
4: 190
1019748887_1019748891 -8 Left 1019748887 7:2716565-2716587 CCCACCAAGTTCAAAGGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1019748891 7:2716580-2716602 GGGGGAGGCTAGAACATTCCAGG 0: 1
1: 0
2: 0
3: 24
4: 183
1019748887_1019748892 -7 Left 1019748887 7:2716565-2716587 CCCACCAAGTTCAAAGGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1019748892 7:2716581-2716603 GGGGAGGCTAGAACATTCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 126
1019748887_1019748895 13 Left 1019748887 7:2716565-2716587 CCCACCAAGTTCAAAGGGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1019748895 7:2716601-2716623 GGGACACACCTACACGCAGAGGG 0: 1
1: 0
2: 0
3: 19
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019748887 Original CRISPR CCTCCCCCTTTGAACTTGGT GGG (reversed) Intronic
900479775 1:2892361-2892383 CCTCCGACTTTGATCTTGATGGG + Intergenic
900590043 1:3455359-3455381 CCCCCACCCTTGACCTTGGTGGG + Intronic
901056318 1:6450161-6450183 CCTCCACCTTGGCACTGGGTTGG - Intronic
902478031 1:16698329-16698351 CCTCCACCTTGGCACTGGGTTGG + Intergenic
903117843 1:21192728-21192750 CAGCCGCTTTTGAACTTGGTGGG - Intergenic
905799129 1:40832244-40832266 GCTCCCCCTTTGGCCTTGGAGGG + Intronic
909197650 1:72648345-72648367 CCACCCCCTTCCAAGTTGGTGGG + Intergenic
909938797 1:81586800-81586822 TCTCCCTCTTTGAAGGTGGTAGG - Intronic
912563362 1:110566149-110566171 CCTCCCCCTCTGATATTGGTTGG - Intergenic
912761765 1:112373687-112373709 CCTCACCCTTTGATCTGGTTTGG - Intergenic
915162893 1:153932440-153932462 CCTCCCCCTTTGTGCCTGATAGG - Exonic
916317842 1:163470393-163470415 TCTCCCCATTTGAACTTGAGGGG + Intergenic
916849060 1:168684194-168684216 CCTCCCCCTGGGAACTCTGTAGG + Intergenic
916855161 1:168741660-168741682 CCTCCACATTTTAACTTGGATGG + Intergenic
923391236 1:233515675-233515697 CCTGCCCCTTTCTAGTTGGTGGG + Intergenic
923465633 1:234245958-234245980 CCTCCCCCTTGAAACTGGGCAGG - Intronic
1064244791 10:13659790-13659812 CACCCCCCTTGGAGCTTGGTAGG + Intronic
1065712152 10:28529138-28529160 CTTCCCCCTTAGTACTTGCTTGG - Intergenic
1067566430 10:47341058-47341080 CCTCCCCCTTTCTATTTGCTGGG - Intergenic
1069160414 10:65084926-65084948 GCTCCCCCTGCCAACTTGGTAGG + Intergenic
1069313085 10:67063519-67063541 CCTCCCCATTTAAACCTGGTAGG - Intronic
1070955191 10:80459198-80459220 CCTCCGCCCTTGGGCTTGGTGGG + Intronic
1072812319 10:98471656-98471678 CCTCCCGCTTGTACCTTGGTGGG + Intronic
1074248211 10:111714918-111714940 CTTCACCATTTGAACCTGGTGGG - Intergenic
1074951517 10:118341994-118342016 CCTCTCACTTTGACCTGGGTGGG + Intronic
1076031961 10:127166913-127166935 CCTCAGCCTTTTAAGTTGGTAGG - Intronic
1077295933 11:1826348-1826370 CCGCCCCCTTTCTACTTGCTCGG - Intergenic
1080613476 11:33925637-33925659 CCTCCCCCTTGAAACTGGGCAGG + Intergenic
1084681649 11:70669906-70669928 ATTCCGCCTTTGAACTTGTTTGG - Intronic
1086075836 11:82851254-82851276 CCACTCCCTTTGAACTTGGATGG + Intronic
1086301512 11:85431513-85431535 CCTTCCCCTGGGAACTTGGCAGG - Intronic
1088251486 11:107864981-107865003 CCTCGCCCTTTGAAAGTGCTGGG - Intronic
1088608554 11:111555121-111555143 CATCCCAATTTGAACATGGTAGG + Intronic
1089131238 11:116213876-116213898 CCTCCCACTTTACACTGGGTTGG - Intergenic
1089929223 11:122292877-122292899 CATCTCCATCTGAACTTGGTTGG + Intergenic
1091541488 12:1466446-1466468 CTTCCACCTATGAATTTGGTGGG + Intronic
1092548105 12:9469086-9469108 CCTGCCCCTGTGAACTTGAATGG + Intergenic
1094054508 12:26255824-26255846 CCTTCCCCTGGGAATTTGGTAGG - Intronic
1094504893 12:31053361-31053383 CCTGCCCCTGTGAACTTGAATGG - Intergenic
1094574252 12:31669588-31669610 CCTCACCCTGAGAACCTGGTAGG + Exonic
1094799461 12:34016370-34016392 CCTCCCGCTATGAACCTGGCTGG - Intergenic
1095112250 12:38310637-38310659 CCTCCCGCTATGAACCTGGCTGG - Intergenic
1095173851 12:39067329-39067351 CCTCACCCCTTGAATTTGGGTGG - Intergenic
1095243700 12:39892282-39892304 CCTCACCCTTTCAGCTTGTTTGG + Intronic
1097078683 12:56413505-56413527 CCGCCCCCTTTCAAGTTGGCGGG - Intergenic
1100211001 12:92398727-92398749 CTACCCTCTTTGAACTTGATGGG - Intergenic
1101288543 12:103342206-103342228 CCTCAACCTTTTAACTTGATGGG + Intronic
1102996758 12:117357334-117357356 CCTCCCACCTTGACCTTGCTGGG - Intronic
1103855964 12:123972127-123972149 CCTCCCCCTTGGCACTGGGGTGG + Intronic
1104433205 12:128733516-128733538 TCTCCTCCCTTGAACTTGGGTGG - Intergenic
1105741612 13:23330551-23330573 CCTCCCACTTTCAAGTCGGTTGG - Exonic
1106174761 13:27320744-27320766 CCTCTCCCCTTGAACCTGGTTGG - Intergenic
1110783049 13:79489450-79489472 CTTCTCCCTTTGAATTTGGGGGG - Intronic
1110790546 13:79582208-79582230 CCTCCCACTGGGAACTTGGCAGG + Intergenic
1111742571 13:92222238-92222260 CTTCCCCTTTTTAACCTGGTGGG - Intronic
1118530629 14:66701764-66701786 CCTCCCCCCAGGAGCTTGGTAGG - Intronic
1119031526 14:71196582-71196604 CCACCTCCTTTGAAGGTGGTTGG - Intergenic
1119618082 14:76111891-76111913 CCTGCCCCTTCCAAGTTGGTGGG + Intergenic
1123920240 15:25065005-25065027 CCTGCCTCTTTGAATGTGGTTGG + Intergenic
1130091499 15:80824785-80824807 CCCACCTCTTTGAACTAGGTAGG + Intronic
1130427477 15:83815867-83815889 CACCACCCTTTGAACTAGGTAGG - Intronic
1130922146 15:88356694-88356716 CCTTCCCCCTTGAACCTGGGTGG - Intergenic
1131361188 15:91792079-91792101 CCATCCCCTTTGCACTTGTTGGG + Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1139112614 16:63909516-63909538 CCTCCTCCTTATCACTTGGTTGG + Intergenic
1139126417 16:64083484-64083506 CCACCCCCTTTGAAGTTAGGTGG + Intergenic
1139368192 16:66446772-66446794 CCTCCCCCAATGCACTTGGCTGG - Intronic
1141136535 16:81469140-81469162 CCTCAACCTTTGACGTTGGTGGG + Intronic
1147974801 17:44240742-44240764 CCTCAGCCTTTGGACTTGTTAGG + Intergenic
1151395481 17:73820017-73820039 CCTGCCCCTTCCAAGTTGGTGGG - Intergenic
1152081051 17:78187288-78187310 TCCGCCCCTTTAAACTTGGTGGG - Intergenic
1152771712 17:82173851-82173873 CCTCTCCCTAGGAACTGGGTGGG - Intronic
1153428087 18:4988060-4988082 CCTCCTCCTTCCAAGTTGGTGGG - Intergenic
1154234967 18:12596504-12596526 CATCCCCCTTTCAACTTTGTGGG - Intronic
1155847755 18:30731049-30731071 CCTCCCCCTGGGAACTCGGCAGG - Intergenic
1156664532 18:39389885-39389907 CCTCCCCCTGGGAGCTTGGTAGG - Intergenic
1160083689 18:75754288-75754310 CCTCCCCCATCCAAGTTGGTGGG - Intergenic
1161439247 19:4280958-4280980 CCTTCCTCTTGGAACCTGGTGGG + Intronic
1161912536 19:7205306-7205328 CAGCCCCCTGTGAACTTGATTGG - Intronic
1164835529 19:31352875-31352897 CCTCCCCCTAAGAACTTAATGGG + Intergenic
1165287038 19:34851129-34851151 CCTACCCCTTTTGACTTTGTAGG - Intergenic
1165481421 19:36066854-36066876 TCTCCCCCTCTGAGCCTGGTAGG + Intronic
1166615629 19:44242468-44242490 CCTCCCCCTTTTAAGTTGTGAGG + Intronic
1166897294 19:46032184-46032206 CCTGCCCCTTCCAAGTTGGTGGG + Intergenic
1202712051 1_KI270714v1_random:24156-24178 CCTCCACCTTGGCACTGGGTTGG + Intergenic
929582681 2:43092918-43092940 CCCCTCCCTTTGAACCTGGGTGG - Intergenic
931228048 2:60351118-60351140 CCTCAGCCTTTCAACTTGGTGGG + Intergenic
932114336 2:69032520-69032542 CATCCCCCTTTGATCTTTCTGGG + Intronic
933541404 2:83647659-83647681 CTTCCCCCTTTGTACTTGACTGG - Intergenic
934770972 2:96907446-96907468 CCTCCTCCTCTGAACCTGGTTGG - Intronic
934956138 2:98621596-98621618 CCTCCCACTTTGAGCATGGGTGG - Exonic
938096559 2:128467682-128467704 CCTGCCCCTTACAAGTTGGTGGG - Intergenic
938732687 2:134158648-134158670 CCTCCCCCTTCCGAATTGGTGGG - Intronic
939230385 2:139417326-139417348 CCTCACTCTGAGAACTTGGTAGG + Intergenic
940912013 2:159217367-159217389 CCTCCCCCTTTGAACCTGCGGGG - Intronic
946254111 2:218430748-218430770 CCTCCACCTGTGTGCTTGGTGGG - Exonic
947327445 2:228993209-228993231 CCTGCCCCTTCCAAGTTGGTGGG - Intronic
1169224236 20:3846509-3846531 CCTCCCCCTGGGAACTTTGAGGG - Intergenic
1169695818 20:8385548-8385570 CCTCCCCCTGGGAACTTGGCAGG + Intronic
1172346884 20:34209234-34209256 CCTACCCCTTCCAAGTTGGTGGG + Intronic
1177511425 21:22092062-22092084 CCTCCCCCTGGGAGATTGGTAGG + Intergenic
1181162868 22:20968044-20968066 CCTCCCCCTCTGCACTCGGTAGG + Intronic
953801907 3:46031093-46031115 CCTGCCCCTTAGAAGTTGGTGGG + Intergenic
953809825 3:46102620-46102642 CCTCACCTCTTGAACTTGGGCGG - Intergenic
954857677 3:53660622-53660644 CCTGCCCCTCTGAAAGTGGTGGG + Intronic
955753369 3:62204368-62204390 CCTTCCCCTTTAAACTTTTTAGG - Intronic
955972183 3:64446395-64446417 CCTCCCCCTCTGAAAGTGTTGGG - Intergenic
956462477 3:69485570-69485592 CCTACCCCTTCCAAGTTGGTGGG - Intronic
957434177 3:80152295-80152317 CCTCCTCCTGGGAGCTTGGTAGG + Intergenic
963250072 3:143095263-143095285 CTGCCCCCTTTCAAGTTGGTGGG + Intergenic
965061445 3:163789112-163789134 CCTCCCCATATCAAGTTGGTGGG - Intergenic
965263277 3:166510539-166510561 CCTCCCCCTAGGAGTTTGGTAGG - Intergenic
965793247 3:172411544-172411566 CCTGCCCCTTCCAAGTTGGTGGG - Intergenic
965813526 3:172614827-172614849 CCCGCCCCTTTGGAATTGGTGGG - Intergenic
973197541 4:47463162-47463184 CCTCCCCCCTTGAGGGTGGTTGG - Intronic
974023314 4:56711072-56711094 CCACCCCCTTTTGAGTTGGTGGG + Intergenic
976758248 4:88521600-88521622 CTTCCACCTTTGGACTTGGATGG - Exonic
977157156 4:93588911-93588933 CATGCCCCATTGAACTTGATGGG - Intronic
979775393 4:124583183-124583205 CCTCCCCCTGCGAGTTTGGTAGG - Intergenic
982183786 4:152775857-152775879 CCTCTCCCTGTGAACATGATGGG - Intronic
983435675 4:167711837-167711859 CCTTCTCCTTAAAACTTGGTGGG + Intergenic
983972316 4:173890155-173890177 CCTCCTCCAGGGAACTTGGTAGG + Intergenic
984299275 4:177894202-177894224 CCTCTCCCCTTGAATTTGGGTGG - Intronic
986168762 5:5298382-5298404 CTTCTACCTTTGAACTTGCTTGG + Intronic
986589783 5:9356541-9356563 CAAGTCCCTTTGAACTTGGTGGG - Intronic
987453825 5:18119359-18119381 CCTCCCCCTAGGAGTTTGGTAGG - Intergenic
988589072 5:32533295-32533317 CCTCCCCCTCTTTTCTTGGTTGG + Intronic
989279294 5:39622366-39622388 CCTGTCCCTTCCAACTTGGTGGG - Intergenic
989348268 5:40453939-40453961 TCTCCCCCTGGGAACTTGGCAGG + Intergenic
989436148 5:41416066-41416088 TCTCCCTCTTTGAGCTTGTTTGG - Intronic
990639059 5:57761879-57761901 CCTGCCCCTTCTAAGTTGGTGGG + Intergenic
998788771 5:145743796-145743818 CCTCCCCCTGGGAGCTGGGTAGG - Intronic
1000157033 5:158562441-158562463 ACTTCCCTTTTGAATTTGGTGGG - Intergenic
1000829435 5:166084783-166084805 AGTCTCCCTTTGAAGTTGGTTGG + Intergenic
1001355957 5:171022814-171022836 CCTCCCCCTGGGAGCTTGGTAGG + Intronic
1004293163 6:14386781-14386803 CTTCCTCCTTTCAACTTGCTGGG + Intergenic
1004548952 6:16627817-16627839 CCTCCCCCTTAGAGCTGGGGTGG - Intronic
1006433262 6:34011420-34011442 CCTCCCCCTGTGTACTAAGTGGG - Intergenic
1009663894 6:66651495-66651517 CCTACCACTTTGGTCTTGGTGGG + Intergenic
1010411646 6:75568269-75568291 CATCCCCCTGGGAACTTGGCAGG - Intergenic
1015545419 6:134356520-134356542 CCTAACCCTTTTAACTTGGGAGG + Intergenic
1018808811 6:167282378-167282400 CCTCCCCCACAGACCTTGGTGGG - Intronic
1019748887 7:2716565-2716587 CCTCCCCCTTTGAACTTGGTGGG - Intronic
1020684363 7:11275027-11275049 TCGCCCCCATGGAACTTGGTGGG - Intergenic
1021074814 7:16289136-16289158 CCTCCTCTTTCGATCTTGGTAGG - Intronic
1026082432 7:67233918-67233940 CCTCAACCTATGAACTTGGGAGG - Intronic
1026694637 7:72580075-72580097 CCTCAACCTATGAACTTGGGAGG + Intronic
1026765040 7:73155041-73155063 GCTCCCCCTTGCAACTTGGCGGG + Intergenic
1027041513 7:74964796-74964818 GCTCCCCCTTGCAACTTGGCGGG + Exonic
1027082129 7:75237573-75237595 GCTCCCCCTTGCAACTTGGCGGG - Intergenic
1030037225 7:105418220-105418242 CCTCGGCCTCTGAACTTGTTGGG - Intergenic
1041349263 8:56932197-56932219 CTTCCTCCTTTGAACTTTGTTGG - Intergenic
1041421292 8:57669765-57669787 CCCCTCCCCTTGAACCTGGTGGG + Intergenic
1044888445 8:96805866-96805888 CCTCCACCATAGAACTTGGTAGG + Intronic
1045376285 8:101577810-101577832 CCTCCCCGTTTGAGCCTAGTAGG + Intronic
1048730707 8:137437649-137437671 CCTCCCCCTTTCTACTTGTCTGG + Intergenic
1049392964 8:142381480-142381502 CCTCCACCCTTGTGCTTGGTGGG - Intronic
1052137449 9:24931361-24931383 CCTCTCCCTTTAAATGTGGTAGG + Intergenic
1054707973 9:68482281-68482303 CCTGCCCCTTTCTCCTTGGTTGG + Intronic
1055818806 9:80238102-80238124 CCTCCCCCTGAGAACTCAGTAGG - Intergenic
1056900440 9:90594395-90594417 CCTCCCTCTAGGAACATGGTGGG + Intergenic
1058510586 9:105713069-105713091 CCTGCCCCTTCCAAGTTGGTGGG + Intronic
1059147223 9:111910995-111911017 CCTCCACCTTTGAAAGTGCTGGG + Intronic
1062368400 9:136223140-136223162 CCTCCTCCTTGCAACTTGATAGG - Intronic
1189289354 X:39874294-39874316 CCTCTCCCCTTGAACCTGGGTGG + Intergenic
1190097372 X:47492473-47492495 CCTCGGCCTTTGAAATTGCTGGG + Intergenic
1192219294 X:69186252-69186274 CCTCCACCCTTGACCTTTGTTGG - Intergenic
1194205157 X:91003014-91003036 CCTACCCCTTTTCAGTTGGTGGG - Intergenic
1198125271 X:133637472-133637494 GCTCTCCCTTTGAATCTGGTTGG - Intronic
1198570097 X:137945712-137945734 CACCCCACTTTGAACTTTGTGGG - Intergenic
1199572666 X:149283373-149283395 CCTCCACCTTTTAATTTTGTGGG + Intergenic
1200368668 X:155697317-155697339 CCTCTGCCTTTGAATTTGGACGG + Intergenic
1200550976 Y:4578135-4578157 CCTACCCCTTTTCAGTTGGTGGG - Intergenic
1202070350 Y:20985645-20985667 CCTCCCCCTGTGAACTTGGCAGG + Intergenic