ID: 1019760676

View in Genome Browser
Species Human (GRCh38)
Location 7:2810261-2810283
Sequence CTGTGTCCTCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019760670_1019760676 10 Left 1019760670 7:2810228-2810250 CCCACTTTCTGGCTCCTAGACGG 0: 1
1: 3
2: 15
3: 120
4: 460
Right 1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG No data
1019760673_1019760676 -4 Left 1019760673 7:2810242-2810264 CCTAGACGGTGATTTCTCACTGT 0: 1
1: 0
2: 2
3: 10
4: 127
Right 1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG No data
1019760672_1019760676 9 Left 1019760672 7:2810229-2810251 CCACTTTCTGGCTCCTAGACGGT 0: 1
1: 1
2: 9
3: 65
4: 309
Right 1019760676 7:2810261-2810283 CTGTGTCCTCAGATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019760676 Original CRISPR CTGTGTCCTCAGATGGTGGA AGG Intronic
No off target data available for this crispr