ID: 1019771330

View in Genome Browser
Species Human (GRCh38)
Location 7:2885422-2885444
Sequence GTTTTGATGGGGACTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019771323_1019771330 11 Left 1019771323 7:2885388-2885410 CCTGAGGTTTGGGGAAGGAATGG No data
Right 1019771330 7:2885422-2885444 GTTTTGATGGGGACTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019771330 Original CRISPR GTTTTGATGGGGACTGTGGC TGG Intergenic
No off target data available for this crispr