ID: 1019758683

View in Genome Browser
Species Human (GRCh38)
Location 7:2792417-2792439
Sequence CACCCTGCACTGACGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019758679_1019758683 -9 Left 1019758679 7:2792403-2792425 CCTTCCAGCACTGACACCCTGCA 0: 1
1: 0
2: 2
3: 40
4: 301
Right 1019758683 7:2792417-2792439 CACCCTGCACTGACGGAACAGGG No data
1019758677_1019758683 7 Left 1019758677 7:2792387-2792409 CCTAAATTGGGAGGTCCCTTCCA 0: 1
1: 0
2: 0
3: 10
4: 201
Right 1019758683 7:2792417-2792439 CACCCTGCACTGACGGAACAGGG No data
1019758678_1019758683 -8 Left 1019758678 7:2792402-2792424 CCCTTCCAGCACTGACACCCTGC 0: 1
1: 1
2: 3
3: 41
4: 287
Right 1019758683 7:2792417-2792439 CACCCTGCACTGACGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019758683 Original CRISPR CACCCTGCACTGACGGAACA GGG Intronic
No off target data available for this crispr