ID: 1019775601 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:2910284-2910306 |
| Sequence | TCTCCTGGATCAGCGGCAGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 244 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 23, 4: 220} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1019775601_1019775605 | -1 | Left | 1019775601 | 7:2910284-2910306 | CCACCTGCCGCTGATCCAGGAGA | 0: 1 1: 0 2: 0 3: 23 4: 220 |
||
| Right | 1019775605 | 7:2910306-2910328 | ATGAGACCCCCACATGAGTCTGG | 0: 1 1: 0 2: 1 3: 5 4: 122 |
||||
| 1019775601_1019775610 | 9 | Left | 1019775601 | 7:2910284-2910306 | CCACCTGCCGCTGATCCAGGAGA | 0: 1 1: 0 2: 0 3: 23 4: 220 |
||
| Right | 1019775610 | 7:2910316-2910338 | CACATGAGTCTGGACACTCCAGG | 0: 1 1: 0 2: 2 3: 6 4: 115 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1019775601 | Original CRISPR | TCTCCTGGATCAGCGGCAGG TGG (reversed) | Intronic | ||