ID: 1019778563

View in Genome Browser
Species Human (GRCh38)
Location 7:2926577-2926599
Sequence AGCCATGGGCAAGCCCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 138}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019778554_1019778563 21 Left 1019778554 7:2926533-2926555 CCCATTACCTACAAGACAAAGAA 0: 1
1: 0
2: 1
3: 34
4: 331
Right 1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG 0: 1
1: 0
2: 0
3: 14
4: 138
1019778552_1019778563 23 Left 1019778552 7:2926531-2926553 CCCCCATTACCTACAAGACAAAG 0: 1
1: 0
2: 0
3: 18
4: 185
Right 1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG 0: 1
1: 0
2: 0
3: 14
4: 138
1019778553_1019778563 22 Left 1019778553 7:2926532-2926554 CCCCATTACCTACAAGACAAAGA 0: 1
1: 0
2: 3
3: 23
4: 284
Right 1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG 0: 1
1: 0
2: 0
3: 14
4: 138
1019778555_1019778563 20 Left 1019778555 7:2926534-2926556 CCATTACCTACAAGACAAAGAAC 0: 1
1: 0
2: 0
3: 14
4: 193
Right 1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG 0: 1
1: 0
2: 0
3: 14
4: 138
1019778556_1019778563 14 Left 1019778556 7:2926540-2926562 CCTACAAGACAAAGAACAAGCTC 0: 1
1: 0
2: 2
3: 26
4: 302
Right 1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG 0: 1
1: 0
2: 0
3: 14
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019778563 Original CRISPR AGCCATGGGCAAGCCCAATG GGG Intronic
903945358 1:26959535-26959557 TCCCATGGGCAAGGCCACTGCGG - Intronic
904378267 1:30095233-30095255 GGCCCTGGGCCAGCCCAAGGGGG - Intergenic
905997692 1:42395800-42395822 AGCCATGGCCAAGGACAATTTGG - Intronic
910088836 1:83437560-83437582 ATGCACAGGCAAGCCCAATGAGG + Intergenic
910670668 1:89769595-89769617 ACCTAGGGGCAAGCCTAATGAGG + Intronic
911957132 1:104251429-104251451 AGCCATGGGCAATCCTATTAAGG - Intergenic
912505381 1:110152200-110152222 AGCCATGGCCAAGGACAATCAGG - Intronic
912525421 1:110279201-110279223 AGCCATGCTCCAGCTCAATGGGG - Intronic
918373177 1:183881938-183881960 AGCCAGGGGCAGCCCCAGTGGGG - Intronic
921090495 1:211837522-211837544 AGCCATGAGAAATCCCAAAGTGG + Intergenic
923252995 1:232194281-232194303 AGCCATGGGGTAGGCTAATGAGG + Intergenic
923621114 1:235580250-235580272 AGGCATGGGCAGGGCGAATGGGG + Intronic
924349721 1:243103292-243103314 AGCCATGTCCAAGGCCAATGGGG + Intergenic
1062997726 10:1882392-1882414 AGGCATGAGCAAGCCCTGTGGGG - Intergenic
1063582097 10:7317194-7317216 ATCCATGGGCAGGACCCATGTGG + Intronic
1064916580 10:20465322-20465344 AGCCATGGGGAAGCTCAAACAGG - Intergenic
1065408325 10:25392336-25392358 TGCCAAGGGCAAGCCAAGTGTGG - Intronic
1066518794 10:36193660-36193682 AGCCATGGGCAAGAACAAGCAGG - Intergenic
1067014589 10:42747880-42747902 AGCCATGGGCAAGATCAACCTGG - Intergenic
1067082605 10:43219989-43220011 AGCCATGGGCATGCTCAGTCTGG + Intronic
1067305038 10:45055910-45055932 AGCCATGGGCAAGATCAACCTGG + Intergenic
1067944855 10:50683094-50683116 AGCCATGGCAAAGGCCAAAGGGG + Intergenic
1069833526 10:71294998-71295020 AGCCATGGGAAAGGACCATGAGG - Intronic
1071562985 10:86657555-86657577 AGCCATGGGAAAGCACAGTCAGG + Intronic
1071597133 10:86936566-86936588 AGAAATGGCCAAGCCCCATGTGG + Exonic
1071633265 10:87232186-87232208 AGCCATGGCAAAGGCCAAAGGGG + Intronic
1071646714 10:87364404-87364426 AGCCATGGCAAAGGCCAAAGGGG + Intronic
1079882325 11:25943812-25943834 AGCCATGGGCAGGCTGAAAGAGG + Intergenic
1081720250 11:45283724-45283746 AACCATGTGCAAGCTCAATAGGG - Intronic
1083254518 11:61487904-61487926 AGCCATGGGGAAGCCTCCTGGGG + Intronic
1084467752 11:69336262-69336284 AGCCCTGGCCAAGCCCACTGAGG + Intronic
1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG + Intergenic
1084881963 11:72177881-72177903 AGCCCAGGGCAACCCCAGTGAGG + Intergenic
1084884700 11:72196051-72196073 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084887674 11:72221624-72221646 AGCCCAGGGCAACCCCAACGAGG + Exonic
1089518454 11:119048428-119048450 AGCCAGGTGTAAGCCCAGTGGGG + Intronic
1089730778 11:120517455-120517477 GGCCATGGGCAGGCCCCCTGAGG + Intronic
1091776773 12:3189769-3189791 AGCTATGGGCCAGCCTGATGGGG + Intronic
1092508111 12:9124902-9124924 AGCCATAGGCAGGCCAAAGGAGG - Intergenic
1094233480 12:28136094-28136116 AGGCCTGGGCAAGGACAATGGGG + Intronic
1095790120 12:46157675-46157697 GGCCATGGGCAAGCCAAGTAAGG - Intergenic
1102280239 12:111613089-111613111 AGCCATGGGCCAGGACGATGGGG + Intergenic
1102347350 12:112168571-112168593 AGCCATGTGGAAACCCAGTGTGG + Intronic
1105349665 13:19603568-19603590 AGACAGGGGCAAGTCCAATGTGG - Intergenic
1106900365 13:34349241-34349263 GGCCATGGGCTTGCCCAGTGAGG - Intergenic
1111474458 13:88726330-88726352 TGCCAAGGGCAAGCCAGATGTGG - Intergenic
1113558211 13:111255390-111255412 AGACATGGGCAAGCAACATGAGG - Intronic
1114612529 14:24052150-24052172 CGCCATGGCCAAGCCCAGCGTGG + Exonic
1116041058 14:39686878-39686900 AGCCATGGCCAGAGCCAATGTGG + Intergenic
1116982268 14:51184206-51184228 AGTGATGGGCAGGCACAATGAGG + Intergenic
1126232002 15:46338315-46338337 AGACATGGTCAAGCACAATTAGG + Intergenic
1126675735 15:51158057-51158079 TGCCATGAGGAAGCCCAAAGAGG - Intergenic
1127930672 15:63595259-63595281 AGCTCTGGACAAGCCCAAAGGGG + Intergenic
1128557079 15:68639177-68639199 AGCCAAGGTCAAGCACAAGGAGG - Intronic
1132943279 16:2519030-2519052 AGCCACGGGCAAGCAAAAGGAGG - Intronic
1133222653 16:4325418-4325440 AGCCACGGGCAAGCAGCATGAGG - Intronic
1141197766 16:81874079-81874101 AACCAGGGGCAGGCTCAATGTGG - Intronic
1142268547 16:89077480-89077502 AGCCATTGGCAAGACCGCTGTGG + Intergenic
1143327805 17:6110868-6110890 AGCCAGTGGCATGCTCAATGAGG - Exonic
1144187070 17:12806692-12806714 AACCATGGACAAGCCCATTTAGG + Intronic
1144312383 17:14025026-14025048 AGCCAAGGACCAGACCAATGAGG + Intergenic
1145729589 17:27165374-27165396 AGACATGTAAAAGCCCAATGAGG + Intergenic
1146056821 17:29585457-29585479 AGCCATGGGCAGACCAGATGTGG + Intronic
1146129951 17:30263712-30263734 AGCCATGAACATGACCAATGGGG + Intronic
1148640419 17:49183543-49183565 AGCCATGGGCAGGCCGGAAGAGG + Intergenic
1151444912 17:74157077-74157099 AGCCAAGAGCAATGCCAATGGGG + Intergenic
1151580567 17:74975566-74975588 AGTGATGGGCAAGACCAAAGGGG - Intergenic
1151884169 17:76913688-76913710 AGCCAAGAGCAAGCCAGATGTGG + Intronic
1158001088 18:52620017-52620039 AGCCATTGGAAAGGCCATTGAGG + Intronic
1162479594 19:10920796-10920818 AGCCATGGGCAGGGGCAAGGGGG - Intronic
1162908471 19:13836958-13836980 AGCCCTGGGCAGGCCAAATGGGG + Intergenic
1164522917 19:28992560-28992582 AGCCATTGGCTAGCCCTAGGAGG - Intergenic
925724726 2:6861864-6861886 GGCCAAGGCCAAGCCCAAAGGGG - Intronic
926159750 2:10479063-10479085 AGACATGGGCATGCACACTGTGG - Intergenic
927413553 2:22853556-22853578 AGCCATGTCCTAGCCCAGTGAGG + Intergenic
927844990 2:26466848-26466870 AGCCCTGGGCAAGACAAATGTGG + Exonic
927928678 2:27030253-27030275 AGCCATGGTCAGGCCTAAGGGGG + Intergenic
928333968 2:30379951-30379973 AGGCATGGGCCAGCCAGATGTGG + Intergenic
929730253 2:44482917-44482939 AGCCATGGGCATGTACAATCAGG + Intronic
938209821 2:129458237-129458259 AGCCTTTGGTAAGCCCACTGAGG - Intergenic
946718532 2:222579064-222579086 AGCCCTGGCCAAGCCCTTTGTGG + Intronic
1169874909 20:10286459-10286481 AGCCCTCGGCCAGGCCAATGGGG + Intronic
1170811942 20:19680956-19680978 GGCCATGGGACAGCCCACTGGGG - Intronic
1171251666 20:23653576-23653598 AGCCATGGGCAGTCTCCATGTGG - Intergenic
1174191973 20:48747343-48747365 AGCCATGGCCAAGGCCAAACTGG + Intronic
1178732501 21:35117517-35117539 AGACATGGGCAATGGCAATGAGG + Intronic
1179563528 21:42232217-42232239 CGCCATGTGCAAGACCAAAGGGG + Intronic
1179589632 21:42397924-42397946 AGCCTTGGGCGATCTCAATGGGG + Intergenic
1179980151 21:44891455-44891477 GGCCATGGGCACGCCCAGCGGGG + Intronic
1181412122 22:22731323-22731345 AGCCCTGGGCAGGCCCTACGAGG - Intergenic
1181677143 22:24462754-24462776 AGCCAAGGGCAAGCACAGAGAGG + Intergenic
1182808053 22:33092346-33092368 AGTCATGGGCAAGTCCTATGGGG + Intergenic
1183331478 22:37224329-37224351 AGCTCTGGGAAAGCACAATGTGG + Intergenic
1183784153 22:40019667-40019689 AGGCATGGACAAGCCCAGGGTGG - Intronic
949254430 3:2028899-2028921 AGCCTTGGTGAAGCCCAATTTGG - Intergenic
949968708 3:9383204-9383226 ATCTATGGGCAAGCCCCAGGAGG - Exonic
950707580 3:14792662-14792684 AGCCACAGGCTAGGCCAATGTGG + Intergenic
952371311 3:32725499-32725521 TGCCATGAGCAAGCACAATTTGG + Exonic
956790902 3:72679293-72679315 AGCCCTGGGGAAACACAATGTGG + Intergenic
957597108 3:82281107-82281129 AGACAAGGGAAAGCACAATGGGG + Intergenic
960258153 3:115533343-115533365 GGCCCTGGGCAAGCTCCATGGGG + Intergenic
965084849 3:164082049-164082071 AGGCATGGACAAGGCCATTGAGG - Intergenic
966518419 3:180846057-180846079 AAACATGGGCATGCCCAGTGAGG + Intronic
968488250 4:875495-875517 AGCCTTGGGCCAGCCCCACGGGG - Intronic
969699829 4:8762011-8762033 AGCCATGGACAAGGCCCACGGGG + Intergenic
973579791 4:52331797-52331819 GGCCATAGCCAAGCCCAGTGGGG + Intergenic
977641215 4:99359965-99359987 GGCCATGCCCAAGCCCACTGCGG - Intergenic
978344101 4:107748292-107748314 ACCAATGTGCAAGCCCAGTGGGG - Intergenic
979252218 4:118577268-118577290 AGCCATGTCCAAGGCCAATGGGG - Intergenic
980158484 4:129133624-129133646 AGCCAAGGACCAGCCCAATGAGG + Intergenic
980242915 4:130201397-130201419 AGGCAAGGCCAGGCCCAATGTGG + Intergenic
981790127 4:148526938-148526960 AGTCACGGGCAAGCACAGTGTGG - Intergenic
983177683 4:164610880-164610902 AGCCATGTGCCACCACAATGTGG - Intergenic
985372541 4:189301637-189301659 AGGCCTGGGGAAGCCCAGTGAGG - Intergenic
985666502 5:1183988-1184010 AGCCATGGGCAGGCCCAGCCAGG + Intergenic
988829147 5:34970772-34970794 AGCCATGGGAATGCCCCAGGAGG + Intergenic
991431677 5:66554317-66554339 AGCTATGGGTAAGCACAATTTGG - Intergenic
994449946 5:99929420-99929442 AGCCATGGGCAGGCCCAAAAAGG + Intergenic
999615496 5:153418464-153418486 AGCCTTACGAAAGCCCAATGGGG + Intergenic
1007108288 6:39298175-39298197 AGCCAGGGGCAAGCCAATGGGGG + Intergenic
1012360081 6:98366526-98366548 ACCCATTAGCAAGGCCAATGGGG + Intergenic
1015628839 6:135210354-135210376 GGCCATGGGCAAGCCAAGTCAGG - Intronic
1019506682 7:1394965-1394987 GGCCCTGGGCAAGCCCCCTGTGG - Intergenic
1019603685 7:1898004-1898026 AGCCTTGGGCCAACCCTATGTGG - Intronic
1019778563 7:2926577-2926599 AGCCATGGGCAAGCCCAATGGGG + Intronic
1020017391 7:4838840-4838862 AGCCGTGGGCATGGCCAGTGTGG + Intronic
1020137828 7:5596409-5596431 AGCTCTGGGCCAGCCCAAGGAGG - Intronic
1021103395 7:16609195-16609217 AGCCATGGGAAGGCTCATTGTGG - Intronic
1022232996 7:28432191-28432213 AGCCAATGGCAAGGACAATGTGG + Intronic
1024912726 7:54464607-54464629 TCACATGGCCAAGCCCAATGCGG + Intergenic
1025751371 7:64296547-64296569 CTGCATGGGCAAGCCCAAAGGGG - Intergenic
1027305688 7:76893996-76894018 ATGCACAGGCAAGCCCAATGAGG + Intergenic
1027501808 7:78961271-78961293 AGGGATGGGGAAGCCCAATTTGG - Intronic
1027698752 7:81442677-81442699 AGTCATGGGGCAGCCCAAAGGGG - Intergenic
1032470636 7:132175955-132175977 AGGGATGAACAAGCCCAATGTGG + Intronic
1034215749 7:149404535-149404557 TGCCATGGGCAAGCCAAGTGCGG + Intergenic
1036390958 8:8324081-8324103 AGCCCAGGGCAAGCACAATGGGG + Intronic
1042175300 8:66032536-66032558 AGCCATGGGCAAGGACTAGGAGG + Intronic
1045831598 8:106468174-106468196 AGCCATGGACAAGACCAACAAGG + Intronic
1048109637 8:131453891-131453913 AGCCATGGGCAAGTGCACTCTGG - Intergenic
1049117543 8:140702572-140702594 AGCAATGTGGCAGCCCAATGTGG - Exonic
1049374285 8:142281676-142281698 AGCCAAGGGCAACCCCATAGAGG + Intronic
1051889031 9:21924618-21924640 AGCCCTGGGTAAACCCAATGAGG - Intronic
1057354103 9:94321045-94321067 AGCCATGGCAAAGGCCAAAGGGG - Intronic
1057653663 9:96936590-96936612 AGCCATGGCAAAGGCCAAAGGGG + Intronic
1059176289 9:112172824-112172846 AGGCTTGGACAAGCCCATTGAGG - Intronic
1062198273 9:135286781-135286803 ATCCATGGGCACGCCCCACGCGG - Intergenic
1189160343 X:38803965-38803987 AGCCCTGGGCAGGCCAGATGAGG - Exonic
1189513207 X:41684385-41684407 AACCCTGGGCAAACCCAAAGAGG + Intronic
1195314778 X:103666721-103666743 AGCTATGGACCAGGCCAATGGGG - Intergenic
1195861900 X:109391979-109392001 AGCCATGAGTGAGCCCATTGAGG - Exonic
1196229617 X:113206459-113206481 AGGCAAGGGCAAGCCCAGGGAGG - Intergenic