ID: 1019769917

View in Genome Browser
Species Human (GRCh38)
Location 7:2877074-2877096
Sequence CTGGAATTGCATCCTGGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019769910_1019769917 5 Left 1019769910 7:2877046-2877068 CCTGAACTTCCAGGTTGGGGACC No data
Right 1019769917 7:2877074-2877096 CTGGAATTGCATCCTGGTGCAGG No data
1019769902_1019769917 29 Left 1019769902 7:2877022-2877044 CCCTGCCAGTGAGGTGAGCTGGG No data
Right 1019769917 7:2877074-2877096 CTGGAATTGCATCCTGGTGCAGG No data
1019769912_1019769917 -4 Left 1019769912 7:2877055-2877077 CCAGGTTGGGGACCAGGTCCTGG No data
Right 1019769917 7:2877074-2877096 CTGGAATTGCATCCTGGTGCAGG No data
1019769904_1019769917 28 Left 1019769904 7:2877023-2877045 CCTGCCAGTGAGGTGAGCTGGGT No data
Right 1019769917 7:2877074-2877096 CTGGAATTGCATCCTGGTGCAGG No data
1019769905_1019769917 24 Left 1019769905 7:2877027-2877049 CCAGTGAGGTGAGCTGGGTCCTG No data
Right 1019769917 7:2877074-2877096 CTGGAATTGCATCCTGGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019769917 Original CRISPR CTGGAATTGCATCCTGGTGC AGG Intergenic
No off target data available for this crispr