ID: 1019759084

View in Genome Browser
Species Human (GRCh38)
Location 7:2795860-2795882
Sequence CTCCATTGCACTCCAGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2920
Summary {0: 1, 1: 0, 2: 27, 3: 317, 4: 2575}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019759084_1019759088 11 Left 1019759084 7:2795860-2795882 CCCTGGCCTGGAGTGCAATGGAG 0: 1
1: 0
2: 27
3: 317
4: 2575
Right 1019759088 7:2795894-2795916 CACTGCAACCTCCGCCTCCCAGG 0: 33522
1: 160300
2: 208179
3: 148545
4: 88541

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019759084 Original CRISPR CTCCATTGCACTCCAGGCCA GGG (reversed) Intronic
Too many off-targets to display for this crispr