ID: 1019775601

View in Genome Browser
Species Human (GRCh38)
Location 7:2910284-2910306
Sequence TCTCCTGGATCAGCGGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019775601_1019775605 -1 Left 1019775601 7:2910284-2910306 CCACCTGCCGCTGATCCAGGAGA 0: 1
1: 0
2: 0
3: 23
4: 220
Right 1019775605 7:2910306-2910328 ATGAGACCCCCACATGAGTCTGG 0: 1
1: 0
2: 1
3: 5
4: 122
1019775601_1019775610 9 Left 1019775601 7:2910284-2910306 CCACCTGCCGCTGATCCAGGAGA 0: 1
1: 0
2: 0
3: 23
4: 220
Right 1019775610 7:2910316-2910338 CACATGAGTCTGGACACTCCAGG 0: 1
1: 0
2: 2
3: 6
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019775601 Original CRISPR TCTCCTGGATCAGCGGCAGG TGG (reversed) Intronic