ID: 1019751037

View in Genome Browser
Species Human (GRCh38)
Location 7:2729942-2729964
Sequence CTCGGATGCCGCTGTCCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 100}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019751037_1019751042 16 Left 1019751037 7:2729942-2729964 CCCCCAGGACAGCGGCATCCGAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1019751042 7:2729981-2730003 CAAGCACAGTCATAGAAGCGAGG 0: 1
1: 0
2: 0
3: 9
4: 99
1019751037_1019751044 18 Left 1019751037 7:2729942-2729964 CCCCCAGGACAGCGGCATCCGAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1019751044 7:2729983-2730005 AGCACAGTCATAGAAGCGAGGGG 0: 1
1: 0
2: 0
3: 8
4: 82
1019751037_1019751043 17 Left 1019751037 7:2729942-2729964 CCCCCAGGACAGCGGCATCCGAG 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1019751043 7:2729982-2730004 AAGCACAGTCATAGAAGCGAGGG 0: 1
1: 0
2: 0
3: 7
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019751037 Original CRISPR CTCGGATGCCGCTGTCCTGG GGG (reversed) Exonic
900372909 1:2340157-2340179 CTCGGAGGCTGCTGTCCCTGGGG + Intronic
900547923 1:3238794-3238816 CCCGGAGGCCTCTGTCCTGCCGG + Intronic
900996423 1:6125665-6125687 CTGGGGTCCCGCTGTCCTTGGGG - Intronic
901672023 1:10861691-10861713 CTGGGATGCCCCTTTCCTGGGGG - Intergenic
901676931 1:10890800-10890822 CTCGGAAGCAGCTTTCCTGGGGG + Intergenic
901843922 1:11970663-11970685 CCTGGATGCGGTTGTCCTGGAGG - Exonic
903328910 1:22586928-22586950 CAGCGATGCCGATGTCCTGGGGG + Intronic
903567956 1:24283351-24283373 CTCCCATGCTGCTGCCCTGGAGG + Intergenic
903694064 1:25194692-25194714 CGCGGCTGCCGCAGCCCTGGGGG - Intergenic
903809943 1:26029593-26029615 CTGGGATGCAGCCGGCCTGGGGG - Exonic
904580309 1:31538480-31538502 TTAGGAGGCCGGTGTCCTGGTGG + Intergenic
908566855 1:65365778-65365800 CTGGGACACCGCTGTCCAGGGGG - Intronic
916879028 1:169000886-169000908 CACAGATGTCTCTGTCCTGGTGG - Intergenic
917968147 1:180191416-180191438 CTGGGATGCTCCTCTCCTGGCGG - Intronic
923665182 1:235993032-235993054 GTGGGAAGCTGCTGTCCTGGGGG - Intronic
1073249803 10:102114595-102114617 CGCGGCGGCCGCTGTCCCGGGGG + Intronic
1075967625 10:126626270-126626292 CTAGGATGCTTCTGTCCTGAGGG - Intronic
1076882761 10:133247637-133247659 CTGGGAGGTGGCTGTCCTGGGGG + Intergenic
1077116871 11:889151-889173 CTGGGAGGACGCTGTTCTGGAGG - Intronic
1077466665 11:2736747-2736769 CTGGTATGCGGCTGCCCTGGTGG + Intronic
1078042944 11:7884846-7884868 CTCAGAAGCCCCTGTCCCGGTGG - Intergenic
1084524061 11:69684986-69685008 CTGGGATGCTGCTGTCCAGTTGG - Intergenic
1086953693 11:92915274-92915296 CTCAGATCCTGTTGTCCTGGGGG + Intergenic
1091693562 12:2612824-2612846 CTCAGAAGCAGCTGTCCTGGTGG - Intronic
1091897389 12:4116548-4116570 CTCAGGTGCTGCTGTCCTGCAGG + Intergenic
1096106741 12:49000422-49000444 TTGGGCTGCCTCTGTCCTGGGGG + Intergenic
1097692285 12:62744762-62744784 CTGGGCTGCAGCTGTCCTGGCGG - Intronic
1102454500 12:113063344-113063366 CTCGGAGGCGGCTGTCCCAGTGG - Intronic
1103972625 12:124681691-124681713 GGCGGATGCTGCTGGCCTGGGGG - Intergenic
1112456118 13:99565529-99565551 CTTGGATCCCGCCGTCCTGAGGG + Intergenic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113571507 13:111361490-111361512 CTCGGATGCAGATGTCTTTGGGG - Intergenic
1118846939 14:69554582-69554604 CTGGGATGGAGCAGTCCTGGTGG + Intergenic
1120921273 14:89757623-89757645 CTCGGAGGCCCCTTTCCTTGGGG - Intergenic
1122782844 14:104150872-104150894 CTGGGCTGGTGCTGTCCTGGGGG + Intronic
1124497686 15:30196305-30196327 CTCGCATGGGGCTGTCTTGGGGG + Intergenic
1124745900 15:32342386-32342408 CTCGCATGGGGCTGTCTTGGGGG - Intergenic
1128931095 15:71705521-71705543 GTCAGATGTTGCTGTCCTGGAGG + Intronic
1136230437 16:28882666-28882688 CTCGGATCCAGGTGTCCAGGAGG + Intronic
1137013182 16:35344530-35344552 TGCGGATGCCGCTGGCCGGGTGG - Intergenic
1137604694 16:49779727-49779749 CAAGGATCCCGCTGTCCTGCTGG - Intronic
1139319705 16:66104447-66104469 ATGGGATGCAGCTGTCCTGGTGG + Intergenic
1141759666 16:86019660-86019682 CCTGGAAGGCGCTGTCCTGGGGG - Intergenic
1142992824 17:3743145-3743167 CTCTGATGACGCTGTGATGGGGG - Intronic
1145014295 17:19386766-19386788 CTCGGATCCCGGAGACCTGGGGG + Exonic
1145206980 17:20989827-20989849 CTGGGAGGCCGATGTCCTGCTGG + Intergenic
1148838632 17:50479931-50479953 CACGGTGGCTGCTGTCCTGGAGG + Exonic
1149424382 17:56540959-56540981 CACCGAAGCCGCAGTCCTGGTGG - Intergenic
1153664343 18:7354818-7354840 CTTGGATGCCACTGTCTTGCAGG + Intergenic
1154173592 18:12067747-12067769 CTCGGATGCCCCTGGGCTCGTGG + Intergenic
1156808516 18:41218030-41218052 CTCTGATGCTGCTATTCTGGAGG - Intergenic
1157088903 18:44612246-44612268 TTCAGAGGCCACTGTCCTGGAGG + Intergenic
1160764783 19:802579-802601 CTGGGATGGCCCTGTCCTGGGGG + Intronic
1161889024 19:7020173-7020195 CTGGGATCCCGGTGTCCTGTTGG - Intergenic
1161890341 19:7031840-7031862 CTGGGATCCCGGTGTCCTGTTGG + Intronic
1161891107 19:7038893-7038915 CTGGGATCCCGGTGTCCTGTTGG - Intronic
1161892430 19:7050576-7050598 CTGGGATCCCGGTGTCCTGTTGG + Intronic
1161893192 19:7057354-7057376 CTGGGATCCCGGTGTCCTGTTGG - Intronic
1163729275 19:18940336-18940358 CTCGGATGCCGCCGGCCACGGGG + Intronic
1167602834 19:50464660-50464682 CTGGGAAGCTGCTGTCCTGAAGG + Intronic
925070058 2:959720-959742 CTCGGGTGCCGCTGTGCAGATGG + Intronic
926327376 2:11796994-11797016 CTGGGATGGAGCTGGCCTGGAGG + Intronic
937670902 2:124536337-124536359 CACCGATGCTGCAGTCCTGGGGG - Intronic
946999239 2:225434243-225434265 CTAGGATGCTGCTGTACTGGAGG - Intronic
948723966 2:239920432-239920454 CTCGGATGCTCCTGTCCCTGGGG - Intronic
948981457 2:241496923-241496945 CTCAGATGCTGGTGTCCTGATGG - Intronic
1169196110 20:3682589-3682611 ACCGGCTGCCGCTGTCTTGGGGG + Intergenic
1171500921 20:25592702-25592724 CTTGCCTGCTGCTGTCCTGGGGG + Intergenic
1172189785 20:33054979-33055001 CTCTCATCCTGCTGTCCTGGAGG + Intergenic
1172512658 20:35511500-35511522 CCCTGAGGCCACTGTCCTGGAGG + Exonic
1172539354 20:35699164-35699186 CTCGGGTCCCGCTCTCCGGGAGG - Intronic
1173876336 20:46374535-46374557 CCCGGATGTAGGTGTCCTGGTGG + Exonic
1174548673 20:51345366-51345388 TTCTGATGCCAGTGTCCTGGAGG + Intergenic
1176079579 20:63265521-63265543 CTGGGATGCCTCTCTCCTGCAGG - Intronic
1179710181 21:43208827-43208849 CTGGGATGCCTGTCTCCTGGAGG - Intergenic
1179896228 21:44365253-44365275 ATTGGGTGCCACTGTCCTGGAGG + Intronic
1184697398 22:46147693-46147715 CTCAGAGGCCACTGCCCTGGCGG + Intergenic
1185391360 22:50563033-50563055 CTCGGACGCCGCAGACCTGTGGG - Intergenic
949594725 3:5531840-5531862 CTAGGAACCTGCTGTCCTGGAGG + Intergenic
954660829 3:52225997-52226019 GTCGGCAGCCGCTGTCCTGAGGG - Exonic
968309935 3:197675026-197675048 CCTGGAAGCCGCCGTCCTGGAGG - Exonic
969979573 4:11140881-11140903 CTTGGATGACTCTATCCTGGGGG - Intergenic
999385424 5:151150781-151150803 CTCGGTTTCCTCTGACCTGGGGG + Intronic
1017108405 6:150909811-150909833 CTGGGATGCTGATGTGCTGGGGG + Intronic
1018213176 6:161501925-161501947 CTAAGATGCGGCTGTTCTGGGGG + Intronic
1019751037 7:2729942-2729964 CTCGGATGCCGCTGTCCTGGGGG - Exonic
1023674506 7:42616139-42616161 CGAGGCTGCTGCTGTCCTGGTGG - Intergenic
1024992009 7:55242164-55242186 CTCGGTGCCCGCTGTTCTGGTGG + Intronic
1029485197 7:100836089-100836111 CTGGGATGCTGCTGGCATGGGGG - Intronic
1029670850 7:102029723-102029745 CTGGGATGCAGGTGTCCTGCTGG - Intronic
1035335734 7:158126184-158126206 TTCCGCCGCCGCTGTCCTGGGGG - Intronic
1035932998 8:3805137-3805159 ATGGGATGCTGCTGTCCTAGTGG - Intronic
1036186378 8:6626010-6626032 CTCGGATGCTGCAGTCCCAGGGG - Intronic
1036688776 8:10928311-10928333 CGCGGCTGCTGCTGTCCTCGAGG + Intronic
1038313824 8:26466028-26466050 CTTCGATGCCTCTGTCCTGATGG + Intronic
1039970368 8:42316799-42316821 CTGGGATGCCCGTGTCCTGTTGG - Exonic
1043492043 8:80759555-80759577 CTCTGATGACGTTGTCATGGTGG + Intronic
1048563062 8:135563469-135563491 CTCAGAACCCCCTGTCCTGGTGG + Intronic
1049579805 8:143406200-143406222 CTGGGGTGCAGCTGTCTTGGCGG - Intergenic
1049779540 8:144422508-144422530 CCTGGATCCTGCTGTCCTGGGGG + Intergenic
1054781345 9:69168874-69168896 GTTAGATGCCGCTCTCCTGGAGG + Intronic
1056563233 9:87751079-87751101 CTAGGATTCCTGTGTCCTGGGGG + Intergenic
1059116324 9:111603049-111603071 CACTGATGCAGCTGTCCTGAAGG - Intergenic
1059510898 9:114845557-114845579 CTCCGCTGCCGCTGTGGTGGTGG - Intergenic
1061953748 9:133950831-133950853 CTCGGAGGCCGCTTTCCGGAAGG - Intronic
1062007828 9:134250300-134250322 CTCGTTTCCCGCAGTCCTGGAGG - Intergenic
1187268441 X:17758834-17758856 ATCTGATGCTGCTTTCCTGGAGG + Intergenic
1189497637 X:41523737-41523759 CTGGGATGCCTCGGTCCTGGTGG + Intronic
1197415147 X:126165465-126165487 CATGGATGCCGCAGCCCTGGTGG + Exonic
1200150002 X:153946706-153946728 CTGGGAAGCCTCTGTCCTGTGGG - Intergenic