ID: 1019759531

View in Genome Browser
Species Human (GRCh38)
Location 7:2800138-2800160
Sequence TCCCATTTGTTGCTGGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019759531_1019759535 4 Left 1019759531 7:2800138-2800160 CCATTACCCAGCAACAAATGGGA 0: 1
1: 0
2: 0
3: 25
4: 143
Right 1019759535 7:2800165-2800187 ACTACGGAAATGCAACAACTTGG No data
1019759531_1019759536 17 Left 1019759531 7:2800138-2800160 CCATTACCCAGCAACAAATGGGA 0: 1
1: 0
2: 0
3: 25
4: 143
Right 1019759536 7:2800178-2800200 AACAACTTGGATGAAGCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019759531 Original CRISPR TCCCATTTGTTGCTGGGTAA TGG (reversed) Intronic
902810965 1:18887619-18887641 TATCATATCTTGCTGGGTAAAGG + Intronic
904621515 1:31778148-31778170 TCACTTTTGGTGCTGGGTGAAGG - Intergenic
904908674 1:33917510-33917532 TCTCAGTTGTTGATGGGTTAGGG - Intronic
905339924 1:37271539-37271561 TCCCATTTGCTGATGGTCAAGGG - Intergenic
911175484 1:94813263-94813285 TCTCATTCGTTGCTGGGTCAGGG + Intergenic
911331996 1:96535461-96535483 TTCCATTTGTGGCTGGATTATGG - Intergenic
912322329 1:108726010-108726032 TCCCATTTGATGTTTGTTAAGGG + Intronic
914676809 1:149912373-149912395 TCTCATTTGTTCCTGGGGAAAGG + Intronic
915724653 1:158008695-158008717 TCCCACATGGTGCTGAGTAAAGG - Intronic
915979457 1:160410895-160410917 TCCCTTTGGATGCTGGGTATGGG + Intronic
918921273 1:190713341-190713363 CACCATCTGTTGCTGGGTTAGGG + Intergenic
919012738 1:191986293-191986315 TTCCATTTGTGGCTGGGGAAGGG - Intergenic
921301229 1:213753349-213753371 TCCCATTACTTTCTGGGTGATGG + Intergenic
921789350 1:219271975-219271997 TCTCATTTGCTGCTGGGTGTGGG - Intergenic
923976605 1:239271301-239271323 TTCCATTAGTCCCTGGGTAATGG + Intergenic
1064121852 10:12625637-12625659 CCCCATTTCTTACTGTGTAATGG + Intronic
1069789980 10:71013221-71013243 TCCCATGTGATGCTGGGCACAGG - Intergenic
1071954317 10:90741350-90741372 TACCATTTTTTGGTGGGTAGGGG + Exonic
1073095111 10:100974770-100974792 TCCCATGTCTGGCTAGGTAATGG + Intronic
1075489826 10:122857018-122857040 TCCTATTTCTTGCTGGCTAATGG + Intronic
1079863100 11:25698974-25698996 TCCCATTTATTGATTTGTAAAGG - Intergenic
1080023832 11:27593214-27593236 GCTCATTGGTTGCTGGGAAATGG + Intergenic
1081212860 11:40357607-40357629 TCTATTTTTTTGCTGGGTAATGG - Intronic
1081688339 11:45058094-45058116 TTCCAGTTGCTGCTGGGTGATGG + Intergenic
1086964713 11:93015856-93015878 TCCCCTTTGATGATGGGCAATGG - Intergenic
1087061619 11:93984261-93984283 TCCCAGATGTTGCTGATTAATGG - Intergenic
1089458315 11:118638619-118638641 ACCCATTGGTTGTAGGGTAAGGG + Intronic
1090051721 11:123385814-123385836 TCCCATTGGTTGCTGGAGATCGG + Intergenic
1093877053 12:24361230-24361252 TCCCATTTCTTGCTCAGTGATGG + Intergenic
1101051021 12:100864266-100864288 CCCCATTTGGAGCTGGGTATGGG + Intronic
1101504777 12:105336196-105336218 TCACATTGGTTGCAGGGTATTGG + Intronic
1104274924 12:127317899-127317921 TCTCATCTGTTGCTGGGTCAAGG - Intergenic
1107434265 13:40367971-40367993 TATAATTTGTGGCTGGGTAAGGG + Intergenic
1107975312 13:45682570-45682592 TCCCATTTCTTGTTAGGGAAGGG + Intergenic
1108633582 13:52310736-52310758 TCCCATGTGATGGTGGGTATGGG + Intergenic
1108633980 13:52314427-52314449 TCCCATGTGATGGTGGGTATGGG + Intergenic
1113418162 13:110147424-110147446 TCCCATTGGTTGCTGGTGGAAGG + Intergenic
1116666863 14:47787719-47787741 TGCCATTTGTAGCTGGGTGTGGG + Intergenic
1119209627 14:72821410-72821432 TCCCTTTTGTTGGTGGAGAATGG - Intronic
1121135070 14:91489917-91489939 TCCCATTGGGTGATGCGTAAAGG - Intronic
1122651572 14:103229659-103229681 TCACATTTCTTGCTGGGTTGGGG - Intergenic
1123440108 15:20284474-20284496 TCCAATTTCTTTCTGTGTAAAGG + Intergenic
1123758051 15:23412252-23412274 TCTCATTTGTGGGTGGGTAATGG + Intergenic
1124125301 15:26933738-26933760 TCCCATTTGATCTTGGGCAAGGG + Intronic
1124249535 15:28097759-28097781 TCCCAGTTGGTGATGGGTGATGG - Intronic
1124614800 15:31233949-31233971 TTGCATTTGTTGGTGGGAAATGG + Intergenic
1127536055 15:59890857-59890879 TGTCATTTTTTTCTGGGTAAAGG - Intergenic
1128234150 15:66056089-66056111 TCCCAATAGTAGCTGGGGAAGGG - Intronic
1131431128 15:92390241-92390263 TCCCACATGTTGCTGGGTCAGGG + Intergenic
1134458292 16:14410642-14410664 TGTCATTTGTTGGTGGGTCATGG - Intergenic
1136845065 16:33569961-33569983 TCCAATTTCTTTCTGTGTAAAGG - Intergenic
1138639445 16:58371813-58371835 TCTCTTTTGATGCTGGGCAAGGG - Intronic
1139033101 16:62909659-62909681 TCCCATTTGTGCCTTGATAAAGG - Intergenic
1139482422 16:67237816-67237838 TGCCAGCTGTTGCTGGGGAAGGG + Intronic
1140511774 16:75513704-75513726 TGCCATTTGTCGTTGGGTGATGG - Intergenic
1141678228 16:85528970-85528992 TCCCATTTGATTCTGAGTAAAGG - Intergenic
1203106773 16_KI270728v1_random:1418614-1418636 TCCAATTTCTTTCTGTGTAAAGG - Intergenic
1203155233 16_KI270728v1_random:1870259-1870281 TCCAATTTCTTTCTGTGTAAAGG - Intergenic
1147605919 17:41773632-41773654 TCCCCTCTGTTGCTGGGGAAGGG - Intronic
1150992509 17:70276107-70276129 GCACATTTGTTGCTGGATAATGG + Intergenic
1152330973 17:79672868-79672890 TTCCACCTGGTGCTGGGTAAAGG - Intergenic
1153264724 18:3258911-3258933 TCCCGTTTGTTGCTACGTCATGG + Intergenic
1158866491 18:61642813-61642835 TCCCATTTCTCCCTGAGTAAAGG + Intergenic
929693925 2:44098317-44098339 TCCCTTTTGTTGCAGGGTTGTGG - Intergenic
929869724 2:45748573-45748595 TCCCATTGAAGGCTGGGTAAAGG - Intronic
932601960 2:73133709-73133731 TCCCATTTTCCTCTGGGTAATGG - Intronic
932805833 2:74782649-74782671 TCCCATTTGTTGCTTTCTACTGG + Intergenic
933110295 2:78390673-78390695 TCCCATTTGATGGTGGTGAATGG + Intergenic
933667262 2:84973365-84973387 CCCCATTTGGTGCTGTGCAAAGG + Intronic
936257839 2:110932734-110932756 TCCCACTTTGTGCTGGGTCAAGG + Intronic
938314078 2:130314602-130314624 GGCCTTTTGTTGCTGGGCAATGG + Intergenic
938579835 2:132635937-132635959 GCCGATTTGGTGCTGGGTGAGGG - Intronic
938913675 2:135911988-135912010 TCTCATTAGTTGCTGTGGAATGG - Intronic
942086038 2:172444765-172444787 TCCCCTTTATTGCTGGGTTGTGG - Intronic
942585571 2:177472631-177472653 TCCTATTTGTTACTTGGAAAGGG + Intronic
942977961 2:182041796-182041818 GACATTTTGTTGCTGGGTAAAGG - Intronic
943161650 2:184261416-184261438 TCTCAATTTTTGCTGGGTATAGG - Intergenic
943587041 2:189753082-189753104 TCCCATTTTGAGATGGGTAATGG + Intronic
944223589 2:197326709-197326731 AGCCATTTGTTGTTTGGTAAGGG - Intergenic
945071748 2:205996827-205996849 TCCCTTCAGTTGCTGGTTAATGG - Exonic
945193857 2:207219361-207219383 ACCCATTTGATGCTGGGTTAGGG - Intergenic
945279324 2:208020784-208020806 CCCCATTGGTTGCTGGCCAAAGG - Intronic
947523908 2:230867023-230867045 TTCCATTTCATGCTGGGTGAGGG - Intronic
947696011 2:232189807-232189829 TACCATTGGTAACTGGGTAAAGG + Intronic
948446884 2:238039992-238040014 CCCCCTTTGTTGCGGGGTAAAGG + Intronic
1168840845 20:909131-909153 CCCCATTTATTGCGGGGAAACGG - Intronic
1169140852 20:3226856-3226878 GCTCATTTGTTGGTGGGTCAGGG - Intergenic
1171390963 20:24801561-24801583 TCCCATTTCTTGTTGGGTCAAGG + Intergenic
1172178136 20:32984918-32984940 TCCCATTTGGCCCTGGGTAGCGG + Intronic
1172282468 20:33717907-33717929 TACCTTTTGTTGATGGGAAAAGG - Intronic
1172514960 20:35527035-35527057 TCCTATTTCTGGGTGGGTAAAGG - Exonic
1174202474 20:48816676-48816698 CCCCATTTTTTGCAGGGTATTGG - Intronic
1177933134 21:27310536-27310558 TCCCATTAAAAGCTGGGTAAAGG - Intergenic
1180904016 22:19395732-19395754 TCCCATTAGTTGCATGATAATGG - Intronic
1182096177 22:27627491-27627513 TCCCCTTTGTTGTTGGTTAGGGG - Intergenic
1182213325 22:28694873-28694895 TCCAATTTCTTTCTGTGTAAAGG - Intronic
1182304973 22:29361695-29361717 TTCCATTTAGTGCTGGGTGATGG + Intronic
1182907439 22:33950292-33950314 CCCCTTTAGTTGCTGGATAATGG - Intergenic
1183150441 22:36032809-36032831 TCTCATTTCTTGCTGGGTCAGGG - Intergenic
1185258993 22:49851334-49851356 TCCCAGTTGATGCTGGGTCCTGG + Intergenic
953727285 3:45411100-45411122 ATTCATTTGTTGCTGGGTCAGGG - Intronic
955025768 3:55165947-55165969 TCCCATTTCCTGCTGGGACATGG - Intergenic
955875520 3:63486314-63486336 TCACATTTGTCATTGGGTAAGGG - Intronic
960016855 3:112900767-112900789 TGCCTTCTGTTACTGGGTAAAGG + Intergenic
960954540 3:123022634-123022656 TCCAATTTGCTGCTGGGCACAGG - Intronic
961243170 3:125429886-125429908 TCACATTTGGTGCTGGCTGATGG - Intergenic
962263795 3:133931333-133931355 TCCCATTTGAGGCTGTTTAATGG - Intergenic
964813717 3:160694201-160694223 TCCCATTATGTGCTGGGAAAGGG + Intergenic
966408471 3:179623905-179623927 TTCCATTTGTTACAGGGTAAAGG + Exonic
972563464 4:40248907-40248929 TCACATTTCATTCTGGGTAAAGG - Intergenic
973164301 4:47057520-47057542 TCCAATTTGTTCCTGTGTAAAGG - Intronic
973314783 4:48748582-48748604 TCCCATCTGTAGCTGGGGAAAGG - Intronic
975463066 4:74677121-74677143 TACAATTTGTTGATGGGTAATGG + Intergenic
976202396 4:82592376-82592398 ACCCATATGTTGCTGGGGCAGGG + Intergenic
976535807 4:86215229-86215251 TTGCATTTGTTGTTAGGTAAAGG - Intronic
977051626 4:92135483-92135505 TCCCATTAGATGGTGGGTGAAGG + Intergenic
979410075 4:120366849-120366871 TCCCATTTGTTGTGAAGTAATGG + Intergenic
981163598 4:141529942-141529964 TCCCCTTTTTTGCAGGGTACGGG - Intergenic
982200104 4:152951748-152951770 TCCCGTTTGTTTTTTGGTAACGG - Intronic
990183892 5:53192020-53192042 TCCCATATGCTGATGGGCAAAGG + Intergenic
992225783 5:74618790-74618812 TCCCATTTGGTAGTGGGTAGTGG + Intergenic
998776723 5:145611490-145611512 TTCTATTAGTTGCTGGGTTATGG - Intronic
999854967 5:155584247-155584269 TACCTTGTGATGCTGGGTAAAGG + Intergenic
1000248027 5:159465969-159465991 TCCTATTTGTTGACGGGGAAAGG + Intergenic
1001797144 5:174511853-174511875 TCTCATCTGTTGCTGTGGAATGG + Intergenic
1004503535 6:16229439-16229461 TCCCATTTGTTCCCTGGTCACGG + Intergenic
1005242127 6:23843126-23843148 TCACATTTGTTTCTGTGAAATGG - Intergenic
1007575522 6:42923199-42923221 TGCCATCCGTTGCTGGGGAAGGG - Exonic
1008443407 6:51559073-51559095 TCCCACTGGTTGCTGAGTAAGGG + Intergenic
1008493734 6:52112054-52112076 TCCCATCTTATGCTGAGTAAAGG - Intergenic
1012213910 6:96558106-96558128 TCCCATTTGTTTCTGTGAAATGG - Intergenic
1012539118 6:100339940-100339962 TCCCCTTTGTTCCTGGGTTTAGG + Intergenic
1012547971 6:100441139-100441161 TCCCTTTAGTTCCTGGGTAGAGG - Intronic
1014808079 6:125854017-125854039 TCCAATTTGATGTTGGGCAATGG - Intronic
1018399384 6:163407012-163407034 TGCCTTTGGTTGCTGGGTTAGGG + Intergenic
1019759531 7:2800138-2800160 TCCCATTTGTTGCTGGGTAATGG - Intronic
1020617759 7:10480750-10480772 TCCCATTGGTTGACGGATAAGGG + Intergenic
1020855944 7:13422656-13422678 TTTCTTTTGTTGCTGGGTACTGG - Intergenic
1021519004 7:21519846-21519868 TCCCCTTAGTTGCTGGGTTCTGG + Intergenic
1021815541 7:24444016-24444038 GCCTATTAGTTGCTGGGTAGTGG + Intergenic
1022405173 7:30082483-30082505 TCCCATTTGTAGCTGGAAAGCGG + Exonic
1022684262 7:32580901-32580923 TCCAATTTGTTCCTGGCTAAAGG - Intronic
1023350409 7:39315114-39315136 TCCCATTTGTTGTTGAGTAGGGG + Intronic
1025845077 7:65188806-65188828 TCCCAATTGTTGCTGAGGAAGGG + Intergenic
1025895353 7:65694834-65694856 TCCCAATTGTTGCTGAGGAAGGG + Intergenic
1026102126 7:67392114-67392136 TTCCATTTAGTGCTGGGAAATGG + Intergenic
1031385011 7:121138790-121138812 TTCCCTTTGTGCCTGGGTAATGG + Intronic
1033726742 7:144126861-144126883 TCCCATTTGGAGGTGGGGAAGGG - Intergenic
1033776718 7:144619680-144619702 TTTCATCTGTTGCTGGGTCAGGG + Intronic
1035573029 8:686710-686732 TCCCACTTGTGGGTAGGTAAAGG + Intronic
1035780292 8:2222573-2222595 ACCTATTGGTTGCTGGGCAAGGG - Intergenic
1037552367 8:19986724-19986746 TCCCATTTGTAGGTGGATATGGG - Intergenic
1042860662 8:73309978-73310000 TCCCATTTGTAGCTGAGTTTGGG - Intronic
1044766938 8:95586508-95586530 TACCATTTTTTGGTGGGTAGGGG - Intergenic
1049033431 8:140054764-140054786 TTCAATTTGTTGTTGTGTAATGG - Intronic
1051231641 9:14961441-14961463 TCCCATTTGCTGCGGAGCAAAGG - Intergenic
1051746138 9:20297119-20297141 TCCCACTTGTTGGTGGGTTTAGG - Intergenic
1051938103 9:22468998-22469020 TCCCATTCTTTGTTGAGTAATGG + Intergenic
1052303104 9:26975195-26975217 TCCCATGTGTTGGTGGGTGTGGG + Intronic
1052618738 9:30877616-30877638 TCTCATCTGTTGCTGGGTCAGGG + Intergenic
1053312613 9:37029045-37029067 TCCCATGAGTTGCTGGGGCAAGG - Intronic
1054961709 9:70977086-70977108 TGCCATATGTTGGTGGGGAAAGG + Intronic
1055130226 9:72766507-72766529 TCCCATTTGTTGGAGGGACAAGG + Intronic
1061615159 9:131774522-131774544 TGCCTCTTGTTCCTGGGTAATGG + Intergenic
1186847744 X:13547570-13547592 ACTCATTTGTTTCTGGGAAAAGG + Intergenic
1188202997 X:27316287-27316309 TCCCCTTTTTTGTTGGGTGAGGG - Intergenic
1190450591 X:50576343-50576365 TGCCTTCTGTTGCTGGGTGAGGG + Intergenic
1191634126 X:63358030-63358052 TCTCATCTGTTGCTGAGTCAGGG - Intergenic
1192787520 X:74349686-74349708 TCCTATTTTTCCCTGGGTAATGG + Intergenic