ID: 1019751037

View in Genome Browser
Species Human (GRCh38)
Location 7:2729942-2729964
Sequence CTCGGATGCCGCTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019751037_1019751044 18 Left 1019751037 7:2729942-2729964 CCCCCAGGACAGCGGCATCCGAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1019751044 7:2729983-2730005 AGCACAGTCATAGAAGCGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1019751037_1019751042 16 Left 1019751037 7:2729942-2729964 CCCCCAGGACAGCGGCATCCGAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1019751042 7:2729981-2730003 CAAGCACAGTCATAGAAGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 99
1019751037_1019751043 17 Left 1019751037 7:2729942-2729964 CCCCCAGGACAGCGGCATCCGAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1019751043 7:2729982-2730004 AAGCACAGTCATAGAAGCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019751037 Original CRISPR CTCGGATGCCGCTGTCCTGG GGG (reversed) Exonic