ID: 1019750968

View in Genome Browser
Species Human (GRCh38)
Location 7:2729565-2729587
Sequence ATGCAGAAGCAGAAGAGGGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 856
Summary {0: 1, 1: 0, 2: 7, 3: 73, 4: 775}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019750968_1019750981 25 Left 1019750968 7:2729565-2729587 CCCTCCCTCTTCTGCTTCTGCAT 0: 1
1: 0
2: 7
3: 73
4: 775
Right 1019750981 7:2729613-2729635 GGTTTGCGGAAAACAAGCCAAGG 0: 1
1: 0
2: 0
3: 3
4: 119
1019750968_1019750982 26 Left 1019750968 7:2729565-2729587 CCCTCCCTCTTCTGCTTCTGCAT 0: 1
1: 0
2: 7
3: 73
4: 775
Right 1019750982 7:2729614-2729636 GTTTGCGGAAAACAAGCCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 169
1019750968_1019750977 4 Left 1019750968 7:2729565-2729587 CCCTCCCTCTTCTGCTTCTGCAT 0: 1
1: 0
2: 7
3: 73
4: 775
Right 1019750977 7:2729592-2729614 CCCAAGGGCTTGCGTTTACCGGG 0: 1
1: 0
2: 0
3: 4
4: 53
1019750968_1019750975 3 Left 1019750968 7:2729565-2729587 CCCTCCCTCTTCTGCTTCTGCAT 0: 1
1: 0
2: 7
3: 73
4: 775
Right 1019750975 7:2729591-2729613 CCCCAAGGGCTTGCGTTTACCGG 0: 1
1: 0
2: 0
3: 11
4: 337
1019750968_1019750979 11 Left 1019750968 7:2729565-2729587 CCCTCCCTCTTCTGCTTCTGCAT 0: 1
1: 0
2: 7
3: 73
4: 775
Right 1019750979 7:2729599-2729621 GCTTGCGTTTACCGGGTTTGCGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019750968 Original CRISPR ATGCAGAAGCAGAAGAGGGA GGG (reversed) Exonic
900228281 1:1543060-1543082 AGGCAGAGGCAGAGGCGGGACGG + Intronic
900566143 1:3332817-3332839 ATCCAGAGGCCGAACAGGGATGG - Intronic
900899944 1:5509567-5509589 CTCCAGAAGCAAAAGAGGGCAGG - Intergenic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901835695 1:11922730-11922752 ACGCTGAACCAGAAGAGGAAGGG + Exonic
902726702 1:18340959-18340981 AAGAAGAAGGAGAAGAAGGAGGG - Intronic
902808076 1:18873090-18873112 ATGCAGAAGAGCCAGAGGGATGG + Intronic
903559227 1:24215511-24215533 AAGCAGAAGGAGAGGAGGGCAGG + Intergenic
904378872 1:30097874-30097896 ATACAGAAGAAGAAGAGAGGAGG + Intergenic
904802563 1:33104805-33104827 ATTCAGAAGCTGGAGTGGGAAGG - Intronic
904948954 1:34220524-34220546 ATACAAAAGCAGAAATGGGATGG + Intergenic
904955854 1:34283378-34283400 AAGCAGGAGCAGCAGAGGAAGGG - Intergenic
905349689 1:37336874-37336896 TTGAAGAGGCAGAAGTGGGAGGG + Intergenic
906280407 1:44549598-44549620 ATGGGGAAGCAGAACTGGGAGGG - Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906545172 1:46615298-46615320 ATGCAGAGGCAAAAGAGTGGGGG - Intronic
906727746 1:48056045-48056067 AGGTGGAGGCAGAAGAGGGAGGG - Intergenic
906900944 1:49835900-49835922 AGCCAGAACCAGAAGAGGGTGGG - Intronic
906994254 1:50773315-50773337 CTGCAGACTCAGAAGTGGGATGG - Intronic
907286145 1:53381064-53381086 GGGAAGAAGTAGAAGAGGGAAGG - Intergenic
907797699 1:57733875-57733897 AAGAAGAAGCAGCACAGGGAAGG + Intronic
907826473 1:58021896-58021918 GTTCAGAAGCAGAAGGGGGTTGG + Intronic
908141225 1:61187370-61187392 TTGGAGAAGCAGCTGAGGGATGG - Intronic
908267634 1:62394883-62394905 CTGCAGAACCACCAGAGGGAAGG - Intergenic
908406656 1:63820829-63820851 ATGGAGAAACAGATGAGGAATGG + Intronic
908466711 1:64403099-64403121 CTGCGGAGGCAGAAGATGGAGGG + Intergenic
908675559 1:66599558-66599580 ATTCAGACTCAGAAGAGAGAAGG - Intronic
908801683 1:67887160-67887182 ATGCAGAAGCAAGAAAGGAAAGG - Intergenic
908892116 1:68860041-68860063 ATGCGGAACCAGAAGGGCGATGG + Intergenic
910149480 1:84125254-84125276 ATGTAGAAGCACCAGAGAGAGGG - Intronic
910593552 1:88953885-88953907 AAGAAGAAGAAGAAGAAGGAGGG - Intronic
910666808 1:89734467-89734489 ATGCAGAAGGAAGAGAGGGAGGG + Intronic
911281340 1:95933246-95933268 ACGCAGAAGCTGAAGAGGCCAGG + Intergenic
911580214 1:99625427-99625449 ATGCAAAAACAGAACAGGGTAGG + Intergenic
911591260 1:99750756-99750778 TTCCAGAAGGAGAAGAGGGAAGG + Intronic
912326518 1:108768518-108768540 ATACAGAATCAGAAGAGTGCAGG + Intronic
912565776 1:110586177-110586199 CTGCAGGAGCAGAAGAAGCAAGG - Intergenic
912861444 1:113217404-113217426 CTGCAGAAGCAGAAGAAAGCTGG - Intergenic
912883015 1:113437736-113437758 ATGAAGAAGAAGAAGAGGAAAGG - Intronic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
914998439 1:152565232-152565254 AAGCAGAATCAAAAGATGGAGGG - Intronic
915140791 1:153767391-153767413 AGTCAGGAACAGAAGAGGGAGGG - Intronic
915712174 1:157910661-157910683 ATGCAAGAGCAGCAGAGGCATGG + Intergenic
915733542 1:158070633-158070655 ATGCAGTAAGAGAAGAGGGAGGG + Intronic
915920000 1:159969048-159969070 AAGAAGAAGAAGAAGAGGTAGGG + Intergenic
915970243 1:160349833-160349855 AAGGGGAAGCAGGAGAGGGAAGG - Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916016653 1:160755665-160755687 AGGAAGGAGCTGAAGAGGGAGGG + Intergenic
917105921 1:171491960-171491982 TTGAAGAAGCACAATAGGGAAGG + Intronic
917628165 1:176866519-176866541 AGGGAGTGGCAGAAGAGGGAGGG + Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918199559 1:182254518-182254540 CTGCAGAACCAGAAGAGGAAAGG + Intergenic
919086960 1:192931989-192932011 CTGCAGAAGCTGAAAAGGCAAGG - Intergenic
920106811 1:203559213-203559235 ATATAGAAGTAGAAGAAGGAGGG + Intergenic
920113776 1:203605185-203605207 ATGCAGGAGCAGAGAAGGCAGGG - Intergenic
920185718 1:204158073-204158095 ATCCAGAAGCAGAAGAGGAAGGG - Intronic
920373505 1:205493977-205493999 GAGCAGAAGCAGAGGAGAGAGGG - Intergenic
920517438 1:206596608-206596630 ATGCAGAAGCAAAAGAAGGCTGG - Intronic
920968570 1:210722549-210722571 AGGCAGGAGCAGTAGAGGGCAGG - Intronic
921333544 1:214064228-214064250 ATGCAGAAGTGACAGAGGGAGGG + Intergenic
921403533 1:214753476-214753498 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
921539153 1:216391864-216391886 ATGCACAGACAAAAGAGGGATGG - Intronic
922279641 1:224111530-224111552 CTGCAGGAGAAGAAGAGAGATGG + Intergenic
922317813 1:224458088-224458110 ATGCAAAATCAGGAGAGGGTAGG - Intronic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
923246111 1:232134083-232134105 TTGCAGAATCAGAAGAGGACTGG + Intergenic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923549841 1:234954810-234954832 TGGCAGAAGAACAAGAGGGATGG + Intergenic
924024260 1:239816487-239816509 AGGCACAGGCAGAAGAGGGAGGG + Intronic
924431664 1:244002378-244002400 ATGCAGTAGCATAATAGGGCTGG - Intergenic
924680363 1:246224879-246224901 AAACAGAAGCAGAAAAAGGAAGG + Intronic
924683043 1:246257869-246257891 AGGCAGAAGCAGGAGAGGGAAGG - Intronic
1062952748 10:1516946-1516968 CTGAAGTAGCAGAAAAGGGATGG + Intronic
1064039603 10:11948426-11948448 ATGAAGAAGAAGAAGAAGGTGGG - Exonic
1064686513 10:17867315-17867337 AGGAAGAAGAAGAAGAAGGAAGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1066105385 10:32151914-32151936 ATGCTGTAATAGAAGAGGGAAGG - Intergenic
1066169710 10:32828413-32828435 AAGGAGAAGAAGAAGAAGGAAGG + Intronic
1066260437 10:33724574-33724596 CTCCAGAAACAGAAAAGGGATGG - Intergenic
1066467050 10:35661416-35661438 AGGAAGAAGCAGAGGAGAGACGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1067561745 10:47309445-47309467 ATGCAGAGGCAGTAGAGGGCAGG + Intronic
1068318268 10:55376133-55376155 ATGCAGATGAAGAACAGGAAAGG - Intronic
1068553280 10:58429594-58429616 ATGGAGACTCAGAAGAGTGAAGG - Intergenic
1068787215 10:60989696-60989718 GTGCTGAAGCAGAAGCAGGAAGG + Intronic
1068835206 10:61545319-61545341 AAGCAGATGAAGAAGAGGAAGGG + Intergenic
1068947251 10:62741909-62741931 ATATGGAGGCAGAAGAGGGAGGG - Intergenic
1069067554 10:63959509-63959531 ATACAGATTCAGAAGGGGGAGGG + Intergenic
1069292963 10:66806145-66806167 ATAAAGAAGCAAAAGAGAGAAGG + Intronic
1069357776 10:67607470-67607492 ATGAAGAAGAAGAGGAGGGTTGG + Intronic
1069580336 10:69561584-69561606 ATGCAAGAGCAGAAGAAGGGGGG + Intergenic
1070915091 10:80148371-80148393 AAGCGGAAGCAAGAGAGGGAAGG + Intergenic
1071016935 10:81008503-81008525 ATGCAGCAGCTGAAAAGTGAAGG + Intergenic
1071110774 10:82152766-82152788 AAGGAGAAGGAGAAGAAGGAAGG - Intronic
1071899875 10:90108702-90108724 ATGGAGAAAGAGCAGAGGGATGG + Intergenic
1072255550 10:93617057-93617079 AAGCAGAAGTAGAGGAGGAAAGG - Intronic
1072801414 10:98394798-98394820 GTGGAGAGGTAGAAGAGGGAAGG + Intronic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1073103553 10:101019523-101019545 AGGCAGAAGCAGAAGCAGAAGGG - Intronic
1073272703 10:102279602-102279624 ATACAGAAAAATAAGAGGGAAGG - Intronic
1073849913 10:107602900-107602922 ATGAAGAAGAACAAGAGGAAGGG - Intergenic
1074100248 10:110349016-110349038 AAGCAGGAGCAAAAGAGAGAAGG + Intergenic
1074192608 10:111150733-111150755 CTGCAGGAGTAGAAGAGGGTTGG - Intergenic
1074193219 10:111155967-111155989 ATCCAGAACCAGAAGAATGATGG - Intergenic
1074217054 10:111395234-111395256 GAGCAGAAGGAGAAGAGGGAGGG + Intergenic
1074594927 10:114853954-114853976 AAGGAGAATCTGAAGAGGGAAGG + Intronic
1074732174 10:116390825-116390847 AAGGAGAAGAAGAAGAAGGAAGG + Intergenic
1075097291 10:119480822-119480844 AGGAAGGGGCAGAAGAGGGAAGG - Intergenic
1075455362 10:122581512-122581534 ATGCATCAGCAGATGTGGGATGG + Intronic
1075456694 10:122589512-122589534 AAGCAGAGGGAGAAGAGGAAAGG + Intronic
1075457485 10:122594215-122594237 ATGCATCAGCAGATGTGGGATGG + Intronic
1075458556 10:122600711-122600733 ATGCATCAGCAGATGTGGGATGG + Intronic
1075847263 10:125555017-125555039 AGGAAGACACAGAAGAGGGAAGG - Intergenic
1076143892 10:128101394-128101416 ATGCAGAATCAGAAAGGGAAAGG - Exonic
1076271739 10:129158517-129158539 ATGGAGAAGGAGAAGAGAGGTGG + Intergenic
1076278815 10:129227881-129227903 ATGAAGAACCAGGAGAGGAATGG - Intergenic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1076921944 10:133458872-133458894 ATGCTGATGCAGAGGAGGGTGGG + Intergenic
1077093778 11:790894-790916 ATGCAGAGGCTGAAAAAGGAGGG + Exonic
1077713066 11:4554877-4554899 AGGTAGAGGAAGAAGAGGGATGG + Intergenic
1077761544 11:5104910-5104932 GTGAGGAAGGAGAAGAGGGAGGG - Intergenic
1077782590 11:5347788-5347810 AGGAGGGAGCAGAAGAGGGAGGG + Intronic
1077787624 11:5401836-5401858 AAGCAGAAGAAAAAGAGGGAAGG - Intronic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1079114266 11:17630988-17631010 TGGCAGAACCAGAAGATGGAAGG - Intronic
1079181047 11:18193799-18193821 ATGAAGAAGAAGAGGAGAGAGGG + Intronic
1079800965 11:24868171-24868193 ATTAAGAAGCAGTAGAGGAAGGG + Intronic
1080601028 11:33820664-33820686 ATGGAGAAGGAGAAGAGGCTGGG - Intergenic
1080708255 11:34720019-34720041 ATGGAGAAGAGCAAGAGGGAAGG + Intergenic
1080866315 11:36198574-36198596 ATGCAGAGGCAGGAGTGGGATGG - Intronic
1081558716 11:44192214-44192236 AAGAAGAAGCAGGAGAGGGCTGG - Intronic
1081754679 11:45536138-45536160 ATGCAGAAGCTGGAGTGGAAAGG - Intergenic
1081772210 11:45656999-45657021 ATGAAGAAGCAGCACAGTGAGGG + Intronic
1083868329 11:65470945-65470967 CTGCAGGAACTGAAGAGGGAGGG - Intergenic
1084617251 11:70244791-70244813 ATGGAGGAGGAGGAGAGGGAAGG + Intergenic
1084641706 11:70430174-70430196 CTGCAGAGGGAGAGGAGGGAAGG + Intronic
1085300696 11:75456688-75456710 AGGCAGCAGCAGCAGAGGAAGGG - Intronic
1085514316 11:77103473-77103495 AGGGAGAAGCAGAGGAGGAAAGG - Intronic
1085913996 11:80862872-80862894 ATGTAGAAGGAGAAGAGTCAGGG - Intergenic
1087179159 11:95125006-95125028 AGGCAGAAGGAGAACAGGGGAGG - Intronic
1088619993 11:111671986-111672008 CTGCAGCAGCAGAAGATGGCTGG - Intronic
1088884157 11:113994157-113994179 GTGCAGAGGCAAAGGAGGGAAGG - Intergenic
1089214565 11:116827791-116827813 AGGCCGCAGCAGAAGAGGAAAGG + Intergenic
1089523503 11:119081436-119081458 CTGCAGGAGAAGAGGAGGGAAGG - Intronic
1089556068 11:119316577-119316599 ATGCCCAGGCAGAAGGGGGAAGG + Intronic
1089760699 11:120720899-120720921 ATGCAAAGACAGAAGAGAGAGGG + Intronic
1089780763 11:120871784-120871806 AAGCAGCAGCAAGAGAGGGAGGG + Intronic
1089855616 11:121541795-121541817 TCGAAGAAGGAGAAGAGGGACGG - Intronic
1089862514 11:121602604-121602626 AGGAGGAAGGAGAAGAGGGAGGG + Intronic
1089868521 11:121652297-121652319 GTGCAGAAGCAGAAGTCAGAAGG + Intergenic
1090028052 11:123184518-123184540 AGGCGGAAGCAAAAGAGGAAAGG + Intronic
1090044427 11:123318329-123318351 AAGAAGAAGAAGAAGAGGAAGGG + Intergenic
1090084966 11:123642678-123642700 ATAGAGGAGCAGAAGAGGGTAGG + Intronic
1090139345 11:124238120-124238142 AGGCAGCAGGAAAAGAGGGAGGG - Intergenic
1090187205 11:124746357-124746379 AGGAAGTAGCAGAAGAGGGCAGG + Intronic
1090712413 11:129399622-129399644 GTACAGCAGCAGCAGAGGGACGG + Intronic
1091033218 11:132210237-132210259 ATGAAGAAACAGAAGAGTGCTGG + Intronic
1091145236 11:133273651-133273673 AGCCAGAAGCTGAAGAGAGATGG + Intronic
1091916211 12:4273115-4273137 GTGCAGAGGAAGAAGAGGGAGGG - Intergenic
1092017325 12:5170115-5170137 ATGCAGAATCGGAAGGCGGAGGG + Intergenic
1092075095 12:5666148-5666170 ATACAGAAACAGAATAGTGAAGG + Intronic
1092696296 12:11175446-11175468 ATGCAGAAGCATAAAGGGGTAGG + Intergenic
1092977296 12:13757717-13757739 ATGAATAAGCAGCACAGGGAAGG + Intronic
1096553899 12:52391476-52391498 AGAATGAAGCAGAAGAGGGAAGG - Intergenic
1096711101 12:53456809-53456831 ATGCAGAAGGGAGAGAGGGAGGG - Intronic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097259357 12:57707449-57707471 AAGCAGGAGCAAAAGAGAGAGGG + Intronic
1097265946 12:57745002-57745024 ATCCAGAGGCAGGGGAGGGACGG + Exonic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097670499 12:62531414-62531436 ATTCACATGCAGAAGAGTGATGG - Intronic
1098142061 12:67459891-67459913 ATACATATGCAGAAAAGGGAAGG - Intergenic
1098521274 12:71437524-71437546 ATGAGGAAGCAGGAGAGAGAGGG + Intronic
1098540000 12:71644200-71644222 AAGCTGAAGAAGAAGAGAGAAGG - Exonic
1098876260 12:75869120-75869142 ATGCAGACACAGAAGAGGTTAGG - Intergenic
1099958148 12:89371211-89371233 ATGCACCAGCAGGAGAGAGACGG - Intergenic
1100083933 12:90884445-90884467 ATGCACATTCATAAGAGGGAGGG - Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100705696 12:97197897-97197919 CAGCAGAACCAGAAGAGGTAAGG + Intergenic
1100775406 12:97967990-97968012 TTGCAGAAGCAGGAGAGACAAGG - Intergenic
1101719375 12:107337930-107337952 ATGAAGAATTAGAAGAGAGATGG - Intronic
1101739878 12:107492584-107492606 ACACAGAAGCAGAAGTGGGAGGG - Intronic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102167846 12:110820701-110820723 AGGAAGAAGAAGAAGAAGGAGGG - Intergenic
1102253057 12:111400567-111400589 AAGCAGGAGCAGAAGAGAGATGG + Intergenic
1103408894 12:120696516-120696538 CGGCAGAGGCAGAAGAGGGTTGG - Exonic
1104063476 12:125287174-125287196 CCACAGAAGCAGAGGAGGGAGGG - Intronic
1104085155 12:125467435-125467457 AAGGAGAAGAAGAAGAGGGTGGG - Intronic
1104196909 12:126549085-126549107 ATGAAGGAGGAGAAGAAGGATGG + Intergenic
1107320931 13:39187579-39187601 ATTTAGAAGCAAAATAGGGAAGG - Intergenic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1108612284 13:52096034-52096056 ATGCAGGAGGAAAAGAGTGAAGG - Intronic
1108664151 13:52612711-52612733 ATGCAGAAGAACCACAGGGAAGG - Intergenic
1108738994 13:53315143-53315165 TTGGAGACTCAGAAGAGGGAGGG + Intergenic
1110406452 13:75155882-75155904 AAGCAGAAGCAAGAGAGAGAGGG + Intergenic
1110420735 13:75304800-75304822 AGGAAGAAGGAGAATAGGGAGGG + Intronic
1110641367 13:77828470-77828492 TGGCAGAAGCAGAAGAGATATGG + Intergenic
1110767577 13:79298541-79298563 ATGCAGCACGTGAAGAGGGAAGG - Intergenic
1111303675 13:86378178-86378200 ATGCACAAGGAGAAGATAGATGG + Intergenic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1111709670 13:91795716-91795738 ATGCAGGGGCAGGGGAGGGAAGG - Intronic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113214911 13:108028862-108028884 ATGCAGAGGTAGAAGTGGGAGGG + Intergenic
1114231902 14:20790718-20790740 ATGGGGAGCCAGAAGAGGGAAGG - Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114877499 14:26739597-26739619 AAGCAGAAGCAAGAGAGAGAGGG - Intergenic
1115409778 14:33060985-33061007 ATTCACAACCAAAAGAGGGAAGG + Intronic
1115711586 14:36056906-36056928 ATGCAGAAACTGAAGAGGACTGG + Intergenic
1115936723 14:38560751-38560773 GAGCAGAAGCAAAAGAGGGAGGG + Intergenic
1116087376 14:40257642-40257664 ATACAGAAAAAGAAGAGGAATGG + Intergenic
1116349227 14:43837882-43837904 ATGAAGGAGTAGAAGAGGGGTGG - Intergenic
1116524776 14:45891124-45891146 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
1117031829 14:51679953-51679975 ATGCCAAAGAAGAAGGGGGAAGG + Intronic
1117742984 14:58837067-58837089 ATGCAGAATTACATGAGGGAGGG - Intergenic
1118493709 14:66287135-66287157 ATGCAGAAGTAGAAGAGAACAGG - Intergenic
1118995636 14:70833228-70833250 AAGCAAAAGAGGAAGAGGGAGGG - Intergenic
1119161345 14:72454966-72454988 TTGCAGAAGCAGAAAACAGAGGG - Intronic
1119199834 14:72744149-72744171 ATAAAGAAACAGAAGAGGGATGG + Intronic
1119484598 14:74979458-74979480 AAGCAGCAGCAGGCGAGGGAGGG + Intergenic
1119631668 14:76237482-76237504 AGGCAGGAGCAGAAAGGGGAAGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120273350 14:82342210-82342232 AAGCAGAAGCAAGAGAGGGGAGG - Intergenic
1120321800 14:82972073-82972095 ATTCAGAAGAAAAAGAGGCAAGG - Intergenic
1121080438 14:91103515-91103537 ATGCAGAAGTAGATGTAGGAAGG - Intronic
1121096871 14:91223480-91223502 AGGAAGAAGAAGAAGAGGGAAGG + Intronic
1121122433 14:91384501-91384523 GTGAAGAAGCAGATGAGGAAGGG - Intronic
1121639419 14:95475305-95475327 AGGCAGAAGCAGAGAAGGGGTGG + Intronic
1121744547 14:96278036-96278058 ATGCAGAGCCACAAGATGGAAGG + Intergenic
1121831385 14:97055270-97055292 ATGAAGAAGGAGAAGAAAGAAGG - Intergenic
1122406425 14:101503753-101503775 CTGCAGAGCCACAAGAGGGAAGG + Intergenic
1122482336 14:102055255-102055277 ATGCAGGAGGAGCAGAGTGATGG - Intergenic
1122765654 14:104067806-104067828 ATGGTGGAGCAGAAGAGAGAGGG + Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1124550864 15:30680342-30680364 ATGCAGTAGTAGAACAGGAACGG + Intronic
1124680389 15:31725326-31725348 ATGCAGTAGTAGAACAGGAATGG - Intronic
1124985158 15:34602003-34602025 ATGCAGGGGCAGGGGAGGGAAGG - Intergenic
1125281584 15:38047546-38047568 AAGCAGGAGGAAAAGAGGGAAGG + Intergenic
1125756245 15:42067084-42067106 ATGCAGAAGAGGCACAGGGAAGG + Intronic
1125886781 15:43235312-43235334 AGGGGGAAGGAGAAGAGGGAAGG + Intronic
1126091179 15:45053462-45053484 AAGCTGAAGCAGGAGAAGGAGGG + Intronic
1126307303 15:47274708-47274730 AGGCAGAGGCAGAAGAGGTGAGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1126890657 15:53200842-53200864 AGGCTGAGGCAGGAGAGGGAGGG + Intergenic
1127052080 15:55094962-55094984 ATGAAGAAGATGAAGAGGGAGGG - Intergenic
1127122100 15:55780570-55780592 AAGCAGAAGAAGAAGAAGAAAGG + Intergenic
1127512123 15:59653199-59653221 ATTTAGAAACAGATGAGGGATGG + Intronic
1128188435 15:65665871-65665893 ATGCAGCACAAGAAGAGAGAAGG + Intronic
1128215756 15:65933092-65933114 AGACAGAAGCAGAAAAGGGCTGG - Intronic
1128963726 15:72036585-72036607 CTGAAGAATCAGAACAGGGATGG + Intronic
1129168400 15:73792775-73792797 ATTCAGATGCAGAAGAGGACAGG - Intergenic
1129432107 15:75506839-75506861 ATGAAGAGGCAGAGGAGGAAAGG - Intronic
1129927255 15:79375610-79375632 AAGCAGAAGCAAGAGAGAGAGGG + Intronic
1129976439 15:79826273-79826295 AGGCTGAAGCAGTTGAGGGAGGG + Intergenic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130430479 15:83842219-83842241 ATGAGGAGGCAGAAGGGGGATGG + Intronic
1130866244 15:87935563-87935585 ATGCAGAAGAAGAAGAAGAAGGG + Intronic
1130997004 15:88909520-88909542 ATGCTGATGCAGAGGAGTGAGGG - Intronic
1131284840 15:91048191-91048213 AAGAAGAAGAAGAAGAAGGAGGG - Intergenic
1131759159 15:95601011-95601033 ATACAAAAGGAGAGGAGGGAAGG + Intergenic
1131803429 15:96096449-96096471 ATGCAAAAGCAAAACAGAGAAGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1131893262 15:96997504-96997526 AGGCAGAGACAGAAAAGGGAAGG - Intergenic
1132242196 15:100266500-100266522 GGGCTTAAGCAGAAGAGGGATGG - Intronic
1132267180 15:100484454-100484476 CTGCCGGAGCAGCAGAGGGAGGG - Intronic
1132274472 15:100554630-100554652 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274501 15:100554772-100554794 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274515 15:100554842-100554864 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274548 15:100555021-100555043 TTCCAGACGCAGATGAGGGATGG + Intergenic
1132274585 15:100555197-100555219 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274621 15:100555375-100555397 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274652 15:100555518-100555540 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274659 15:100555554-100555576 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274673 15:100555625-100555647 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274680 15:100555660-100555682 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274702 15:100555768-100555790 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274725 15:100555875-100555897 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274748 15:100555982-100556004 TTCCAGACGCAGATGAGGGAGGG + Intergenic
1132274761 15:100556053-100556075 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274914 15:100556802-100556824 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274921 15:100556838-100556860 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274983 15:100557158-100557180 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274990 15:100557194-100557216 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132274997 15:100557230-100557252 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275011 15:100557301-100557323 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275018 15:100557337-100557359 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275067 15:100557586-100557608 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275074 15:100557622-100557644 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275081 15:100557658-100557680 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275095 15:100557729-100557751 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275102 15:100557765-100557787 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275144 15:100557979-100558001 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132275165 15:100558086-100558108 TTCCAGACGCAGATGAGGGATGG + Intergenic
1132275180 15:100558194-100558216 TTCCAGACGCAGATGAGGGACGG + Intergenic
1132609093 16:806172-806194 GGGCAGAAGCAGGGGAGGGAGGG + Intronic
1133169322 16:3971314-3971336 AGGCAGAATCAGCAAAGGGAAGG - Intronic
1133537993 16:6720582-6720604 ATGGAGAAACAGAAGTGAGAGGG + Intronic
1133638790 16:7697054-7697076 ATGCAGAGGCATTGGAGGGAGGG + Intronic
1133743001 16:8665444-8665466 ATTCAGAGGCAGCAGAGGGAGGG - Intergenic
1133876917 16:9743704-9743726 ATGTAGAAGAAGATGAGAGATGG + Intergenic
1134470088 16:14516976-14516998 AATCAGACACAGAAGAGGGAAGG + Intronic
1134531564 16:14988371-14988393 AAGCTGAACCAGAAGAGGAAGGG + Intronic
1134690959 16:16190870-16190892 ATGGAGCTGGAGAAGAGGGAGGG + Intronic
1135458202 16:22617314-22617336 AGGCAGAAGAGGAAGAGGAAAGG + Intergenic
1135815340 16:25627460-25627482 AAGCAGGAGCAAGAGAGGGAGGG + Intergenic
1135856425 16:26015333-26015355 ATGCAGAAGCAGAATCTGGTGGG + Intronic
1135937522 16:26793671-26793693 GAGAAGGAGCAGAAGAGGGAGGG - Intergenic
1136412953 16:30087473-30087495 ATGCAAAAGCAGAACTGTGACGG - Intronic
1136506892 16:30710133-30710155 AGGCAGAAGGAGCAGAGGGAGGG + Intronic
1136931969 16:34426792-34426814 ATGCACATCCAGAAGAGTGAAGG + Intergenic
1136972603 16:34985023-34985045 ATGCACATCCAGAAGAGTGAAGG - Intergenic
1137341750 16:47614147-47614169 AAGCAGGAGCAGGAGAGTGAGGG + Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137557141 16:49477641-49477663 AAGAAGAAGGAGAAGAAGGAGGG + Intergenic
1137639254 16:50013928-50013950 ATGGTGAAGCAGGGGAGGGAAGG - Intergenic
1137679215 16:50324520-50324542 AGGAAGAAGCAGAAGAGTGCAGG - Intronic
1137748502 16:50841235-50841257 ATGCAGAAGCAGCCGCGGGCCGG + Intergenic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1138533767 16:57649005-57649027 ATGCAGATGCAGGGGTGGGATGG + Intronic
1139127887 16:64103306-64103328 ATACAGAAGGACAAGCGGGATGG - Intergenic
1139144767 16:64310036-64310058 ATGAAGAAAGAGAAGAAGGAAGG + Intergenic
1139268241 16:65659430-65659452 ATGGAGAAGGTGCAGAGGGATGG + Intergenic
1139316736 16:66078387-66078409 TTGCAGACTCAGAAGAGGGGAGG - Intergenic
1139640050 16:68285065-68285087 AAAAAGAAGCAGAAGTGGGAGGG - Intronic
1140137169 16:72217155-72217177 ATGAAGCATAAGAAGAGGGAAGG + Intergenic
1140309509 16:73835444-73835466 AAAAAAAAGCAGAAGAGGGATGG - Intergenic
1141275545 16:82584645-82584667 ATGGAGAAGAAGAAGAAGTAGGG + Intergenic
1141379531 16:83563850-83563872 ATCCAGAAACTGAAGTGGGATGG + Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142322492 16:89393095-89393117 ATGCAGGTGAAGAAGAGGGAGGG - Intronic
1143097414 17:4485875-4485897 ATGCAGCAGCACAAGCGGGCAGG - Intronic
1143325297 17:6094664-6094686 TGGCAGAAGCAAGAGAGGGAAGG + Intronic
1143336077 17:6172508-6172530 GAGAAGAAGCCGAAGAGGGAGGG - Intergenic
1144349466 17:14380894-14380916 GTGCAGAAACAGAAGAGAGAAGG + Intergenic
1144653286 17:17020111-17020133 TTGAGGAAGCAGAAGAGGGTGGG - Intergenic
1144810042 17:17993187-17993209 ATGAAGAAGCTGAGGAGGGCTGG + Intronic
1144838330 17:18170079-18170101 CTGCAGAAGCAGATCTGGGAAGG - Intronic
1146097659 17:29947401-29947423 ATGGAGACTCAGAAGTGGGAGGG + Intronic
1146187185 17:30731722-30731744 AGGCAGGAGGAGAGGAGGGAAGG - Intergenic
1146460020 17:33038957-33038979 ATGCAGACACAAAGGAGGGAAGG - Intronic
1147629080 17:41918597-41918619 TGGCAGAGGCAGAAGAGGCAAGG + Intronic
1148616861 17:49007279-49007301 CTACAGAAGCAGAAGAAGTAGGG - Intronic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1149200757 17:54183353-54183375 GTGCAGAAGCTGGAGTGGGATGG - Intergenic
1149594153 17:57853959-57853981 TTGAAGGAGCAGGAGAGGGACGG - Intergenic
1150000701 17:61437160-61437182 AAGAAGAAGAAGAAGAGAGAAGG - Intergenic
1150092352 17:62338844-62338866 AGGCAAAAGAACAAGAGGGAAGG + Intergenic
1150565181 17:66332571-66332593 GTGGAGAAGCTGCAGAGGGAGGG + Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150724731 17:67642433-67642455 AGGGGGTAGCAGAAGAGGGAAGG - Intronic
1150965643 17:69964929-69964951 AGGCAGATGCAGAAGATGAAAGG - Intergenic
1151038743 17:70832878-70832900 ATGCAGAAGCAGCAGTAGCAGGG + Intergenic
1151520906 17:74628905-74628927 ATGCAAAAGAAGAGGAGGCAAGG + Intergenic
1151969230 17:77449406-77449428 ATCCAGAGGCAGAGGAGGGGAGG + Intronic
1152148039 17:78581011-78581033 AGGCAGAAGCTGAAGAAGGATGG - Intergenic
1152462436 17:80448650-80448672 AGGGAGGAGGAGAAGAGGGAAGG - Intergenic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153218829 18:2845239-2845261 ATGAAGAAGAGGAAGAGGGGGGG - Intergenic
1153509453 18:5835926-5835948 AGGGAGTAGAAGAAGAGGGAAGG + Intergenic
1155263326 18:24066714-24066736 ATGCAGGAGCAGAAGACAGGTGG - Intronic
1155315134 18:24563740-24563762 ATGGAGACTCAGAAGGGGGACGG - Intergenic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1155901215 18:31393490-31393512 GGGCAGTAGCAGAAGAGAGAAGG + Intronic
1156229383 18:35139101-35139123 ATGCTGCAGGAGAAGAGAGAAGG + Intronic
1156281966 18:35648033-35648055 AAGAAGAAGAAGAAGAAGGAAGG + Intronic
1156909792 18:42397916-42397938 ATGCAGAACAATAAAAGGGAAGG + Intergenic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1157312112 18:46560310-46560332 AGGAAGAAGAAGAAGAGGAAGGG - Intronic
1158355051 18:56608698-56608720 ATGCAGAAGCAGATATGAGAAGG + Intronic
1158541019 18:58354771-58354793 ACACAGAAACAGAAGAGGCAAGG + Intronic
1158638387 18:59181204-59181226 ATGCAAAAGAAGAAGAGCGAAGG + Intergenic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1159375921 18:67592856-67592878 ATGCAGAAGAAGAATATAGAAGG - Intergenic
1159433868 18:68390403-68390425 ATTCAGTAGCAGAAGATTGAGGG - Intergenic
1159441934 18:68492464-68492486 ATGCAGAAGCTGAAGAGACTCGG + Intergenic
1159861176 18:73651424-73651446 ATACTGTAGCAGAAGAGGAAGGG + Intergenic
1160286306 18:77546866-77546888 TAGAAGAAACAGAAGAGGGAGGG - Intergenic
1160361729 18:78288641-78288663 ATGTATAACCAGAAGTGGGATGG - Intergenic
1161751717 19:6102577-6102599 AAGGAGAGGCAGAAGAGGCAGGG - Intronic
1163229300 19:15989310-15989332 CTGGAGACTCAGAAGAGGGAAGG - Intergenic
1163518976 19:17780795-17780817 CTGAGGAAGCAGGAGAGGGAGGG + Intronic
1163838057 19:19588167-19588189 ATCCAGGAGAAGAATAGGGATGG - Intronic
1164292442 19:23880368-23880390 AAGAAGAAGCAGAGGAGAGAAGG + Intergenic
1164441118 19:28281691-28281713 ATGAAGAGGGAGAAGAGGGTGGG - Intergenic
1164571342 19:29376827-29376849 AGGCAGAAACAGAAAAGAGATGG + Intergenic
1164591928 19:29512133-29512155 ATGAAGAGGAAGAAGAGGGAGGG + Intergenic
1164788018 19:30952207-30952229 AGGAAGAAGCAAAAGAGGGAGGG - Intergenic
1164788027 19:30952246-30952268 AGGAAGGAGCAAAAGAGGGAGGG - Intergenic
1164896716 19:31883264-31883286 ACGGAGAAGTAGAAGAGAGAAGG + Intergenic
1165939045 19:39406297-39406319 ATTCAGAGGGAGAAGAGGGTTGG - Intergenic
1166008621 19:39925123-39925145 AAGAAGAAGAAGAAGAGGGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166445272 19:42853238-42853260 AAGCAGAAACAGAAGAGAGAAGG - Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1167324798 19:48817630-48817652 ATGCAGAAACCTATGAGGGATGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
926053772 2:9761709-9761731 AAGCAGAGGCAGGAAAGGGAGGG - Intergenic
926309012 2:11661016-11661038 GAGTAGAAGCAGGAGAGGGAAGG - Intronic
926537156 2:14127560-14127582 ATGGTGAAGCAGGAGAGAGACGG + Intergenic
926887633 2:17612642-17612664 ACACTGAATCAGAAGAGGGAGGG - Intronic
927260469 2:21083499-21083521 ATGGGGAAGCAGAAGAGTGCTGG + Intergenic
927273461 2:21239463-21239485 ATGGAGAAGAAGAAGAAGGAAGG - Intergenic
927706024 2:25297064-25297086 ATGCAGGAGCACAGGAGAGATGG - Intronic
928224825 2:29439740-29439762 GGCCAGAAGCAGAAGTGGGAGGG + Intronic
928508290 2:31977104-31977126 ATAGAGAAGCAGAAGACGGCAGG + Intronic
929334607 2:40725844-40725866 ACCCAGATGCAGAAGAGGAAAGG + Intergenic
929864794 2:45708872-45708894 TGGCAGAGTCAGAAGAGGGAAGG + Intronic
929872184 2:45768483-45768505 TTACAGAAGGAAAAGAGGGAAGG - Intronic
929909819 2:46080269-46080291 ATGCAGACTCAGTAGAGTGAGGG + Intronic
930662084 2:54064336-54064358 AGCCAGAAGCAGAACAGTGAGGG + Intronic
931483678 2:62669056-62669078 AGGCAGAAGCAGAAGAAAGACGG - Intergenic
931640161 2:64374818-64374840 ATGAAGAAGCAGCTGAGGCAAGG + Intergenic
932623317 2:73279603-73279625 AAGTAAGAGCAGAAGAGGGAAGG + Intronic
932830022 2:74980325-74980347 ATGCTGAGGCAGAAGGGGCATGG + Intergenic
933190393 2:79327795-79327817 ATGCAGAAGGGGCAGGGGGATGG + Intronic
933608896 2:84413882-84413904 ATACAGTAGGAGAAGAGGAAAGG - Intergenic
933907773 2:86912623-86912645 TTACAGAAGTAGGAGAGGGAAGG + Intronic
933909021 2:86922338-86922360 TTACAGAAGTAGGAGAGGGAAGG + Intronic
933928612 2:87124918-87124940 TTACAGAAGTAGGAGAGGGAAGG + Intergenic
933999947 2:87700704-87700726 TTACAGAAGTAGGAGAGGGAAGG + Intergenic
934023703 2:87981047-87981069 TTACAGAAGTAGGAGAGGGAAGG - Intergenic
934112226 2:88754669-88754691 AGGCAGAATCCAAAGAGGGAAGG + Intergenic
934131187 2:88950645-88950667 AGGCAGGAGCAGAAGATGAATGG - Intergenic
934631584 2:95930924-95930946 AAGCAGAAGCAGAAGTTAGAAGG - Intronic
934802063 2:97173761-97173783 AAGCAGAAGCAGAAGTTAGAAGG + Intronic
935204815 2:100888347-100888369 AAGCAGAAACAGAAGAGGATAGG + Intronic
935629618 2:105202378-105202400 ATGGTGAAGCAGGAGAGAGAGGG + Intergenic
936580027 2:113691493-113691515 ATGGAGACTCAGAAGGGGGAGGG - Intergenic
936832835 2:116669860-116669882 AAGGAGAAGGAGAAGAGGGAAGG - Intergenic
937285258 2:120746524-120746546 AAACAGAAGCAGAAGAAAGAGGG - Intronic
937345966 2:121125482-121125504 AAGGAGAAGGAGAAGAAGGAAGG + Intergenic
937495203 2:122411866-122411888 AAGCAGAAGGAGAAGTGGGTGGG - Intergenic
937743712 2:125386501-125386523 ATGGGGAACCAGAAGGGGGAAGG + Intergenic
937844011 2:126557439-126557461 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
937907996 2:127061704-127061726 TTCCAGGAGCAGGAGAGGGAAGG + Intronic
938017481 2:127879367-127879389 ATGCAGGAGCAGGAGAGAGTTGG - Intronic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
938742444 2:134245601-134245623 AAGGAGAAGCAGAGGAGGAAGGG - Intronic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
940122861 2:150287011-150287033 ATACAGCAGCAGAAGAGGCACGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
941141103 2:161782891-161782913 TTCCAGAAGGAGAAGAGAGAAGG + Intronic
941309619 2:163912599-163912621 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
942962146 2:181843670-181843692 ATGGATATGTAGAAGAGGGAGGG + Intergenic
943769880 2:191705029-191705051 ATCCAGAAAAAGAACAGGGAAGG - Intergenic
943850807 2:192720201-192720223 GGGCAGAAGTAGAAGAGAGAGGG + Intergenic
944328308 2:198433526-198433548 ATGCTAAAGCAGGGGAGGGAGGG - Intronic
944661192 2:201923358-201923380 ATGCATAAGGGGAAGAGGGTGGG - Intergenic
944915590 2:204357413-204357435 GTGCAGAAGCAACAGACGGATGG + Intergenic
945688791 2:213007160-213007182 AGGAAGAAACAGAAGAGAGAAGG - Exonic
945907991 2:215615572-215615594 ATGCAGCAGAAGAGGATGGAAGG - Intergenic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946145896 2:217730774-217730796 AAGCAGGAGCAAGAGAGGGAGGG - Intronic
946149709 2:217756066-217756088 ATGCAGAGGCAGAAAAATGAGGG - Exonic
946769634 2:223075588-223075610 AAGCAGAAGGAGGAGAGAGAAGG - Intronic
947100543 2:226616568-226616590 ATACAGCAGAAGAAGAGGCAAGG - Intergenic
947127399 2:226884191-226884213 CTGCACAAGCAGAAGAGGAAAGG - Intronic
947224057 2:227823041-227823063 ATGGAGAAGTGGAAGATGGAAGG + Intergenic
947295663 2:228627759-228627781 AAGGAGAAGAAGAAGAAGGAGGG - Intergenic
948838299 2:240636796-240636818 ATGCAGGAACAGAAGGGGGAGGG - Intergenic
949061433 2:241960520-241960542 ATGAAGAAGTAGCAGAGGAAGGG - Intergenic
1168971263 20:1932498-1932520 GAGCAGAGGCAGGAGAGGGATGG + Intronic
1169205271 20:3736300-3736322 AATCAGAATCAGAAGAAGGATGG - Intronic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1169608398 20:7350124-7350146 ATGCAATAGCAGAAGTGGGAAGG + Intergenic
1169700720 20:8443711-8443733 ATGCAGAAGCAGAAGGGAATAGG - Intronic
1170316669 20:15049298-15049320 AAGAAGAAAGAGAAGAGGGAGGG + Intronic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171486460 20:25489705-25489727 ATGCAGAGGAAGCAGAGGGAAGG + Intronic
1172087714 20:32400764-32400786 ATGCAGAAGCAGAAGCCCTATGG - Intronic
1172113891 20:32562774-32562796 CTGCAGGAGCAGAATGGGGAGGG - Intronic
1172134000 20:32675133-32675155 ATGCAGCAGGACAGGAGGGAGGG - Intergenic
1172189288 20:33052226-33052248 GACCAGAAGGAGAAGAGGGAAGG - Intergenic
1172512230 20:35508745-35508767 CTCCTGAAGCAGAAGAGGCAGGG - Intronic
1172517941 20:35548618-35548640 ATGCAGGAGCAGAAGAATGAAGG + Exonic
1172888583 20:38247763-38247785 AAGAGGATGCAGAAGAGGGAAGG + Intronic
1173017184 20:39236371-39236393 AGGCAGAAGCTCAACAGGGAAGG - Intergenic
1173260281 20:41428746-41428768 ATGTAGAAAAAGAAGAGGGCAGG + Intronic
1173497686 20:43531094-43531116 CTGCAGTAGCAAAGGAGGGAGGG - Intronic
1173925574 20:46778772-46778794 GTGCAGAGGAGGAAGAGGGAGGG - Intergenic
1173997503 20:47350056-47350078 ATGCTGGAGCAGAAGAGAGAGGG + Intronic
1174119049 20:48248598-48248620 ATTGAGAAGCAGGAGAGGGGTGG - Intergenic
1174454893 20:50642004-50642026 CTGCGGAAGCAGAAGGGGGTGGG - Intronic
1174471909 20:50767726-50767748 CTGCGGAAGCAGAAGGGGGTGGG + Intergenic
1174856299 20:54048533-54048555 ATCCAAAAGCAGGAGAGGAAAGG - Intronic
1175006091 20:55684902-55684924 ACGCAGAAGCAGGAGTGAGAAGG - Intergenic
1175458926 20:59136236-59136258 ATGAAGCAGCAGCAGAGGGTAGG - Intergenic
1176177405 20:63735248-63735270 CTGCAGAAGCAGACCAGGGTTGG + Exonic
1178092097 21:29174860-29174882 ATACAGTATCAGAAGAGGCAGGG + Exonic
1178348321 21:31851155-31851177 TTGGAGGAGCAGAGGAGGGAGGG - Intergenic
1178584721 21:33862480-33862502 TGGGAGAAGGAGAAGAGGGAAGG + Intronic
1179124814 21:38581252-38581274 GTGCAGAGCCAGATGAGGGATGG + Intronic
1179185399 21:39081804-39081826 AAGGAGAAGGAGAAGAAGGAGGG + Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181872602 22:25911883-25911905 ATGCAGCAGCAGCACAGGAAGGG - Intronic
1182411494 22:30190615-30190637 AAGCAGAAGGAAATGAGGGAAGG + Intergenic
1182874801 22:33682390-33682412 GTGCAGGAGAAGAAGTGGGAAGG - Intronic
1183573163 22:38669449-38669471 ATGCAGAAGTGGATGAAGGAGGG + Intronic
1184591017 22:45483367-45483389 ATGTAGCAGCAGCAGTGGGAAGG - Intergenic
1184914453 22:47559481-47559503 GTGAGGAAGCAGAGGAGGGAAGG + Intergenic
1185377492 22:50488949-50488971 CTGCAGAAGGACAGGAGGGACGG - Intronic
949284370 3:2383705-2383727 AGACAGAAGAAGGAGAGGGAGGG - Intronic
949397203 3:3627321-3627343 CTGCAGCAACAGCAGAGGGAGGG - Intergenic
949459542 3:4275431-4275453 GTCAAGAGGCAGAAGAGGGATGG + Intronic
950403648 3:12790516-12790538 ATTCAGAAGAAGAAGAAGGGTGG + Intergenic
950426680 3:12928143-12928165 ATGCTGCAGCAGAGGTGGGAGGG + Intronic
950723632 3:14901769-14901791 ATCCACAGGCAGAAGAGGAAGGG + Intronic
951098378 3:18658014-18658036 ATCAGGAAGCAGAAGAGGGCAGG - Intergenic
951425009 3:22534266-22534288 AGGCAGAAGCAGATGAGACAGGG + Intergenic
951455841 3:22891195-22891217 ATGCAGACGGAGAAGAGAAAAGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952436947 3:33280975-33280997 ATTGGGAAGCAGAAGATGGAGGG + Intronic
952708873 3:36408648-36408670 ATTCAGAAGCAGAAGAATGATGG - Intronic
953557136 3:43955292-43955314 ATGCATAACTGGAAGAGGGAGGG - Intergenic
953957621 3:47243933-47243955 ATCCGGAAGCAGAACAGAGAGGG + Intronic
954740821 3:52749080-52749102 TTGCAGAAGGGGAAGAGGGGAGG + Intronic
954859876 3:53678706-53678728 ATGGAGAATGTGAAGAGGGAAGG + Intronic
955518812 3:59754560-59754582 TGGCAGTAGCAGAAGTGGGAAGG - Intronic
955576121 3:60365257-60365279 ATGCATATGGAGGAGAGGGAAGG + Intronic
955905313 3:63801400-63801422 AAGAAGAAGCAAAAGAGGCATGG + Intergenic
955912396 3:63870801-63870823 ATGCAGAAAGGGAATAGGGAAGG - Intronic
957788332 3:84908847-84908869 AGGAAGAAGAAGAAGAGGAAGGG + Intergenic
958095039 3:88933702-88933724 AGGCAGAAGGGGAAGAGGGAAGG - Intergenic
958529118 3:95302064-95302086 AAGAAGAAGAAGAAGAGGTATGG + Intergenic
958667161 3:97155904-97155926 AACCAGAAGCAGAAGAGAGATGG - Intronic
958762772 3:98328736-98328758 TTGCTGAGGCTGAAGAGGGAGGG + Intergenic
959024375 3:101223781-101223803 ATGCAGAAGAAGAAAACAGAAGG + Exonic
959662434 3:108883942-108883964 GTGCAAAAGCACAAGGGGGAAGG - Intergenic
959910942 3:111763008-111763030 TTGCAGGTGCAGAAGAGGGTGGG - Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
961203676 3:125063853-125063875 GAGAAGAAACAGAAGAGGGAAGG - Intergenic
961879406 3:130050281-130050303 AAGAAGAAGGAGAAGAAGGAAGG + Intergenic
962526156 3:136239419-136239441 AGACAGAAGCAGGGGAGGGAAGG - Intergenic
962564066 3:136639225-136639247 TTCCAGAAGCTGAAGTGGGAGGG + Intronic
963003085 3:140701544-140701566 GTCCAGAAGGAGAAGAGGGAGGG - Intergenic
963204203 3:142615735-142615757 AAGCAGATGTTGAAGAGGGAAGG + Intronic
963558942 3:146835567-146835589 AAGCAAAAGCAAAAGAGGAAGGG + Intergenic
963599687 3:147367831-147367853 ATTCAGGTGGAGAAGAGGGAGGG - Intergenic
963831779 3:150016410-150016432 ATGCTGAAGCTGAAGAGGAGTGG + Intronic
964162274 3:153659716-153659738 ATGCAATTGCAGGAGAGGGAGGG - Intergenic
965467205 3:169044849-169044871 ATGCAGGAGATGAGGAGGGAAGG + Intergenic
965719103 3:171641683-171641705 ATGTGGAAGCAGGAGAGGAAGGG - Intronic
966266161 3:178047058-178047080 AGTCAGAAGAAGATGAGGGAAGG - Intergenic
966389850 3:179440698-179440720 ATGCAGAATCTAAACAGGGATGG + Intronic
966472484 3:180306824-180306846 ATGCAGAGGAAGAAGAAAGAGGG - Intergenic
966502550 3:180659474-180659496 GAACAGATGCAGAAGAGGGATGG - Exonic
966564433 3:181360760-181360782 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
967493148 3:190116231-190116253 ATGTAGAAGAGGAAGAGGAAAGG + Intronic
967932003 3:194696706-194696728 CTGCAGACGCAAGAGAGGGAAGG - Intergenic
967997081 3:195174766-195174788 AAGGAGAAGGAGAAGAGGAAGGG - Intronic
968294767 3:197567477-197567499 AGGCAAAAGCAGGACAGGGAGGG - Intronic
968503210 4:960678-960700 AAGCAGAAGCCGAGGAGGGCCGG - Exonic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968943588 4:3652110-3652132 GTGCAGAAGCACAAGGGGCAAGG - Intergenic
968978660 4:3835053-3835075 ATGGAGAGAGAGAAGAGGGAAGG + Intergenic
969154382 4:5197132-5197154 ATGAAGAAGGACAATAGGGAGGG + Intronic
969823717 4:9740263-9740285 AAGCAGAAGGAGAAGAAGGAAGG - Intergenic
970218840 4:13786497-13786519 ATGAAGAAGGAAAAAAGGGAGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970321367 4:14878797-14878819 ATCCAGAGGCAGAAGAGTCATGG - Intergenic
971887598 4:32473406-32473428 ATGGCGAGCCAGAAGAGGGATGG + Intergenic
973628448 4:52795507-52795529 AGGAAGAAGAAGAAGAAGGAAGG + Intergenic
973628467 4:52795712-52795734 AAGCTGAAGCAGGAGAAGGAAGG + Intergenic
974032797 4:56790990-56791012 ATGGAGACTCAGAAGAGGGAGGG - Intergenic
974651547 4:64759700-64759722 GTGAAGAAGAAGAAGAGTGAAGG - Intergenic
975825128 4:78311486-78311508 ATGCAGATGGAGAAAAAGGAGGG - Intronic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
976478806 4:85514951-85514973 ATGCAGAAGCCAGATAGGGAAGG + Intronic
976536515 4:86223661-86223683 GTGCAGAGGAAGAAGAGGGAGGG - Intronic
976809048 4:89080692-89080714 ATGCAGAACCACAAGAGGCCGGG + Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
978122326 4:105094793-105094815 ACCCAAAACCAGAAGAGGGAAGG + Intergenic
978277343 4:106967871-106967893 AAGCAAAAGGAGAAGAAGGAAGG + Intronic
978371262 4:108031526-108031548 ATGCAGAGGCAGGAATGGGAAGG - Intronic
979006190 4:115300294-115300316 TCACAGAAGCAGAAGTGGGAGGG - Intergenic
979286848 4:118935958-118935980 TGGCAGAGGCAGAAGAGGGGAGG + Intronic
980833034 4:138154741-138154763 AAGAAGAAGAAGAAGAAGGATGG - Intergenic
980884957 4:138752352-138752374 ATGGAGGAGCAGGAGAGAGAGGG - Intergenic
981220850 4:142232557-142232579 AGGCCCAAGGAGAAGAGGGAGGG - Intronic
982397563 4:154928506-154928528 ATGGAGAAGGAAATGAGGGAAGG + Intergenic
982404048 4:155000970-155000992 CTCCAGAAGCTGAAGTGGGAGGG - Intergenic
982525346 4:156470939-156470961 ATTCAGAAGCAGAAGAAGGAAGG + Intergenic
982598355 4:157414088-157414110 ATGCAGAAACTGTAGAGGCATGG - Intergenic
982822818 4:159965735-159965757 ATGCAGGAGAAGAAATGGGAAGG - Intergenic
982893751 4:160890200-160890222 ATGCAGAAGCAAGAGAAAGAAGG + Intergenic
983740178 4:171121222-171121244 ATGCACAAGCAGTAGAGACAGGG + Intergenic
984168728 4:176335201-176335223 ATCCAGAAGAAGTATAGGGAGGG - Intergenic
984424871 4:179570663-179570685 TGGCAGAGGCAGAAGAGGTAGGG + Intergenic
985376444 4:189344664-189344686 ATGAAGATGGAGAACAGGGAAGG + Intergenic
986076986 5:4348057-4348079 ATACATAAGCAGGAGAGGCAGGG - Intergenic
986139947 5:5020100-5020122 AAGCAGGATCAGAAGAGTGATGG + Intergenic
986210187 5:5664760-5664782 ATGGCCAAGGAGAAGAGGGAGGG + Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986687498 5:10287474-10287496 ATGGAGACTCAGAAGGGGGAGGG + Intronic
986916224 5:12624088-12624110 AAGCAGAAGCAAGAGAGTGAGGG - Intergenic
986927014 5:12766767-12766789 AAGCAGGAGCAATAGAGGGAGGG - Intergenic
987566371 5:19593530-19593552 AGGGAGAAGGAGAAGAAGGAAGG - Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
989214363 5:38888599-38888621 ATGGAGAAAGAAAAGAGGGAAGG - Intronic
989307983 5:39979736-39979758 CAGCAGAAGATGAAGAGGGAGGG - Intergenic
989654445 5:43731115-43731137 AAGAAGAAGAAGAAGAGAGAGGG - Intergenic
990148488 5:52788887-52788909 ATGCAGAACAAGAAAAGGCAGGG + Intronic
990378054 5:55192916-55192938 GTCCAGAAGCAGAGGTGGGAGGG - Intergenic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990767274 5:59198737-59198759 ATACAGAAGTAGAAGAAGGATGG - Intronic
990938686 5:61177887-61177909 AAGCAAAAGCAGAAGACAGAGGG + Intergenic
991035875 5:62126951-62126973 ATGCAGCAGCAGAAAAAGAATGG + Intergenic
991449559 5:66737592-66737614 ATCCAGAAGTAGAAGACAGAAGG - Intronic
991547622 5:67800817-67800839 CTGCAGAAGCAGATGAGGAGAGG + Intergenic
992611599 5:78512854-78512876 ATGCTGAGGCAGGAGAGGGGAGG - Intronic
993188104 5:84645940-84645962 ATGGGGAGCCAGAAGAGGGATGG - Intergenic
993237092 5:85325542-85325564 ATACAGAAGCAGAAGAGCTTGGG - Intergenic
993315213 5:86395475-86395497 AGGAGGAAGCAGAAGAGGAAGGG + Intergenic
993499211 5:88645416-88645438 AGGCAGAAGAGGAAAAGGGATGG - Intergenic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
994946493 5:106399947-106399969 ATTCATAGGCAGAAGAGGAAAGG + Intergenic
995086572 5:108117975-108117997 ATGAAAAAGCAGGAGATGGAGGG + Intronic
995926549 5:117381837-117381859 ATAGAGAGGCAGGAGAGGGAGGG - Intergenic
996188166 5:120505109-120505131 AAGCAGAAGGAAAAGAGGGGAGG - Intronic
996432999 5:123401946-123401968 CTGCAGCAGCAGAAGACGGCCGG - Intronic
996814600 5:127560836-127560858 ACACAGAAGCAGAAGAGGCAAGG - Intergenic
997566742 5:134893731-134893753 AGTTAGAAGCAGAAGAGGGGGGG + Intronic
997716388 5:136046312-136046334 CTGCAGGAGCAGAAGACAGAAGG - Intronic
997716756 5:136048363-136048385 ATGGAGGGTCAGAAGAGGGAAGG - Intronic
998225393 5:140322811-140322833 AAGCAGAGGGAGAAGAGGGGTGG - Intergenic
998549864 5:143067035-143067057 AAGCAGAAGCGGGAGGGGGAGGG - Intronic
998549869 5:143067041-143067063 ACCAAGAAGCAGAAGCGGGAGGG - Intronic
998660690 5:144233860-144233882 AAGGAGAGGGAGAAGAGGGAGGG + Intronic
998729333 5:145056244-145056266 ATAGCGAAGCAGAGGAGGGAGGG - Intergenic
998801373 5:145872928-145872950 AAGCTGAATCAGAAGAGTGATGG - Exonic
998887259 5:146707215-146707237 CTGCAGCAGCAGAAGACGGCTGG - Intronic
999249210 5:150172061-150172083 GTGAAGATGCAGGAGAGGGAAGG - Intronic
999396875 5:151235135-151235157 AAGCAGCTGCAGAGGAGGGACGG + Intronic
1000193755 5:158938343-158938365 ATGCTGGAGCAGAGGAGGGGAGG - Intronic
1001120723 5:168977857-168977879 ATGGAAAAGGTGAAGAGGGAGGG + Intronic
1001171620 5:169424834-169424856 ATGCAGAAGCTGAAGTTGCAAGG - Intergenic
1001465115 5:171957368-171957390 AAGCAGGAGCAGAAAAGGGGAGG + Intronic
1001705044 5:173735460-173735482 CTGCAGAGGCAGAAGAGCCAGGG - Intergenic
1001931992 5:175679728-175679750 ATGCAAAGGCAGAGGAAGGAGGG + Intronic
1002088850 5:176792854-176792876 AGGCAGAAGGAGAGGAGGGGAGG - Intergenic
1002855252 6:1030895-1030917 ATGCAGAAGTAGCAGAATGAAGG + Intergenic
1003045994 6:2733307-2733329 ATGCAAAGGCAGAAGAGTTATGG + Intronic
1003514172 6:6804541-6804563 ATGCAAAAGAAGAAGGGAGAGGG - Intergenic
1003593447 6:7454902-7454924 ATGCTGAGAGAGAAGAGGGAGGG - Intergenic
1003694080 6:8384971-8384993 TTGAAAAAGCAGAAAAGGGAAGG + Intergenic
1004002042 6:11604802-11604824 AAAAAGAAGAAGAAGAGGGAGGG + Intergenic
1004049900 6:12066318-12066340 ATGTGGTAGCACAAGAGGGATGG - Intronic
1004462714 6:15853428-15853450 AAGGAGAAGCAGAAGGGGAAGGG - Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004675864 6:17841548-17841570 AAGCAGCAGCAGCAGAGGGGTGG + Intronic
1005612451 6:27539443-27539465 ATCAAAAAGCAGAAGAGGGAAGG + Intergenic
1006030885 6:31175780-31175802 CTGCAGAAGGAGAGAAGGGAAGG - Intronic
1006143599 6:31945401-31945423 ATTCAGAGGTAGAAGATGGAGGG - Exonic
1006145037 6:31953829-31953851 GAGCTGAAGCAGAAGAGGGGAGG + Exonic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1006467358 6:34203565-34203587 ATGCAGAAGCAGGAAAAGAATGG + Intergenic
1007024983 6:38562260-38562282 AGGAAGAAACTGAAGAGGGAAGG - Intronic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007622467 6:43223410-43223432 ATGCAGGAGCAGAAGGGGTCTGG - Intronic
1007957454 6:45930318-45930340 TTGTAGAAGGAGAAGAGGAAAGG + Intronic
1009369900 6:62886124-62886146 GTGCAAAAGCAGAAAAGGGAGGG + Intergenic
1010020157 6:71150117-71150139 ATGCAAAAGAAGAATAGTGAGGG - Intergenic
1010073603 6:71773390-71773412 TTGGAGAAGCAGAAGGGGAAAGG - Intergenic
1010421367 6:75680260-75680282 ATGCAGAAGGAGAACAGGCTTGG + Intronic
1010628467 6:78168273-78168295 ATGGGGAACCAGAAGGGGGATGG + Intergenic
1010828241 6:80498739-80498761 GTGCAGAAGGAGAGGAGGAAGGG + Intergenic
1010890843 6:81308572-81308594 ATGAAGCAGAAAAAGAGGGAGGG + Intergenic
1011253822 6:85401346-85401368 TTTAAGAAGCAGAAGAGAGAGGG + Intergenic
1011559915 6:88603801-88603823 CTGCAGAAGCATGATAGGGATGG - Intergenic
1011673444 6:89707583-89707605 TTGCAGAGGCAGGAGAGGAATGG - Intronic
1011702192 6:89966322-89966344 TTGCAGAAGCACAAGAAGGGAGG - Intronic
1012216855 6:96597751-96597773 ATGCAGCAGCAGAACTGGGAAGG - Intronic
1012370706 6:98503307-98503329 AGGAAGGAGGAGAAGAGGGAAGG - Intergenic
1012494379 6:99818516-99818538 AAGAAGAAGAAGAAGGGGGAGGG - Intergenic
1012713184 6:102634369-102634391 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1013284890 6:108672782-108672804 AAGCAGGAAAAGAAGAGGGAAGG - Intronic
1013424945 6:110003160-110003182 AAGAATAAGCAGAAGAAGGAAGG + Intergenic
1013793008 6:113857508-113857530 AAGCAGCAGCACAGGAGGGAGGG - Exonic
1014555505 6:122840132-122840154 ATGCAAAGGCAGAGAAGGGAAGG + Intergenic
1015210663 6:130694865-130694887 ATGGAGAAGCAGCAGCAGGAAGG + Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015388655 6:132655087-132655109 ATACAGTAGCAGCACAGGGAGGG + Intergenic
1015490781 6:133823298-133823320 TTGATGAGGCAGAAGAGGGAGGG - Intergenic
1015655016 6:135508143-135508165 ATTAAGATGCAGAAGAGGGCGGG - Intergenic
1015684947 6:135849344-135849366 AAGAAGAAACAGGAGAGGGAAGG - Intergenic
1016354095 6:143198990-143199012 CTGCAGTAGCAGAAAAGGGAAGG + Intronic
1017055392 6:150431432-150431454 ATGTAGAACCAGAAGCAGGAGGG + Intergenic
1017587708 6:155945548-155945570 ATGAAGAAACGCAAGAGGGAGGG - Intergenic
1018005612 6:159619381-159619403 CTGCAGCAGCACAAGAGGCAGGG + Intergenic
1018377122 6:163223511-163223533 ATGGGAAAGCAGAAGAAGGATGG + Intronic
1018722946 6:166587711-166587733 ATTCAGAAGTAGAAGATGAAGGG + Intronic
1018758942 6:166873598-166873620 AGGCTGACGCAGAAGAGGGGAGG - Intronic
1018788267 6:167125683-167125705 AAGCAGAACCAGAAGAAAGAGGG - Intronic
1018818073 6:167350816-167350838 AGGCATAAGCAGAAGAGGAAAGG + Intronic
1018950244 6:168374300-168374322 AGCCAGTGGCAGAAGAGGGATGG - Intergenic
1019021907 6:168925920-168925942 AGGAAGGAGCAGAAGATGGAAGG - Intergenic
1019535356 7:1526402-1526424 AAGGAGAAGGAGAAGAGGGGAGG + Intergenic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1020179549 7:5911312-5911334 AAGCAGGAGGACAAGAGGGAGGG - Intronic
1020415465 7:7940961-7940983 AGGTAGAAGCAGAAGACTGAAGG - Intronic
1020666270 7:11047792-11047814 AGACAGAAGAAGAGGAGGGAGGG + Intronic
1021558089 7:21941979-21942001 TGGCAAAAGCAGAAGAGGAAGGG + Intronic
1022027313 7:26460581-26460603 AAGGAGAAGCAAGAGAGGGAAGG + Intergenic
1022500153 7:30877654-30877676 AAGAAGAAGAAGAAGAGGGAAGG - Intronic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1022675501 7:32495511-32495533 CTGCGGAAGCGGATGAGGGAAGG + Exonic
1023135681 7:37049418-37049440 ATGCAAAAGGAGAAGAGAGCTGG - Intronic
1023156115 7:37254117-37254139 ATGCAGGACCAGCAGAAGGAAGG + Intronic
1023565693 7:41521966-41521988 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1023931223 7:44707802-44707824 AGGCACATGCAGCAGAGGGATGG + Intronic
1024039348 7:45538478-45538500 ATGCAGAGCAAGAAGAAGGAAGG + Intergenic
1024947168 7:54820193-54820215 ATGCAGGTGGGGAAGAGGGAAGG + Intergenic
1025607550 7:63050288-63050310 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026380427 7:69793929-69793951 CTGCAGAGGCAGCAGAGTGATGG + Intronic
1026487610 7:70834987-70835009 AAGCAGGAGCAGGAGAGTGAGGG + Intergenic
1026979684 7:74519093-74519115 ATGCAGAGGCAGGAAGGGGAGGG + Intronic
1027532344 7:79352527-79352549 AAGCAGAAGCATGAGGGGGAAGG + Intronic
1027569555 7:79847237-79847259 ATGCAGAGCTGGAAGAGGGATGG - Intergenic
1027730908 7:81871380-81871402 ATTCTGAAGTAGAAAAGGGATGG + Intergenic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028628403 7:92904492-92904514 ATGCTGACTCAGAAGAGGGGTGG - Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030484907 7:110153029-110153051 ATGCAGAAGAAGAAAAGGCAAGG + Intergenic
1030749464 7:113212985-113213007 AAACAGAAGCAGAACAGGCAAGG + Intergenic
1030963242 7:115953523-115953545 CTGCAGACACAGAAGAGAGAAGG + Intronic
1031003674 7:116447250-116447272 TTGGAGACTCAGAAGAGGGAGGG + Intronic
1031675733 7:124610014-124610036 GGGCAGAATCTGAAGAGGGAGGG + Intergenic
1031689707 7:124772538-124772560 ATGCAGGGGGACAAGAGGGAAGG + Intergenic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1032839767 7:135704479-135704501 AGTCAGAAGCAGCAGAGTGAGGG + Intronic
1033056278 7:138057896-138057918 ATGCAGAAGTAGTGGATGGAAGG - Intronic
1033279427 7:139995348-139995370 ATGCACACGAAGATGAGGGATGG + Intronic
1033600484 7:142885383-142885405 CTGCTGCAGCAGAAGAGGTAAGG - Exonic
1034121630 7:148633228-148633250 ATGCAGGAGCAATAGAGGAAAGG - Intergenic
1034408880 7:150926437-150926459 ATGCTGGAGCAGACAAGGGAGGG + Intergenic
1035236792 7:157502538-157502560 GGCCAGAGGCAGAAGAGGGAGGG + Intergenic
1035543755 8:462732-462754 TTGGAGACTCAGAAGAGGGAAGG + Intronic
1035761983 8:2075252-2075274 AGGCACATGCAGAAGACGGAAGG - Intronic
1036588983 8:10150782-10150804 ATGCAGGAGCTGAAGAGAAAAGG - Intronic
1037387566 8:18359907-18359929 AGGCAGAAGAGGAAGATGGAAGG - Intergenic
1037552742 8:19990946-19990968 AAGCAGAAGATGATGAGGGAAGG - Intergenic
1037809037 8:22075310-22075332 AAGAAGAAGAAGAAGGGGGAGGG - Intronic
1037916074 8:22774260-22774282 ATGCAGAAGCCCAAAAGGAAGGG - Intronic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1038902954 8:31864584-31864606 GTGCAGGAGCAGAAGAATGAGGG + Intronic
1039431495 8:37528645-37528667 TTGCAGGAGCAGCAGAGAGATGG - Intergenic
1040579082 8:48681245-48681267 AGGGAGAATCTGAAGAGGGAAGG - Intergenic
1040621523 8:49097370-49097392 ATGCAAAAGGAGAGGAGGCAGGG + Intergenic
1041050429 8:53929134-53929156 AGGCAGAGGCATAAGAGGGAAGG + Intronic
1041056009 8:53986809-53986831 AAACAGAAGCAGAAGAGGATTGG - Intronic
1042102063 8:65284557-65284579 ATGCACAAAGGGAAGAGGGAGGG - Intergenic
1042704600 8:71652701-71652723 ATGCAGAAACAGCTCAGGGAAGG - Intergenic
1042911409 8:73831061-73831083 ATGAAGAAGTACATGAGGGAAGG - Intronic
1043068569 8:75608975-75608997 ATGCAGAAAAATAAGAGAGAAGG - Intergenic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043278360 8:78430752-78430774 ATGCAAGAGCACAAAAGGGAAGG + Intergenic
1043476515 8:80610839-80610861 AAGCAGAAAGAGGAGAGGGAGGG - Intergenic
1043919819 8:85968532-85968554 ATGGAGAAGGAGAACAGGTAGGG + Intergenic
1044143416 8:88683317-88683339 ATACAGAAATAGAATAGGGAAGG - Intergenic
1045302110 8:100920702-100920724 AAGCTGAAGCAGGAGAAGGAGGG - Exonic
1045377987 8:101594124-101594146 ATGCAGAGACACAAAAGGGAAGG + Intronic
1045974706 8:108119072-108119094 ATACATAAGCAGAACAGGGCTGG + Intergenic
1046077382 8:109329595-109329617 ATGCAGAAGGAGCAGAGAGATGG + Intronic
1046096689 8:109570953-109570975 CTAAAGAAGCAGGAGAGGGAGGG + Intergenic
1046347732 8:112956899-112956921 ATACAGATGCAGAAGATGAAAGG + Intronic
1046720352 8:117612100-117612122 ATCCAGAAACAGAAGACAGAAGG + Intergenic
1047830346 8:128622629-128622651 ATACAATAGCAGAATAGGGATGG + Intergenic
1047889185 8:129288458-129288480 ATAAAGACTCAGAAGAGGGAGGG + Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048156192 8:131955777-131955799 TTGCAGAAGGAGAAGAAGGAGGG - Exonic
1048298952 8:133237602-133237624 AAGAGGAAGCAGGAGAGGGAAGG + Exonic
1048473375 8:134722633-134722655 ATGAGGAAGCAGAGGAGGGGAGG + Intergenic
1048592464 8:135833476-135833498 GTGCAGAATCAGAAGAGGTCAGG - Intergenic
1048672672 8:136740556-136740578 AAGCAAAACCAGAAGAGGGAGGG + Intergenic
1049201435 8:141342495-141342517 CTGCTGAAGCAGACGAGTGAGGG + Intergenic
1049324361 8:142014410-142014432 AAGCAGAAGCAGTTGAGTGAAGG - Intergenic
1049443499 8:142619672-142619694 CTGCAGAGGCTGCAGAGGGAGGG - Intergenic
1049684548 8:143934092-143934114 CTGCAGCAGCAGCACAGGGAAGG + Intronic
1050128032 9:2379834-2379856 GAGCAGAAGCAAGAGAGGGAGGG - Intergenic
1050328532 9:4521749-4521771 ACACTGAGGCAGAAGAGGGAAGG + Intronic
1050413483 9:5390108-5390130 ATCCTGAAGCAGACGAGGGTTGG - Intronic
1051159671 9:14192612-14192634 ATGTCAAAGCAGAGGAGGGAAGG - Intronic
1051782135 9:20700967-20700989 AAGAAGAATCAGAAGTGGGAAGG - Intronic
1052280225 9:26724364-26724386 ATACAGAAGGTGAAGAGGAAAGG - Intergenic
1052323908 9:27196723-27196745 AAGCAGGAGCAGAAGAGTGAGGG + Intronic
1052434766 9:28412097-28412119 CTGGAGAATCAGAAGAGGGGAGG - Intronic
1053037827 9:34840535-34840557 AAGAAGAAGAAGAAGAAGGAAGG - Intergenic
1053046344 9:34922193-34922215 AAGCTGAAGCAGGAGAAGGAGGG - Intergenic
1053069222 9:35091334-35091356 ATGCAACAGCAGAAGTGGGAAGG + Exonic
1053097676 9:35342691-35342713 ATGCACATGCAGGAGAGGAATGG - Intronic
1053371805 9:37567850-37567872 CTGAGGACGCAGAAGAGGGAAGG - Intronic
1055264631 9:74480879-74480901 AGGAAGAAGCAGAAGACAGAGGG - Intergenic
1056678256 9:88695177-88695199 ATACTGAATGAGAAGAGGGAAGG + Intergenic
1056741856 9:89263516-89263538 ATACAGAAGAAGAAGAAGAAAGG - Intergenic
1057198473 9:93127942-93127964 ATACAGAACCAGCAGAGGGCAGG + Intronic
1057899914 9:98940525-98940547 AGGCAGATGAAGAACAGGGAGGG - Intergenic
1058572802 9:106365732-106365754 GTGCAGAAGCTGAGGAGGCAGGG - Intergenic
1058696595 9:107564275-107564297 ATGAAAAAGGAAAAGAGGGAAGG + Intergenic
1058835595 9:108856241-108856263 ACCAAGAAGCAGAAGAGGAAAGG - Exonic
1059058005 9:111004727-111004749 AAGCAGAAGTAGAATAGGAAAGG - Intronic
1059418691 9:114177799-114177821 CTGCAGAATCAGAACAGAGAAGG - Intronic
1059433957 9:114265489-114265511 GCAAAGAAGCAGAAGAGGGAAGG - Intronic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060516921 9:124271728-124271750 ATGCAGATGCAGCAGACGGTGGG - Intronic
1060769810 9:126324555-126324577 AAGAAGAAGAAGAAGAAGGAAGG + Intergenic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061805622 9:133136222-133136244 AGGCAAAAACAGAACAGGGAAGG + Intronic
1062107231 9:134762381-134762403 TTGGAGGAGCAGAAGAGGGTGGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062566235 9:137165115-137165137 ATGCAGGAGCAGGCGAGGGCAGG + Intronic
1203773478 EBV:60837-60859 GTGCAGAAGACGAAGAGGGCGGG - Intergenic
1185589845 X:1268749-1268771 ATGAGGAAGCAGGGGAGGGAGGG + Intergenic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1185972595 X:4681867-4681889 AGGAAGAAGGAGAGGAGGGAAGG + Intergenic
1186069961 X:5808805-5808827 AGGAAGCAGCAGGAGAGGGAGGG - Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186315206 X:8362257-8362279 AAGCTGAAGAAGAATAGGGAGGG - Intergenic
1186444024 X:9610605-9610627 ATGCAGAAGCAGCAAAAGAATGG - Intronic
1189060821 X:37751898-37751920 GAGCAGGAGCAAAAGAGGGACGG + Intronic
1189146313 X:38658662-38658684 AAACAGAAGCAGAAGATGGTGGG - Intronic
1189512365 X:41675766-41675788 AAGCTGAAGCAGGAGAAGGAGGG - Intronic
1189575801 X:42351932-42351954 ATGAAGACACAGAAGAGTGAGGG - Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192956535 X:76076386-76076408 ACTCAGAAGCAGCAGAGGAAAGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193841109 X:86409543-86409565 ATGTAGGAGCAGGAGAGAGAAGG - Intronic
1193992356 X:88323612-88323634 TTGTAGTATCAGAAGAGGGAAGG - Intergenic
1196023188 X:111011664-111011686 CTGCAGAAGCAGAAGAACGGAGG - Intronic
1196517906 X:116634822-116634844 ATCCATATGCAGAAGAGTGAAGG + Intergenic
1196938296 X:120751203-120751225 AGGAAAAAGGAGAAGAGGGAGGG - Intergenic
1197289066 X:124632556-124632578 AGAGAGAAGGAGAAGAGGGATGG - Intronic
1197430322 X:126354936-126354958 ATTAAGAATCAGAAGAGGCAGGG + Intergenic
1198021428 X:132662230-132662252 ATGAACAAACAGATGAGGGAAGG + Intronic
1198105031 X:133453961-133453983 TTGGAGATGCAGAAGAGGGTAGG - Intergenic
1198717458 X:139573510-139573532 AAGCAGGAGCAGGAGAGTGATGG - Intergenic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1198767210 X:140091743-140091765 ATGGAGGAGCAGCAGAAGGAGGG + Intergenic
1198795007 X:140385273-140385295 AAGCAAAAGCAGAAGAGGGAGGG - Intergenic
1198916206 X:141675274-141675296 ATCAAGAGGCAGAAAAGGGAAGG - Intronic
1199297043 X:146171140-146171162 TTGCAGATGAAGGAGAGGGATGG - Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1199768255 X:150956340-150956362 ATGCAGCCGCAGACCAGGGAAGG - Intergenic
1200803837 Y:7411740-7411762 CAGCAGAGACAGAAGAGGGAAGG - Intergenic
1200944454 Y:8819706-8819728 ATCAAGAGGCAGAAAAGGGAAGG - Intergenic
1201452070 Y:14127767-14127789 ATGGAGAAAAAGAAGAGGAAAGG - Intergenic
1201461675 Y:14232565-14232587 AAGAAGAAGCAGAAGAAGGAAGG - Intergenic
1201894870 Y:18982535-18982557 ATGCAGTAGGAGAGCAGGGATGG - Intergenic
1202110802 Y:21417196-21417218 ATGTAGTAGGAGAAGAGAGAAGG + Intergenic