ID: 1019779294

View in Genome Browser
Species Human (GRCh38)
Location 7:2930105-2930127
Sequence CAGAGAAAGGAGAAGGGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1556
Summary {0: 1, 1: 0, 2: 11, 3: 143, 4: 1401}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019779288_1019779294 3 Left 1019779288 7:2930079-2930101 CCTCACGGGAGACGAGATGGGAG 0: 1
1: 0
2: 1
3: 7
4: 67
Right 1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG 0: 1
1: 0
2: 11
3: 143
4: 1401
1019779280_1019779294 22 Left 1019779280 7:2930060-2930082 CCTCGTGCCCCTTGGCTGTCCTC 0: 1
1: 0
2: 0
3: 19
4: 219
Right 1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG 0: 1
1: 0
2: 11
3: 143
4: 1401
1019779285_1019779294 13 Left 1019779285 7:2930069-2930091 CCTTGGCTGTCCTCACGGGAGAC 0: 1
1: 0
2: 4
3: 26
4: 137
Right 1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG 0: 1
1: 0
2: 11
3: 143
4: 1401
1019779279_1019779294 29 Left 1019779279 7:2930053-2930075 CCTTCTTCCTCGTGCCCCTTGGC 0: 1
1: 0
2: 0
3: 38
4: 308
Right 1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG 0: 1
1: 0
2: 11
3: 143
4: 1401
1019779284_1019779294 14 Left 1019779284 7:2930068-2930090 CCCTTGGCTGTCCTCACGGGAGA 0: 1
1: 0
2: 1
3: 13
4: 107
Right 1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG 0: 1
1: 0
2: 11
3: 143
4: 1401
1019779283_1019779294 15 Left 1019779283 7:2930067-2930089 CCCCTTGGCTGTCCTCACGGGAG 0: 1
1: 1
2: 1
3: 14
4: 117
Right 1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG 0: 1
1: 0
2: 11
3: 143
4: 1401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019779294 Original CRISPR CAGAGAAAGGAGAAGGGGGC CGG Intronic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900185987 1:1333481-1333503 GTGAGAGAGGAGAAGGGCGCTGG - Intronic
900279845 1:1859674-1859696 GAGAGGAAGGAGAAGTGGGGTGG + Intronic
900420602 1:2554438-2554460 CAGAGAAGGGAGAAAAGGGACGG + Intergenic
900626156 1:3609600-3609622 CAGAGAAGGGAGAGGAGGGGAGG + Intronic
900655902 1:3756915-3756937 CAGAGAGAGGGGTGGGGGGCCGG - Intronic
900760316 1:4466123-4466145 AAGTGAAAGGTGAAGGGTGCAGG + Intergenic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901031924 1:6312061-6312083 CGGAGAAGTGAGAAGAGGGCAGG + Intronic
901058847 1:6462356-6462378 AAGAGGAAGGAGGCGGGGGCAGG - Intronic
901192391 1:7420313-7420335 CAGAGCAAGGAGCAGGGCACTGG - Intronic
901232320 1:7648095-7648117 GAGAGAGAAGAGAAGAGGGCTGG + Intronic
901735669 1:11310597-11310619 CAAAGAAAGCAGCAAGGGGCAGG - Intergenic
901813296 1:11779721-11779743 AAGAGAAAGGAGGGTGGGGCAGG + Intronic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902545983 1:17190624-17190646 CAGAGAACGGAGAAAGGAGCTGG - Intergenic
902655934 1:17868365-17868387 GAGAGAAGGGAGGAGGGGCCAGG - Intergenic
902830762 1:19010774-19010796 AAAAGAAAGGAGGAGTGGGCAGG + Intergenic
902918853 1:19654960-19654982 CACAGCAAGGTGCAGGGGGCCGG - Intronic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903654775 1:24942571-24942593 CCAGGAAGGGAGAAGGGGGCTGG + Intronic
903828961 1:26163638-26163660 CCGAGAAGGAAGAAGGGGGCCGG - Intergenic
903926812 1:26836263-26836285 GAGACAAAGGAGATGGGGTCTGG - Intronic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
903974134 1:27138184-27138206 GTGAGAATGGAGAAGAGGGCAGG - Intronic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904055115 1:27664949-27664971 GGGTGAAAGGAGATGGGGGCGGG + Intergenic
904078790 1:27858959-27858981 CAGAGAAATGGGAGGGCGGCTGG - Intergenic
904274193 1:29369653-29369675 CACAGGAAGGAGAGAGGGGCAGG - Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904423773 1:30410440-30410462 CACAGGAAGGAGAGAGGGGCAGG + Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904610121 1:31721196-31721218 CTGAGGAAGGAGGAGGGAGCTGG + Intergenic
905069914 1:35216579-35216601 AAGAGAAAAGAGAAAGAGGCGGG - Intergenic
905491386 1:38346727-38346749 GAGAGAGAGGAGAAGGGGAGGGG + Intergenic
905702052 1:40024454-40024476 CAAAGAAAGCAGAAGTGGCCAGG - Intergenic
906156562 1:43617419-43617441 CAGAGAATGGAGAAAGCGGGTGG - Intronic
906626781 1:47332135-47332157 AAGAAAAAGGAGAATGGGGGTGG + Intergenic
906803089 1:48754577-48754599 GAGAAAAAGGAAAAGGGGACTGG + Intronic
907074516 1:51566268-51566290 TGGAGATAGGAGAAGGAGGCTGG - Intergenic
907288089 1:53395026-53395048 GGGAGAAGGGAGAAGCGGGCAGG - Intergenic
907288500 1:53397366-53397388 GAGAAACAGGAGAAAGGGGCAGG - Intergenic
907303581 1:53502350-53502372 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907303609 1:53502430-53502452 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907303637 1:53502510-53502532 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907303694 1:53502701-53502723 CAGAGAGAGGAGAGTGGGGAGGG + Intergenic
907730533 1:57061306-57061328 ACGAAAAGGGAGAAGGGGGCAGG + Intronic
907800512 1:57760543-57760565 TAGAGAAGGGAGGAGAGGGCAGG - Intronic
907837599 1:58125950-58125972 AGGAGGAAGGAGAAGGGGACAGG + Intronic
907902128 1:58750637-58750659 CTGAGAAAGCAGAAGGGGAGGGG - Intergenic
908372318 1:63495576-63495598 CAAAGAAAGTAGGATGGGGCAGG + Intronic
908447730 1:64216880-64216902 CTAAGAAAGGAAAAGGGGCCAGG - Intronic
909015332 1:70373900-70373922 CAGAGAAGGGAGATAGGGGTGGG - Intronic
909286840 1:73830275-73830297 CAGAAAAAGGAGAGAGGGGAAGG + Intergenic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
909591262 1:77351807-77351829 AAGACAAAGGAGAAAGGAGCTGG + Intronic
909952034 1:81732011-81732033 CAGAGAAAAGAAAAAGGGACAGG - Intronic
910110967 1:83683072-83683094 CAGAGAAAGCATAAAGGAGCTGG + Intergenic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910238020 1:85055805-85055827 CGGAGAAAGGAGAATGAGGAAGG + Intronic
910480119 1:87649601-87649623 AAAAGAAGGGAGAAGGGGGAGGG - Intergenic
910795421 1:91092734-91092756 CAGAGAGAGGAGGAAGGGGTGGG - Intergenic
910910399 1:92227977-92227999 AAGAGAAAAGAGAATGGAGCAGG - Intronic
910922173 1:92359889-92359911 CAGAGAAAGCAGAAAAGGGGAGG + Intronic
911010816 1:93279164-93279186 CAGAGAAAGGAAAAGAGGCGAGG + Intergenic
911368657 1:96970986-96971008 CAGAGAGAGGAGAATGGGAGAGG - Intergenic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
911991741 1:104706897-104706919 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
912445457 1:109732648-109732670 CAGGGAAAGGAGAGAGGGACAGG - Intronic
912510001 1:110182922-110182944 CAGAGAAATGAGAAATGGGATGG + Intronic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
912939481 1:114032359-114032381 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
912954589 1:114145880-114145902 GAGAGGTAGGAGAAGGGGGTGGG + Intronic
912961143 1:114196932-114196954 CAGAGATTGGAGGAGGGGGAGGG + Intergenic
912972671 1:114298730-114298752 CAGAGAAACCAAAAGGAGGCTGG - Intergenic
913190166 1:116406763-116406785 TAGAGAAAGGGGTAGGGGTCAGG - Intronic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
913571084 1:120120563-120120585 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914240531 1:145849870-145849892 CAGGGAAAGGGGAAGGGTGTAGG - Intronic
914291894 1:146281541-146281563 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914552938 1:148732324-148732346 AAGAGCATGGAGAAAGGGGCAGG + Intergenic
914833672 1:151189918-151189940 CGGACAAAGAAGAAGAGGGCGGG - Intronic
914840128 1:151241504-151241526 AAGAAAAAGAAAAAGGGGGCAGG + Intronic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914960132 1:152197623-152197645 GAAAGAAAGGAGGAGGGGGGAGG - Intergenic
915022994 1:152798495-152798517 CAGAGGATGGGGAAGGGGTCAGG + Intronic
915090483 1:153420807-153420829 TAGAGAAGGCAGCAGGGGGCTGG - Exonic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915221316 1:154376957-154376979 AAGAGAAAAGAGCAGTGGGCTGG - Intergenic
915231125 1:154446055-154446077 AAGACAAAGAAGATGGGGGCAGG - Intronic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915354690 1:155249010-155249032 CTGAGAAAGGAGACAGTGGCCGG - Intronic
915596504 1:156899464-156899486 GAGAGAAAGGAAGTGGGGGCAGG - Intronic
915601795 1:156927280-156927302 CAGAGAAAGGGGGTGAGGGCAGG - Intronic
915647201 1:157281402-157281424 TAGAGCAGGGAGAAGGGAGCAGG + Intergenic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916501599 1:165392372-165392394 CAGTGGAAGGAGCAGGGGACAGG - Intergenic
916508027 1:165445500-165445522 CTGTGAAAGGAGGAGGGGGTGGG + Intergenic
916693913 1:167218141-167218163 AAGAGAAAGGGTAGGGGGGCAGG - Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916864000 1:168836850-168836872 CTGAGAAAGGAGAATCAGGCAGG - Intergenic
917288637 1:173448516-173448538 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
917304086 1:173608955-173608977 GAGAGGAAGGAGAAGGGGAAGGG + Intergenic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
917542432 1:175927240-175927262 AAGAGAGAGGAGAAGGTGCCAGG + Intergenic
917685795 1:177414501-177414523 CAGAGAAAGGAGCAGAGGAAGGG + Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918002679 1:180512476-180512498 AAGGGCAAGAAGAAGGGGGCAGG + Intergenic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918317101 1:183331372-183331394 AGGAGAGAGGAGAAGGGAGCTGG + Intronic
918322009 1:183373370-183373392 CATGGAAAGGAGAAGGGAGAAGG - Intronic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
918473925 1:184903566-184903588 AAGAGAGAGGAGAAGGTGCCAGG - Intronic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
919822454 1:201481841-201481863 CAGAGAGAGGAGGAGGGCGTGGG + Intergenic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
919991279 1:202709903-202709925 CAGGGAAAGGAGAGAGGGACGGG + Intronic
920209766 1:204319831-204319853 GAGAGAAGGGAGAAAGGGACAGG + Intronic
920226953 1:204446155-204446177 CACGGAAAGGAGAAGGTGGTGGG + Intronic
920448597 1:206039477-206039499 AAGAGGATGGAGAAGGGGGATGG + Intronic
920681557 1:208077008-208077030 CAGGGAAAGGAGGATGGGGTAGG + Intronic
921114459 1:212074979-212075001 CAGAGAAAAGAGGATGGGGTGGG - Intronic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
921326347 1:213989010-213989032 AAGAGAAAGGACAAGGGGACCGG - Intronic
921328664 1:214013766-214013788 CAGATAAAGGAGAGGTGGCCTGG - Intronic
922025356 1:221743474-221743496 CAGGGAGAAGAGTAGGGGGCGGG + Intergenic
922145753 1:222942543-222942565 CACTGAAAGGAGAGGTGGGCAGG + Intronic
922179178 1:223220261-223220283 AAGAGAAAGGGGAGGGGGCCAGG - Intergenic
922247740 1:223817229-223817251 GAGAGAAAGGATGAGGGGGAGGG + Intronic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922596307 1:226816113-226816135 CAGAGGAAGGAAGATGGGGCAGG - Intergenic
922775800 1:228213778-228213800 CCGAGAAGGGAGCCGGGGGCGGG + Intronic
922905006 1:229167639-229167661 AAGAGAAGGGAGAAGTGGGAGGG + Intergenic
923342101 1:233016378-233016400 CAAAAAGAGGAGAAAGGGGCAGG - Intronic
923842397 1:237687411-237687433 AAGAGAAAAGGGAAGGGGGAAGG - Intronic
924114544 1:240732225-240732247 CAGAGAAAAAAGAATGAGGCAGG - Intergenic
924284378 1:242470811-242470833 CACAGAAAGAAGACAGGGGCAGG - Intronic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062907315 10:1187564-1187586 AAGAGAAAGGAGAGGGGCACAGG - Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1062931288 10:1354448-1354470 CAGCGAAGGGAGATGGGGGTGGG - Intronic
1063348057 10:5329623-5329645 TAGAGGAAGGGGAAGGGGGTTGG - Intergenic
1063382260 10:5592844-5592866 GAGAGGGAGGAGAAGGGAGCTGG + Intergenic
1063509972 10:6635194-6635216 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063527204 10:6797184-6797206 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063790978 10:9447521-9447543 GAGAGGAAGGGGAAGGGGGAAGG - Intergenic
1063925075 10:10969594-10969616 CAGAGAATGGGGAAGGGGAGAGG - Intergenic
1063963786 10:11328858-11328880 CAGAAAACAGAAAAGGGGGCTGG - Intronic
1064099723 10:12453030-12453052 GGGAGAAAGTAGAATGGGGCTGG - Intronic
1064462802 10:15551259-15551281 GAGAGAGAAGAGGAGGGGGCTGG + Intronic
1064697018 10:17976895-17976917 CAGAGAAAGGAGAAAGAGAAAGG - Intronic
1064887334 10:20124635-20124657 CAGCGAAGGGAGATGGGGGTGGG + Intronic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065031382 10:21589909-21589931 CAGACAAAGGGGAAGGGGAAGGG - Intronic
1065240320 10:23697073-23697095 TAGAGAACGGAGATGGGTGCTGG - Intronic
1065263776 10:23954266-23954288 CAATGAAAGGGAAAGGGGGCCGG + Intronic
1065414125 10:25466076-25466098 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
1065483744 10:26217399-26217421 CAGATAAAGGAAATGAGGGCTGG + Intronic
1065522906 10:26589173-26589195 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065528830 10:26648444-26648466 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065558073 10:26936554-26936576 CAGGGAAAGAAGAAGGGATCAGG + Intergenic
1065559275 10:26946059-26946081 CAGGGAAAGAAGAAGGGGTGGGG + Intergenic
1065590793 10:27259200-27259222 GAGAGAAAAGGGGAGGGGGCAGG - Intergenic
1065660205 10:27998642-27998664 GAGAGAGAAGGGAAGGGGGCGGG + Intronic
1065806128 10:29395004-29395026 CTCAGAAAGGAGAAAGGGGATGG - Intergenic
1065859328 10:29858354-29858376 CTGGGAAAGGAGAAAGAGGCAGG + Intergenic
1065862971 10:29886846-29886868 GAGAGGAAGGAGATGGGGGTAGG + Intergenic
1065892287 10:30131687-30131709 CAGACAAAGTGGAAGAGGGCAGG - Intergenic
1065952375 10:30663922-30663944 CAGAGAAAAGAGATGAGGGAAGG - Intergenic
1065961136 10:30735203-30735225 GGGAGAATGGAGAAGAGGGCGGG - Intergenic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066674199 10:37871515-37871537 CAGAGAAATGACAATGTGGCAGG - Intergenic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1066782144 10:38963069-38963091 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1066954973 10:42157561-42157583 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1067047044 10:42990718-42990740 CAGAGGAAGGAGACAGGGGTGGG + Intergenic
1067184303 10:44014091-44014113 GAGGGAAAGGAGAAGGGGAGGGG - Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067502742 10:46820517-46820539 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067556674 10:47277892-47277914 CAGAGAGAGGGGTAGGGGGGTGG + Intergenic
1067591848 10:47519496-47519518 AAGAGAGAGGGGAAGGGGGAAGG - Intronic
1067638963 10:48027569-48027591 AAGAGAGAGGGGAAGGGGGAAGG - Intergenic
1067672203 10:48333666-48333688 CAGGGAAAGAAGAAGGGGTGGGG + Intronic
1067688002 10:48479331-48479353 CAGAGAATGGAGATGAGGGAAGG + Intronic
1068654899 10:59564436-59564458 CCAAGGAAGGAGAAGAGGGCAGG + Intergenic
1069555473 10:69394927-69394949 CTGAGACAGGAGGAGGGGCCTGG - Intronic
1069638581 10:69940698-69940720 GGGAGAGAGGAGAAGGGGGGCGG + Intronic
1069656711 10:70095071-70095093 GAAAGAAAGGAGAGGGGGCCAGG + Intronic
1069756338 10:70776290-70776312 CAGAGAATGGAGAAGGGCCCAGG - Intronic
1069893206 10:71664812-71664834 GAGAGAAGGGAGGAGGGGGAAGG - Intronic
1070466783 10:76732028-76732050 GAGAGGAAAAAGAAGGGGGCTGG - Intergenic
1070525497 10:77292634-77292656 AAGAGAAAGGAGCTGGGGCCTGG - Intronic
1070673808 10:78398146-78398168 TAGAGAAAGGAGATGGAGACAGG + Intergenic
1070803233 10:79255559-79255581 CAGAGAAATAAGAGGGGAGCGGG - Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1071491463 10:86139387-86139409 CAGAGGGAGGTGAAGGGGACTGG - Intronic
1071499624 10:86194076-86194098 CAGAGAAAGGAGAAGTGTTCTGG - Intronic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071807741 10:89142766-89142788 AAGAGAAAGGAGAAGGGGAGGGG + Intergenic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1072811710 10:98467506-98467528 GAGAGAAAGGAGGAGGGGCAGGG + Intronic
1073115288 10:101088332-101088354 CAGAGACAGGATGAGGGGACGGG + Intergenic
1073434284 10:103506855-103506877 AAAAGAAAGCAGAAGTGGGCCGG - Intronic
1073443653 10:103568166-103568188 CAGACAAAGGAGGTGGGGCCAGG - Intronic
1073847585 10:107576312-107576334 CAGAGAGAGGGGAAGGGAGAAGG + Intergenic
1074829697 10:117240351-117240373 CAGAGAAAGGGCTAGGGGGCGGG - Intergenic
1074898435 10:117796433-117796455 GAGAGAAAGCAGAAGGGGCAGGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075334832 10:121601069-121601091 AAGAGAAAGGAGAAGGGGGTGGG + Intergenic
1075450613 10:122549524-122549546 GAGGGAGAGGAGAAGGGGACAGG + Intergenic
1075645222 10:124092476-124092498 AGGAGGAAGGAGGAGGGGGCGGG + Intronic
1076165655 10:128280514-128280536 CAGAGAAGTGAGAAGGTGGGAGG - Intergenic
1076180353 10:128402257-128402279 CAGAGACAGAAGAAGAGAGCTGG + Intergenic
1076222500 10:128745763-128745785 CTGATAGGGGAGAAGGGGGCAGG + Intergenic
1076371096 10:129954414-129954436 CAGAGAAAAAAAAAGGGGGGGGG - Intronic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077066975 11:645675-645697 CAGAGAAAGGAGGTGGGGGATGG + Intronic
1077404130 11:2375243-2375265 CAGAGCCAGGGGAAAGGGGCTGG - Intergenic
1077578033 11:3399072-3399094 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1077831359 11:5874723-5874745 GTGAGAAAGGAGAAGAGAGCTGG - Intronic
1077889800 11:6410884-6410906 GAGGGAGAGGAGAAGGCGGCCGG - Exonic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1079283597 11:19109348-19109370 CAGTGAAAGGAGCACCGGGCTGG - Intergenic
1079475048 11:20821254-20821276 TAGAGGAAGGAGAAGGGTGGAGG - Intronic
1080122882 11:28697583-28697605 GAGAGAAAGGTGATGGGGTCAGG - Intergenic
1080662887 11:34311842-34311864 CAGAGAAAGCCAATGGGGGCCGG + Intronic
1081365690 11:42232296-42232318 CATAGAAAGCAGAAGGGATCTGG - Intergenic
1081565766 11:44260157-44260179 CAGGGAAGCTAGAAGGGGGCAGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1082030981 11:47603220-47603242 GGGAGAAAGGAGCAGGGAGCAGG + Intergenic
1082082009 11:48019372-48019394 CAGAGAAAGGAGGTGGGGTTCGG - Intronic
1082657055 11:55869002-55869024 CTGAGCAAAGAGAAGGGGGTGGG + Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082912818 11:58395971-58395993 CACTGAAAGGAGATGGGGGTGGG + Intergenic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083141844 11:60728696-60728718 GAGGGAAAGGAAAAGGGGGAAGG - Intergenic
1083179835 11:60978204-60978226 CAGAGAAAGGACAAAGGGGGTGG + Intronic
1083193488 11:61069004-61069026 AAGAGAAGGGGGAAGGGGGAGGG - Intergenic
1083253145 11:61481316-61481338 GAGAGAGAGGAGCCGGGGGCTGG + Intronic
1083463944 11:62832968-62832990 CGGAGAAAGAAGAAGCGGCCTGG - Exonic
1083746765 11:64741390-64741412 GAGAGAAGGGAGAAAGGGGAGGG + Intronic
1083755480 11:64789629-64789651 AGGAGAGAGGAGTAGGGGGCAGG + Intronic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1083973335 11:66096994-66097016 CAAAGAAATGAAAATGGGGCTGG - Intronic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084171754 11:67404345-67404367 CAGAGCCAGGGTAAGGGGGCAGG + Exonic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084358136 11:68652841-68652863 CCTGGAAAGGAGAAGAGGGCGGG + Intergenic
1084421196 11:69061529-69061551 CAGAGAGAGGAGGTGGGGGCAGG + Intronic
1084557531 11:69883826-69883848 CAGACACAGGAGCAGGGAGCTGG + Intergenic
1084583413 11:70038908-70038930 GAGAGAAAATAGAAGGGGGAAGG + Intergenic
1084712309 11:70851480-70851502 AGCAGAAAGGAGAAAGGGGCAGG - Intronic
1084796150 11:71505793-71505815 CAGCGAAAGGAGATAGGGGTGGG - Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1084941977 11:72617829-72617851 CAGAGAGAGGGAAAGGGGGCAGG - Intronic
1085270117 11:75265270-75265292 CAGAGATGGGGGCAGGGGGCGGG - Exonic
1085341270 11:75733079-75733101 CAGAGAGCAGCGAAGGGGGCGGG - Intergenic
1085349242 11:75787981-75788003 CAGAGTAAGGACAAGTGGGTAGG + Intronic
1085450488 11:76629315-76629337 CCCAGACAGGAGAAGGGGCCTGG - Intergenic
1085470035 11:76752123-76752145 CAGAGAAAGGAAAAATGGGATGG - Intergenic
1085470204 11:76752838-76752860 GAGAGAATGGAGAGGGGAGCAGG + Intergenic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1085745605 11:79111815-79111837 CAGAGAAAGGAGGTGGGAGGGGG + Intronic
1086073820 11:82828855-82828877 CAGAGATTGGAGAAGATGGCAGG - Intronic
1086116446 11:83256546-83256568 AAGAGAAAAGAGAGGGGGGTAGG - Intronic
1086274124 11:85104905-85104927 GAGAGAAAGGAGAAAGAGGTGGG + Intronic
1086362526 11:86073694-86073716 CACAGAAAGGTGAGGGGGGAAGG - Intergenic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1086797148 11:91120331-91120353 CAGAGACTGTAAAAGGGGGCTGG - Intergenic
1087074053 11:94112106-94112128 CAGAAAAAGGAGAATGGGCATGG + Exonic
1087078446 11:94147584-94147606 AACAGAAACGAGAAGGAGGCTGG - Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087839054 11:102904099-102904121 CAGCGAAAGGAGATAGGGGTGGG + Intergenic
1088500204 11:110475357-110475379 CAGAGACAGGAGGAGGGGAAAGG - Intergenic
1088680009 11:112231887-112231909 CAGAGACAGGAGAAGAGGAGGGG + Intronic
1088735186 11:112722987-112723009 CAGAGAACAGAGACGGGAGCAGG + Intergenic
1088889041 11:114030440-114030462 CAGAGAGAGGCCAAGGGGGCAGG - Intergenic
1088968814 11:114753108-114753130 TAGTGAAAGGTGAAGTGGGCTGG + Intergenic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089786129 11:120908588-120908610 GAGGGAAAGGGGAAGGTGGCAGG + Intronic
1089874632 11:121708150-121708172 CAGAGAGAGGAGATGGAGTCAGG - Intergenic
1089965666 11:122653166-122653188 CAAAGAGAGAAGAGGGGGGCTGG - Intergenic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090387003 11:126363185-126363207 GACAGGAAGGAGATGGGGGCAGG - Intronic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090437050 11:126695744-126695766 CTGAGAGAGGGGAAGGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090591475 11:128274862-128274884 CAGAGAATGGAGAAGCGGGAAGG - Intergenic
1090819304 11:130326663-130326685 AAGCGAGAGGAGAAGGGGTCCGG - Intergenic
1090854609 11:130600691-130600713 CAGAGCAGGAGGAAGGGGGCAGG + Intergenic
1091345974 11:134854398-134854420 CACAGAAAAGAGGAGGTGGCTGG + Intergenic
1091439643 12:502539-502561 AAGAGAAAGGAGAAACAGGCGGG + Intronic
1091491879 12:939769-939791 CAAAGAAGAGAGAAGAGGGCTGG + Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1092000418 12:5027149-5027171 CAGAGACAGAAGTAGGGGGCAGG + Intergenic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1092170928 12:6373776-6373798 CAGAACAAGGAGAATGGGTCAGG - Intronic
1092208573 12:6631812-6631834 AAGAGAAAGGACCAGGGGGCTGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092614392 12:10203187-10203209 GAGAGATAGGAAAAGGGGGCAGG - Intergenic
1092861851 12:12725340-12725362 CACAGAAAGAAGGAGGGGGTGGG - Intergenic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093261794 12:16947956-16947978 GAGAGAAAGGAGAGTGGGGATGG - Intergenic
1093728794 12:22544584-22544606 CCGAGGAAAGATAAGGGGGCGGG + Intergenic
1093763352 12:22935297-22935319 CAGAGAAAAGAAAGGGGCGCTGG - Intergenic
1093957406 12:25236634-25236656 AAGAGAGAGAAGAAGGGGGAGGG + Intronic
1094207790 12:27858989-27859011 TAGAAAATGGAGATGGGGGCCGG + Intergenic
1095967980 12:47882400-47882422 GAGAAAGAGGAGATGGGGGCTGG + Intronic
1096356872 12:50948852-50948874 CAGAGCGAGGAGGAGGGGGGAGG + Intergenic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096580696 12:52582933-52582955 TACAGGAAGGAGGAGGGGGCAGG - Intergenic
1096665174 12:53159772-53159794 CAGGGAGAGGGGAAAGGGGCAGG - Intronic
1096809816 12:54162085-54162107 AAGAGAAGGGAGCAGGGGACAGG + Intergenic
1097014274 12:55974254-55974276 CGGAGAGGGGAGAAGGGGGCCGG + Intronic
1097214397 12:57398783-57398805 CTGAGAAAGGAAGAGAGGGCTGG - Intronic
1097248043 12:57617350-57617372 TGGTGAAAGGAGAAGGGGACAGG + Intronic
1097283171 12:57858295-57858317 GAAAGAAAGGAAAAGAGGGCAGG - Intergenic
1097544289 12:60979375-60979397 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1099315458 12:81078033-81078055 GAGGGAAGGGAGTAGGGGGCGGG - Exonic
1099570117 12:84306459-84306481 GAGAGAGAGGAAAAGGGGTCAGG + Intergenic
1100206718 12:92357792-92357814 CAGAGAGAGGAGCAGAGGGAGGG - Intergenic
1100455176 12:94744795-94744817 CAGAAATCGGAGAAGGGGGAGGG - Intergenic
1100825695 12:98472349-98472371 CAGAGAATGGAGAGGTGGGTTGG - Intergenic
1101348144 12:103905220-103905242 AAGAGAGAGGAGGAGGGGGATGG + Intergenic
1101387169 12:104268149-104268171 GAGAGAAAGAGGAAGGGGCCGGG - Intronic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101514275 12:105419984-105420006 AAGATAAAGGAGGAGGGAGCAGG + Intergenic
1101635525 12:106537600-106537622 CATAGATGGGAGTAGGGGGCTGG - Intronic
1101730624 12:107424310-107424332 TAGAGAAAGGAGAAAAAGGCAGG - Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101968379 12:109296039-109296061 CAGAGAAAGGGGAAGAGGAGAGG - Intronic
1102045245 12:109825774-109825796 CAGAGGAGGGGGAAGAGGGCAGG + Intronic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102500308 12:113347562-113347584 TATAAAAAGGAGAAAGGGGCTGG + Intronic
1102518951 12:113467469-113467491 CAGGGAAGGGAGAAGAGGGGGGG - Intronic
1102577166 12:113863066-113863088 GAGAGAAGGGAGGAGGGGGGAGG + Intronic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102856540 12:116299338-116299360 CATAGAAAGGAGAAGTGTGGGGG + Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103087473 12:118072539-118072561 AAGAGAAAGGAAAAGGGAGAAGG + Intronic
1103087731 12:118074378-118074400 CAGATAAAGGGGACTGGGGCCGG - Intronic
1103354058 12:120306504-120306526 CAGAGAAAGGAAACTGGGACGGG + Intronic
1103407541 12:120686721-120686743 CTGAGAAAAGAAGAGGGGGCGGG + Intergenic
1103949467 12:124543113-124543135 CAGACCAAGGCCAAGGGGGCTGG + Intronic
1104169301 12:126264697-126264719 CAGAGAAATGAGATGAGGACTGG - Intergenic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104451875 12:128875876-128875898 CAGAGAAAGGAGAAGATGAGGGG - Intronic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104512994 12:129398569-129398591 CAGGCAAAGGAGGAGGGGGTTGG + Intronic
1104792096 12:131489747-131489769 AAGAGAAGGGAGAATGGGGCAGG + Intergenic
1105572846 13:21620348-21620370 AAGAGAAAGGAGAAGGAGATTGG - Intergenic
1105575809 13:21650568-21650590 AAGAGGAAGAAGGAGGGGGCTGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1105764837 13:23548927-23548949 CATAGAAAGGGGAAAAGGGCTGG - Intergenic
1105831404 13:24165540-24165562 CTGAGAGAGGAGAAGAGGGCAGG - Intronic
1106104043 13:26718390-26718412 CAGAGAAAGGAGACTGGCGTGGG + Intergenic
1106177023 13:27340401-27340423 GAGAGAATGGAGAAGCGGGGAGG + Intergenic
1106356398 13:28987454-28987476 GAGAGGAAGGAGATGGGGGTTGG + Intronic
1106367024 13:29091229-29091251 CAAACAAAAGAGAAAGGGGCAGG - Intronic
1106644984 13:31624053-31624075 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1106969997 13:35128071-35128093 CAAAGAAAGCAGAAAGGGGTGGG + Intronic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107726930 13:43308274-43308296 CAAAGAAAGGAGAAGTGAGAGGG - Intronic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108035499 13:46286222-46286244 AAGAGAAAGGAGAATGGGCTGGG - Intergenic
1108134022 13:47335459-47335481 AAGAAATAGGAAAAGGGGGCCGG - Intergenic
1108733544 13:53259068-53259090 GGGAGAAAGGAGATGGGGGAGGG + Intergenic
1108807385 13:54175895-54175917 GAGAGAAAAGGGAGGGGGGCGGG + Intergenic
1108879213 13:55088580-55088602 CAGAGAAAGGAGAAAGGGTTTGG - Intergenic
1109272394 13:60268838-60268860 GTGAGAAAGGGGAAGGGGCCGGG + Intergenic
1109282409 13:60372260-60372282 CAGAGACAGGAGAAAGCGGTAGG - Intergenic
1109432405 13:62252610-62252632 CAGAGAAAGAAGGAGGGCACGGG - Intergenic
1109729144 13:66387565-66387587 CGGAGAAAGGAGGAAGGTGCTGG - Intronic
1110319781 13:74148346-74148368 CAGAGAAATGGGATGGGAGCTGG - Intergenic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112374531 13:98826366-98826388 CAGAGGAAGGAGAGGGGGCGAGG - Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1114222003 14:20705010-20705032 GAGAGGTAGCAGAAGGGGGCAGG - Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114572924 14:23687172-23687194 CAGAGAGAGGAGAATGGATCTGG + Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114686012 14:24532396-24532418 AAGAGATTGGAGAAGGGGGCTGG - Intergenic
1114754118 14:25239817-25239839 CATAAAAAGGCCAAGGGGGCTGG + Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115026701 14:28755408-28755430 CAAGAAAAGAAGAAGGGGGCAGG + Intergenic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115267372 14:31514599-31514621 CAGAGAAAGGAGACCAGAGCTGG - Intronic
1115275599 14:31605807-31605829 ACGAGAAAGGAGAAGGGAGGAGG - Intronic
1115500767 14:34047547-34047569 GAGAGAGAGGAGAAGGTGCCAGG + Intronic
1116460184 14:45163736-45163758 CACAGAAAGGGGAATAGGGCAGG - Intronic
1116557179 14:46325578-46325600 AGGAGAAAGTAGAAGTGGGCAGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117981587 14:61347402-61347424 CAGAGAAAGCAGATGAAGGCAGG - Intronic
1118005099 14:61558431-61558453 CAGTGAAAGCAGCAGGGGCCTGG - Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1118676309 14:68188348-68188370 GGGAGAAAGGAGGAGGGGGGAGG - Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118735269 14:68696599-68696621 CAGTGAGAGGAGCAGAGGGCTGG - Intronic
1118789170 14:69073489-69073511 TAAAGAAAGCAGCAGGGGGCTGG + Intronic
1118879949 14:69817446-69817468 AAGAGAAAGGCGAAGGCAGCAGG - Intergenic
1119079142 14:71675497-71675519 TAAAGAAAGGAGAAAGGAGCAGG - Intronic
1119120247 14:72068789-72068811 GAGAGAAAGGAAGAGTGGGCCGG - Intronic
1119213136 14:72847804-72847826 TAAAGAAAGGAGAATGAGGCTGG - Intronic
1119314740 14:73683620-73683642 CAGAGACTGGAGAGGGGGGTGGG - Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119734978 14:76976037-76976059 CAGAGAAGGGAGGAGTGTGCAGG + Intergenic
1119783588 14:77296024-77296046 CAGAGAAAACAGAAGGGTGCAGG + Intronic
1119788069 14:77327360-77327382 CAGGGAAGGGAGATGGGGGTGGG + Intronic
1119805957 14:77482546-77482568 CAGAGGAAGGACCAGAGGGCGGG + Exonic
1120255019 14:82107459-82107481 AAGAGAGAGGGGAAGGGGGCTGG + Intergenic
1120556526 14:85934546-85934568 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
1120868745 14:89318452-89318474 GAGAGAAAGAAAAAGGGGCCGGG - Intronic
1120881744 14:89419020-89419042 CTGAGAAAGCAGGAGGGGACTGG - Intronic
1120974104 14:90233993-90234015 CATAGCAAGGAAAAGGGAGCAGG + Intergenic
1120999992 14:90444663-90444685 CACAGAAAGGAGAAAGGAGGAGG - Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121129936 14:91436891-91436913 CAGAGAAAGGAGAAAAGGCTGGG - Intergenic
1121260008 14:92559161-92559183 CAAGGAAGAGAGAAGGGGGCCGG - Intronic
1121477021 14:94218223-94218245 AAGAGAAAGGAGAAATGGGAAGG + Intronic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121781352 14:96624389-96624411 GAGAGGAAGGAGACGGGGTCAGG - Intergenic
1122113093 14:99515138-99515160 CAGAGGAAGAAGACAGGGGCTGG + Exonic
1122161844 14:99790819-99790841 CAGGGAAAGGAAATGGGGGGAGG - Intronic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1123540515 15:21285180-21285202 AAGAGAAAGGTGAGGGGGGAGGG + Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124159646 15:27256502-27256524 CGGGGAGAAGAGAAGGGGGCTGG + Intronic
1124186401 15:27533380-27533402 CAGAGAAAGGAGACTGGGGTTGG - Exonic
1124836416 15:33199720-33199742 AAGAGACAGGAGCAGGAGGCGGG + Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1124957799 15:34371010-34371032 GAGAGAAAGGAGAGAGGGGACGG - Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1126320325 15:47415516-47415538 AGGAGAAAGGAGACGGGAGCGGG - Intronic
1126336146 15:47588231-47588253 CAGAGGAAGGATAGTGGGGCAGG - Intronic
1126357577 15:47812613-47812635 AAGAGAACTGAGAAGGGGGATGG + Intergenic
1126447120 15:48760071-48760093 CTGAGATAAGAGAAGGGGTCAGG + Intronic
1127524531 15:59779272-59779294 CAGAGAAATGACAAGTGGCCTGG + Intergenic
1127719159 15:61682968-61682990 AAGAGGAAGGAGGAGTGGGCAGG + Intergenic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127798175 15:62455776-62455798 GAGAGATAGCAGAAGGGGACTGG - Intronic
1128146141 15:65333419-65333441 CAGAGGAAGGGGAGGGGGGATGG + Intronic
1128157663 15:65401997-65402019 GAGAGAAAGGGGCAGGGAGCAGG + Intronic
1128349133 15:66877488-66877510 CAGAGACAGGAGAAAGAAGCAGG + Intergenic
1128351954 15:66896850-66896872 AGGAGAAAGGAGGAGGGGGAAGG + Intergenic
1128590357 15:68890063-68890085 AAAAGAAAGGAAAAGAGGGCCGG - Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129158641 15:73734321-73734343 CAGAGAAATGGAAAGGGGGAAGG + Intergenic
1129254846 15:74328416-74328438 CTCAGAAAGGTGAAGGGGCCTGG + Intronic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129334314 15:74843259-74843281 CAGAGACAGGGGAGGGGCGCCGG - Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129716941 15:77857722-77857744 CAGAGAGAGGAGTATGGGGTCGG + Intergenic
1129727925 15:77911043-77911065 CAGAGGAAGGAGGAGGGGATGGG - Intergenic
1129752666 15:78077067-78077089 CTGAGAAAGGAGACGGGGCTTGG + Intronic
1129765037 15:78159291-78159313 AAGAAAAAGGAGGAGGGGGTAGG - Intronic
1129839954 15:78737817-78737839 CAGAGGAAGGAGGAGGGGATGGG + Intergenic
1130106507 15:80932497-80932519 CAGAGAAGGCAGAAGAGGGGCGG + Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130284139 15:82541301-82541323 CAGAGTTGGAAGAAGGGGGCAGG - Intronic
1130528667 15:84728628-84728650 TAGAAAAAGCAGAAGAGGGCCGG - Intergenic
1131213324 15:90516606-90516628 GATAGAAAGCAGAAAGGGGCTGG + Intergenic
1131557654 15:93413722-93413744 CAGAGAAAGGAGAAGCTGCTGGG - Intergenic
1131689373 15:94809973-94809995 GAGGGAAATGAGAAGGGAGCAGG - Intergenic
1132431940 15:101767682-101767704 CAGAGAAAGGAGGCGGGGATGGG - Intergenic
1202948829 15_KI270727v1_random:12322-12344 AAGAGAAAGGTGAGGGGGGAGGG + Intergenic
1132551575 16:555915-555937 CAGAGAAGGGAGGGGAGGGCTGG - Intergenic
1132950616 16:2560345-2560367 GGGAGAAAGGGGAAGTGGGCCGG - Intronic
1132963733 16:2639825-2639847 GGGAGAAAGGGGAAGTGGGCCGG + Intergenic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133141994 16:3751948-3751970 CAATGAAAGGAACAGGGGGCAGG + Intronic
1133161752 16:3916447-3916469 CAGAGAAAGGACATGGGCTCTGG + Intergenic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133414681 16:5597235-5597257 CAGAGAAAGCGGGAGGGGGGTGG - Intergenic
1133801544 16:9090071-9090093 CAGAGATAGCAGACTGGGGCAGG + Intergenic
1134667344 16:16028451-16028473 CAGAGAGAGGAGGAAGGGGTGGG - Intronic
1134680684 16:16122892-16122914 CAAAAAAAGGAGATGGGGGTGGG + Intronic
1134741719 16:16553424-16553446 GAGAGAAAGGAGAGGAGGGGAGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134925847 16:18159034-18159056 GAGAGAAAGGAGAGGAGGGGAGG + Intergenic
1135066565 16:19314982-19315004 GAGAGGAAGGAGGAGGGGGTGGG + Intronic
1135500339 16:22990664-22990686 GGGAGAAGGGAGAAGGGAGCAGG - Intergenic
1135500341 16:22990671-22990693 CAAAGAAGGGAGAAGGGAGAAGG - Intergenic
1135631607 16:24039855-24039877 AAGACCAAGGAGGAGGGGGCTGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1136155035 16:28376825-28376847 CTGAGACAGGAGAATGAGGCAGG - Intergenic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136520895 16:30795093-30795115 CAGGGAGAAGTGAAGGGGGCTGG - Intergenic
1136558790 16:31025985-31026007 CAGAGACCTGAGACGGGGGCCGG + Intergenic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1136936684 16:34474214-34474236 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1136947988 16:34678867-34678889 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136959102 16:34825251-34825273 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136963135 16:34874356-34874378 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1136967226 16:34928559-34928581 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137085017 16:36109295-36109317 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137087838 16:36150670-36150692 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1137221551 16:46456776-46456798 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1137374560 16:47941604-47941626 AAGAGGAAGGAGTAGGGGGAGGG + Intergenic
1137447551 16:48540957-48540979 CCGAGAAAGGGAAAGGGGACAGG + Exonic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137689709 16:50414414-50414436 GAGAGAAAGGGGAAGGGGAAGGG - Intergenic
1137697128 16:50468844-50468866 CAGAGAGAGGACTAGGGAGCCGG - Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1137977253 16:53042272-53042294 GAGAGAAAGGAGAGGGGTGAGGG - Intergenic
1138412324 16:56850440-56850462 CAGGGAGTGGAGAAGGGGCCTGG - Intergenic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138505973 16:57478440-57478462 GAGAGAAGGGAGAAGGGGACAGG + Intronic
1138530487 16:57631798-57631820 CAGAGACAGGAGGAGGGGCAGGG - Intronic
1138790032 16:59892869-59892891 CAGAGAAAGAGGAACAGGGCTGG - Intergenic
1139003524 16:62542779-62542801 CAGAGAAAGGTGAAGGTGAAAGG + Intergenic
1139055527 16:63179074-63179096 GAGTGAAAGGAGAGGGGGGGGGG + Intergenic
1139120609 16:64011872-64011894 CAGAGAGAGGAGGAGGTGCCAGG - Intergenic
1139429510 16:66903721-66903743 CAGGGATAGGATGAGGGGGCTGG - Intergenic
1139519483 16:67472384-67472406 AAGAGAGAGGAGCTGGGGGCTGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140235908 16:73158449-73158471 AAGAGAAAAGAGAAGGGAGGGGG - Intergenic
1140715279 16:77720888-77720910 CAAAGACAGCAGAAAGGGGCTGG - Intergenic
1140944904 16:79758709-79758731 GAGAGAAAGGAGGACGGGGCAGG + Intergenic
1141085964 16:81095984-81096006 AACAGAAATAAGAAGGGGGCAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141403820 16:83774046-83774068 CAGAGATAACAGCAGGGGGCTGG - Intronic
1141637241 16:85320776-85320798 GGGAGAAAGGACATGGGGGCTGG - Intergenic
1141665712 16:85464123-85464145 CAGAGAGAGGAGGGGTGGGCGGG - Intergenic
1141692967 16:85606897-85606919 CCGAGGCAGGGGAAGGGGGCTGG - Intergenic
1141839307 16:86564453-86564475 CAAAGAAAGGAAAAGGGGAGGGG - Intergenic
1141929799 16:87194440-87194462 CACAGAAATAAGAAGTGGGCTGG + Intronic
1142189186 16:88709781-88709803 CAGAGACTGGTGAAAGGGGCGGG - Intronic
1142236951 16:88926916-88926938 CAGAGAAAGGAGATGAGGGCAGG - Intronic
1142252650 16:88999715-88999737 CAGAGGGAGGAGGGGGGGGCGGG + Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1142882510 17:2892869-2892891 AAGAGAAAGGGGAGGGGAGCTGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1142966563 17:3585548-3585570 CTGAGAAGCGGGAAGGGGGCGGG + Intronic
1143097637 17:4486875-4486897 GAAAGGAAGGAGAAAGGGGCCGG + Intronic
1143114381 17:4574054-4574076 AAGAGAAAGGAGACAGGAGCAGG - Intergenic
1143122537 17:4617852-4617874 CAGTGAGGGGAGTAGGGGGCAGG - Intergenic
1143155541 17:4833802-4833824 GAGAGAAGGGAGCAGAGGGCGGG - Intronic
1143216606 17:5229830-5229852 GGGAGAAAGGAGATGGGGGAAGG - Intronic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1143255902 17:5557960-5557982 CAGAGAGAGGAGCAGGGGTAGGG + Intronic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143382132 17:6503161-6503183 CAGAGAGAGGAGGACGGGGATGG - Intronic
1143552950 17:7642477-7642499 GAGAGAACGGAGGAGGGGGGAGG - Intergenic
1143865561 17:9920321-9920343 CAGAGAAAGGGTGAGTGGGCAGG + Intronic
1143998677 17:11032316-11032338 GAGAGAAAGGAGAAACGGGGTGG - Intergenic
1144116647 17:12100008-12100030 GAGGGAAAGGAGAAGAGGGGTGG - Intronic
1144346555 17:14354785-14354807 GAGAGGAAGCAGAAGTGGGCAGG - Intergenic
1144368524 17:14568437-14568459 CCCAGAAAGTAGAAGTGGGCAGG - Intergenic
1144501328 17:15787997-15788019 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1144681764 17:17200673-17200695 CAAGGAAGGGGGAAGGGGGCAGG + Intronic
1145163503 17:20590671-20590693 CAGAGAAGGGACAGGGTGGCTGG + Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145324032 17:21783580-21783602 AAGACAAATGAGAAGGGGGCAGG - Intergenic
1145326580 17:21835215-21835237 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1145689559 17:26724381-26724403 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1145988574 17:29064199-29064221 AAGAGAATGGGGAAGTGGGCAGG + Intergenic
1145991721 17:29083062-29083084 CAGAGAAAGGAAAAGGGGCGGGG + Intronic
1146296279 17:31653151-31653173 AAGAGAAAGGGCAAGGGGGTGGG + Intergenic
1146645520 17:34574566-34574588 AATAGAAGGGAGAAGGGGGAAGG + Exonic
1146667510 17:34714968-34714990 CAGAGAAAGAAGAATGGGTAGGG + Intergenic
1147043791 17:37737987-37738009 TTCAGAAAGGAGAAGGAGGCAGG - Intronic
1147051987 17:37802170-37802192 CAGAGCAAGGAGAGGGGGAGAGG - Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147326370 17:39671653-39671675 CAGAGGAAGGAAAATGGGGATGG - Exonic
1147581948 17:41631984-41632006 CCGAGCAAGGAGATGGGGGCTGG - Intergenic
1147697938 17:42370558-42370580 CAAAGAAATGAGAAGATGGCTGG - Intronic
1147914566 17:43878776-43878798 CATAGGAAGGAGGATGGGGCTGG + Intronic
1148086145 17:44994993-44995015 CAGAGGAAGGAGGAGAGGGGAGG + Intergenic
1148153188 17:45408553-45408575 TAGAGAAAGGACAAGTGGGGTGG - Intronic
1148358903 17:46995872-46995894 CAGTGTAAGGAGGAGGGGCCTGG + Intronic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148386102 17:47236329-47236351 CAAAGAAAGGACCAGGGGACAGG - Intergenic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148618470 17:49016911-49016933 CTGAGAAAGGGGGCGGGGGCGGG - Intronic
1148676559 17:49448892-49448914 GAGAGAAGGGAGAAGGGGTGAGG + Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148767157 17:50046124-50046146 AAGAGAAAGGGGAAGGGGAACGG + Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1148906089 17:50913170-50913192 CAGGGAAAGGCAAAGGGGTCTGG - Intergenic
1148907648 17:50921361-50921383 CAGAGAAAGCAGAAGTGTGGAGG - Intergenic
1149018543 17:51936600-51936622 GAGCGAAATGAGATGGGGGCTGG + Intronic
1149447508 17:56725034-56725056 TAGAGAAAGTGGGAGGGGGCAGG - Intergenic
1149540521 17:57464737-57464759 CAGAGAAAAGAGGAAGGGACAGG - Intronic
1149812789 17:59693691-59693713 AACAAAAAGGAGCAGGGGGCAGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150150646 17:62806561-62806583 GAGAGAAAGGAGGAGGGAGTTGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1151154219 17:72113547-72113569 CAGAGACAGGAGAAGGGAATAGG + Intergenic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151456019 17:74226256-74226278 GAGTGAGAAGAGAAGGGGGCTGG + Intronic
1151780794 17:76243838-76243860 GGGAGAAAGGAGAAGGGTGGGGG + Intergenic
1152047953 17:77950781-77950803 GGGAGAAAGGAGAGGGGGGAGGG + Intergenic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152552055 17:81034938-81034960 CGGAGAAGGGGGAGGGGGGCGGG - Intergenic
1152840066 17:82561626-82561648 CGGGGAAAGGAGAAGGGCGAGGG + Intronic
1152878122 17:82800010-82800032 CAGAGCAGGGGGATGGGGGCTGG - Intronic
1203182830 17_KI270729v1_random:80349-80371 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1203190770 17_KI270729v1_random:185806-185828 AAGACAAATGAGAAGGGGGCAGG + Intergenic
1153052941 18:917359-917381 CAGCGAAGAGAGAAAGGGGCAGG - Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1153671806 18:7418985-7419007 TAAAGAAAGCAGTAGGGGGCTGG - Intergenic
1153711269 18:7802089-7802111 CAGAGAAGGGAGAGGGGAGAAGG - Intronic
1153784563 18:8523175-8523197 CAGAGAGATGAGTAGGGGGCTGG - Intergenic
1153806470 18:8712519-8712541 AAGAGAAAGGAGGAGGAGGCGGG - Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1154335520 18:13461908-13461930 CAGAAAAAGTGGGAGGGGGCAGG + Intronic
1154516438 18:15171967-15171989 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155838138 18:30613002-30613024 CAGCGAAAGGAGATGGGGTGGGG - Intergenic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156145743 18:34175162-34175184 CAGAGAAAGGAGAATGGAACTGG + Intronic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1156958781 18:42997454-42997476 AAGAGAGAGAAGAAGGGGGAGGG + Intronic
1157119404 18:44895141-44895163 GAAAGAAAGGAGAAGAGGGAAGG + Intronic
1157379642 18:47201982-47202004 AAGAGGGATGAGAAGGGGGCTGG - Intergenic
1157623398 18:49028990-49029012 CAAAGAATGGAGAATGTGGCTGG - Intergenic
1157728378 18:49982982-49983004 CAGAGAAAGGAGAAGATCTCTGG - Intronic
1157820336 18:50762964-50762986 CAGAGAGAGAAGAAGGGTGAAGG - Intergenic
1158288533 18:55912709-55912731 CAGAGAAAGGAGAAAGGAAAGGG - Intergenic
1158429239 18:57369353-57369375 CAGAGGAAGGAGAACTGGACAGG - Intronic
1158584495 18:58719403-58719425 AAGAGAAAGAAGTTGGGGGCGGG - Intronic
1159127329 18:64238777-64238799 CAGGAAATGGAGAAGGGGGTTGG - Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160237250 18:77095705-77095727 CACATAAATGTGAAGGGGGCAGG - Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160510101 18:79448651-79448673 CAGAGAAATAAAAAGGGGGCAGG + Intronic
1160930074 19:1566417-1566439 CAGAGAAAGGTGTGGGGGGCTGG - Intronic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161328144 19:3673127-3673149 CAGAGGGAGGAGCAGAGGGCAGG - Intronic
1161373568 19:3927422-3927444 CACAGACAGGAGACGGGGACAGG + Exonic
1161422014 19:4181148-4181170 GAGAGGGAGGAGAAGAGGGCAGG - Intronic
1161693625 19:5752729-5752751 CATGGAAAGGAAAAGGGGGCCGG + Intronic
1161756580 19:6138472-6138494 GAGAGAGAGGGGAAGGGGGAAGG + Intronic
1161776998 19:6269065-6269087 CAGAGAAAGGAAAGAGGGCCTGG + Intronic
1161912864 19:7207626-7207648 TAAAGAAAGGAGAATGGGCCGGG + Intronic
1162083596 19:8234848-8234870 GACAGAAAGTAGAATGGGGCCGG - Intronic
1162127676 19:8508059-8508081 CAGAGAATGGAGAAAGGAGGAGG + Intergenic
1162275456 19:9650478-9650500 ATGTGAAAAGAGAAGGGGGCGGG + Intronic
1162686168 19:12386427-12386449 AAGGGAAAGGAGAGGAGGGCAGG + Intronic
1163081876 19:14950150-14950172 CAGAGAGGAGGGAAGGGGGCTGG - Intronic
1163110043 19:15154401-15154423 CAGAGAAAGTGGATGCGGGCAGG + Intergenic
1163673340 19:18642222-18642244 AAGAGGAAGGAGACGTGGGCAGG - Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163921184 19:20290393-20290415 GAGAAAAAGGAGAAGAGGCCGGG - Intergenic
1164039851 19:21484543-21484565 CAGAAACAGGAGGATGGGGCCGG - Intronic
1164148982 19:22532577-22532599 CAGAGAAAGGAGGCGAGGCCAGG + Intergenic
1164157083 19:22603451-22603473 CAAAGCCAGGAGAAGGGGGGTGG + Intergenic
1164406899 19:27957248-27957270 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1164563968 19:29312670-29312692 CAGAGAATGCACAAAGGGGCAGG + Intergenic
1164587441 19:29484866-29484888 CAGGGAAAAGAAAAGGGGGCTGG - Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1165095547 19:33407912-33407934 CAGAGAAGCGGGAAGGGGCCCGG + Intronic
1165730801 19:38143418-38143440 CAGGGAAAGGAGGAGAGGGTGGG - Intronic
1165911330 19:39230058-39230080 GAGAGAAAGGAAAGGGGGGAAGG + Intergenic
1165922307 19:39307076-39307098 CAGAGAGACGACAAGAGGGCGGG + Exonic
1165977659 19:39691498-39691520 CAGAGAAAAGAAAAGGGTGTGGG + Intergenic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166108266 19:40608177-40608199 CAGAGAGAGGACAAGAGAGCGGG - Intronic
1166121937 19:40691512-40691534 CAGAGAAAAGAGCTGGGGGAAGG + Exonic
1166344195 19:42155182-42155204 CAGAGAAAGATGAAGGCAGCCGG - Intronic
1166391260 19:42410163-42410185 TACAGAAAGGAGAAGTTGGCTGG - Intronic
1166778722 19:45328423-45328445 AAGAGAAAGGAGGAATGGGCAGG - Intergenic
1167075141 19:47244019-47244041 CGGGGAAGGGAGAGGGGGGCGGG - Intergenic
1167212015 19:48139384-48139406 TAGAGAAGAGAGAAGAGGGCAGG - Intronic
1167424182 19:49421439-49421461 AAGAGAAAGGAGCAGGCGTCAGG - Intergenic
1167671719 19:50857348-50857370 AGGAGGAAGGAGAAGGGGGAAGG + Intronic
1167729678 19:51244631-51244653 GAGAGTAAGGGGAAGGGGACAGG - Intergenic
1167847732 19:52178279-52178301 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168081295 19:54012329-54012351 GGGAGAAAGGATAAGGGGACAGG - Exonic
1168115802 19:54220944-54220966 CAGAGACAGGGGATGGGGGGAGG - Intronic
1168185686 19:54698062-54698084 CAGAGACAGGGGATGGGGGGAGG + Intronic
1168276935 19:55284019-55284041 GAGAGAAAGGACGAGGTGGCGGG + Intronic
1168320249 19:55504791-55504813 CAGAGAAAGAAACAGGTGGCCGG - Intronic
1168692522 19:58385694-58385716 CAGGGATGGGAGTAGGGGGCAGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925172024 2:1755750-1755772 AAAAGGAAGGAGAAAGGGGCTGG - Intergenic
925406175 2:3606585-3606607 CAGAGCAAGGAGCAGGGGCTGGG - Intronic
925515087 2:4673221-4673243 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
925587192 2:5475545-5475567 GAGGGAGAGGAGAAGGGGCCTGG + Intergenic
925668646 2:6289027-6289049 CAGAGAAAGGAGATGCAGGAAGG - Intergenic
926294681 2:11560402-11560424 CAAAGAAATAAGAAGCGGGCCGG + Intronic
926516737 2:13855885-13855907 CAGAAAAGGGAGAAAGGGGCTGG + Intergenic
926629129 2:15120737-15120759 GGGAGAAAGGAGAATTGGGCAGG + Intergenic
926633413 2:15157752-15157774 CATGGAAAGAAGAAGGGGTCTGG + Intergenic
926965228 2:18402336-18402358 AAGAGAAAGGAGAGGGGGAAAGG - Intergenic
927035431 2:19170287-19170309 GAGAGAAGGGAGAAAAGGGCAGG + Intergenic
927194059 2:20535698-20535720 CCAACACAGGAGAAGGGGGCAGG + Intergenic
927338293 2:21950993-21951015 CAGAGGAAGGGGAGGGGGGGTGG - Intergenic
928133858 2:28673445-28673467 AAGAGAAAGAAGAGGAGGGCAGG + Intergenic
928156049 2:28877845-28877867 CAGAGATTGGAGAGAGGGGCAGG + Intergenic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
929474081 2:42227685-42227707 CAGAGGAGGAGGAAGGGGGCGGG - Intronic
929570002 2:43016715-43016737 GAGAGAAGGGAGAAGGTGCCAGG - Intergenic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
930721397 2:54641673-54641695 CAGGGAATGGGGCAGGGGGCGGG - Intronic
930791909 2:55341441-55341463 CAGAAAAAAAAAAAGGGGGCGGG - Intronic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931348840 2:61470847-61470869 AAGAGAATGGGGGAGGGGGCCGG + Intergenic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932086406 2:68766450-68766472 CAGAGACAGGCGGAGAGGGCTGG + Intronic
932271154 2:70411471-70411493 CAGAGAAAGGAGAGAGGGAAAGG + Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932412265 2:71554520-71554542 CAGTGCAAGGAGATGGGGGGTGG + Intronic
932439174 2:71721025-71721047 CAGAGAGAGGAGAAGAGGAGTGG - Intergenic
932459070 2:71870816-71870838 AAGAGACAAGAGAAAGGGGCTGG + Intergenic
932555380 2:72819489-72819511 CAGAGAAAGGAGGAGGAGATAGG - Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932873912 2:75430972-75430994 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
933854071 2:86396437-86396459 CAGCGAAGGGCGAAGGGGGTGGG - Intergenic
933876056 2:86623174-86623196 CACAGAAAGGAGAGGGGCGCGGG + Exonic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934252286 2:90367622-90367644 AAGACAAATGAGAAGAGGGCAGG - Intergenic
934257156 2:91435323-91435345 AAGACAAATGAGAAGAGGGCAGG + Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
934557895 2:95297042-95297064 CAGAGAAAGAGGCAGCGGGCAGG + Intergenic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934762791 2:96865607-96865629 CAGAGAAGGGTGAGGAGGGCGGG + Intronic
934882302 2:97995258-97995280 CAGTGACAGGAGACGGGGGAAGG + Intronic
935077726 2:99761977-99761999 AAGAGAAACAAGATGGGGGCAGG - Intronic
935170313 2:100606491-100606513 CAGAGAAAGGAGGCTGGGGAGGG - Intergenic
935571432 2:104664976-104664998 AAGAGAAAGAGGCAGGGGGCCGG + Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936144039 2:109967288-109967310 TAGAGACAGGAGGAAGGGGCTGG - Intergenic
936180721 2:110265249-110265271 TAGAGACAGGAGGAAGGGGCTGG - Intergenic
936200648 2:110404181-110404203 TAGAGACAGGAGGAAGGGGCTGG + Intronic
936963639 2:118103949-118103971 CAGAGAAGGTAGAAAGGGGAAGG - Intronic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937283309 2:120735394-120735416 CAGAGAAGGGACGCGGGGGCTGG - Intergenic
937681210 2:124646809-124646831 TTCAGAAAAGAGAAGGGGGCTGG + Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938130462 2:128710998-128711020 TTGAGAAAGAGGAAGGGGGCAGG + Intergenic
938375902 2:130806464-130806486 CAGAGGAAGCAGAGGGGTGCCGG + Intergenic
938516759 2:132016961-132016983 AAGACAAATGAGAAGAGGGCAGG - Intergenic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
938773820 2:134523732-134523754 CAGAGAAACGGGAAGTGGGGAGG + Intronic
938845717 2:135206728-135206750 GAGAGAAAGGGGAAGAGGGAGGG + Intronic
938925607 2:136038803-136038825 CAGAGAAAGCAGAAAGGGAAGGG - Intergenic
938935254 2:136121903-136121925 TAGAGAAAGGAGGAGGTGCCAGG + Intergenic
939054822 2:137352126-137352148 AATAAAAAAGAGAAGGGGGCAGG + Intronic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939428250 2:142069055-142069077 CAGAGAAGGGAGAAGGGTGGAGG - Intronic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
939990295 2:148872028-148872050 AAGAAAAAGGAGAACAGGGCCGG - Intergenic
940135014 2:150425797-150425819 CAGAGGAAGGAAACTGGGGCAGG - Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940852484 2:158701699-158701721 GAGAGAAAGGAGAAGAGAGAGGG - Intergenic
940898917 2:159108486-159108508 CAGAGAAAATAGATGAGGGCAGG + Intronic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941521046 2:166543510-166543532 GAAAGAAAGGGGAAGGGGGAAGG + Intergenic
941652963 2:168113085-168113107 TAGACAATGGAGAAGAGGGCTGG - Intronic
942044824 2:172094445-172094467 AAAAGAAAGGAGGAGGTGGCAGG - Intergenic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942300561 2:174557249-174557271 AAGACAAAGGAGAAGGGAACTGG + Intergenic
942350249 2:175045189-175045211 GAGAGAAAGGAGGAGGGGAGGGG - Intergenic
942495320 2:176534044-176534066 CAGAGGAAGCAGAAGGGATCAGG + Intergenic
942596251 2:177594138-177594160 GATAGAAAGCAAAAGGGGGCAGG + Intergenic
942602681 2:177657672-177657694 GAGAGAAAGCAGAAAGAGGCGGG + Intronic
942729786 2:179051688-179051710 CAGCGAAAGGAGATAGGGGTGGG + Intergenic
942899377 2:181095759-181095781 CAGAGAAAGGGGAAGCTGTCAGG - Intergenic
943531214 2:189083300-189083322 CAGAGAACGGCAAAGGGGCCAGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944251983 2:197587602-197587624 CAGCGAAGGGAGAAAGGGGTAGG - Intronic
944485608 2:200201966-200201988 CAGTGAAAGGAGATAGGGGTGGG + Intergenic
944526841 2:200627968-200627990 AAGAGAAAGGAGAAAGGGAAGGG - Intronic
944973498 2:205021053-205021075 CAGAGAAAGGTGATGGGAGATGG + Intronic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
945259640 2:207831729-207831751 CACTGGAAGGAGGAGGGGGCTGG - Intronic
945375771 2:209078346-209078368 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945376652 2:209084256-209084278 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
945582377 2:211611312-211611334 CAGAAAAAGGAAAAGGGGAGGGG + Intronic
945672043 2:212813992-212814014 CAAAGAAAGGAAAAGGGTACAGG - Intergenic
945777569 2:214126184-214126206 CGGAGAAGGGAGAAGGGAGAAGG + Intronic
946100205 2:217314119-217314141 CAGAACAAGAGGAAGGGGGCTGG - Intronic
946143902 2:217714290-217714312 GAGAGGATGGAGAAGGGGGAAGG - Intronic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946149366 2:217753769-217753791 CAGTAACTGGAGAAGGGGGCAGG + Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946385992 2:219384864-219384886 CAGAGATTGGAGAAGGGGGCTGG + Intronic
946415379 2:219537474-219537496 CAGAGTCAGGAGAAGGGGATGGG + Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
946683184 2:222239339-222239361 CAGAGAGAGAAGGAGGGGGGAGG + Intronic
946716501 2:222559177-222559199 CAGCGAGAGGAGCAGGGGCCGGG - Exonic
946781362 2:223195203-223195225 CAGCGAAAGGAGATAGGGGTGGG + Intronic
946885164 2:224215786-224215808 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
947142145 2:227029288-227029310 AAGAGGAAGGAGGAAGGGGCTGG - Intronic
947223976 2:227822508-227822530 AAAGGAAAGGAGATGGGGGCTGG - Intergenic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
948028839 2:234800144-234800166 CAGAGCAAGGAGGATGGAGCTGG + Intergenic
948295475 2:236857221-236857243 GAGAGGAAAGAGGAGGGGGCGGG - Intergenic
948465867 2:238151348-238151370 CAGAGAGGGGAGCCGGGGGCCGG + Exonic
948504283 2:238417799-238417821 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504294 2:238417841-238417863 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504316 2:238417925-238417947 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504338 2:238418009-238418031 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504349 2:238418051-238418073 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504360 2:238418093-238418115 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504371 2:238418135-238418157 CACACACAGGAGAAGGGCGCGGG - Intergenic
948504382 2:238418177-238418199 CACACACAGGAGAAGGGCGCAGG - Intergenic
948504392 2:238418219-238418241 CACACACAGGAGAAGGGCGCAGG - Intergenic
948504402 2:238418261-238418283 CACACACAGGAGAAGGGCGCAGG - Intergenic
948523402 2:238556446-238556468 GAGAGAGAGTAGAAGGGGGCAGG + Intergenic
948663561 2:239521093-239521115 CTGAGAAAAGAAAAGAGGGCAGG - Intergenic
948757945 2:240170026-240170048 CAGAGGTGGGAGAAGGGAGCGGG - Intergenic
948990732 2:241552596-241552618 GAGACACAGGAGACGGGGGCGGG - Intergenic
948993355 2:241565429-241565451 TGGACAAAGGTGAAGGGGGCTGG - Intronic
949032247 2:241802637-241802659 CAGAGGGAGGAGGAGGGGCCGGG + Intronic
1168750247 20:276971-276993 CAGAGGATGGGGAAGAGGGCGGG + Intronic
1169168824 20:3447501-3447523 CAGAGAAAGGAGCTGGGCCCAGG + Intergenic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169267241 20:4174214-4174236 CAGAGACAAGAGAAGGGGCAAGG + Intronic
1169623254 20:7532024-7532046 GAGAGAAAGGAGAAGGAAACTGG + Intergenic
1169650321 20:7859533-7859555 CAGAGAAAGAATATGGGGGTGGG + Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170203331 20:13768599-13768621 AAGAAAAGGGAGAAGGGGCCAGG + Intronic
1170323183 20:15124747-15124769 CAAAGAAATGAGATGGGGGAAGG - Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1170819712 20:19746566-19746588 TAGAGAAAGAAGAGGGAGGCTGG + Intergenic
1170940679 20:20845625-20845647 CAGGGAAAGGAGATGGGGAGAGG + Intergenic
1171009161 20:21498631-21498653 CACAGAAAGGAGATGGGAGTGGG + Intergenic
1171088470 20:22261849-22261871 CAGAGAGAGGGGGAGGGCGCTGG - Intergenic
1171201838 20:23247945-23247967 CTGTGAAAGGAGGAGGGGGACGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171416740 20:24986614-24986636 CAGGGAAAGGAGTAAGGGCCAGG + Intronic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1171896317 20:30813467-30813489 CAGAGAAAGGGAAAGGGTGAGGG + Intergenic
1172122612 20:32607761-32607783 CACAGAAGAGAGAAGGGGACAGG - Intronic
1172174933 20:32966528-32966550 CAGAGGAAGGACACGGGGGAAGG + Intergenic
1172292131 20:33784114-33784136 AAGAGGAGGGAGAAGGGTGCTGG - Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172626338 20:36349602-36349624 CAGAGAAACAGGAAGGAGGCCGG + Intronic
1172639262 20:36431224-36431246 CAGAGCTAGGAGATGTGGGCTGG + Intronic
1172665962 20:36600326-36600348 CAGAGAAAGTAGAATGGAACTGG + Intronic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1172793895 20:37524123-37524145 CAAAGAAATGAGTAGTGGGCAGG + Intronic
1172870857 20:38134747-38134769 CAGAGAAAGGAGGCAGGGGTGGG + Intronic
1173114719 20:40230295-40230317 GAGAGCAAAGAGAAAGGGGCAGG + Intergenic
1173201302 20:40957203-40957225 GAGAGAAGGGAGAAAGGGGTAGG + Intergenic
1173201634 20:40959413-40959435 GAGAGAAAGGAGGAGAGGGAAGG + Intergenic
1173289759 20:41704204-41704226 CAGTGAATGGAGAAGGGGATGGG - Intergenic
1173370159 20:42427976-42427998 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1173375422 20:42478203-42478225 GGGTGAAAGGAGAAGGGGGAAGG + Intronic
1173492314 20:43493019-43493041 CAGAGGCAGCAGAAGAGGGCAGG + Intergenic
1173547996 20:43914340-43914362 CAGTGAGACGAGGAGGGGGCGGG + Intergenic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174120043 20:48258180-48258202 CAGAGAGAGAAGATGGGGCCAGG - Intergenic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174301557 20:49585913-49585935 CAGAGAAAGAGGAAGGGGACAGG + Intergenic
1174670989 20:52307543-52307565 CAGAAAAAGCAGAAGGGTGGGGG - Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1175069682 20:56322726-56322748 AGGAGAAACGAGAAGGAGGCAGG + Intergenic
1175070901 20:56332945-56332967 GAGAGAAAGGAGGAGGAGCCAGG - Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1176214416 20:63941502-63941524 AAGAGGAAGCAGAAGTGGGCCGG + Intronic
1176281938 20:64318252-64318274 CAGAGAAAGGAAAAGGAACCGGG + Intergenic
1176968155 21:15235143-15235165 CAGGCAAAAGAGAAGAGGGCAGG - Intergenic
1176983805 21:15412802-15412824 CAGAGAAAGGAGAAAGCTCCAGG + Intergenic
1177299256 21:19219568-19219590 AAGAGAAAGCAGAAGGGGAAGGG + Intergenic
1177683899 21:24411594-24411616 CAGTGACAGGACAAAGGGGCAGG - Intergenic
1178074928 21:29006094-29006116 CAGGTAAGGGAGAAGGGGGTTGG + Exonic
1178259768 21:31088374-31088396 CAGAGAGAGGTGAAGCCGGCTGG - Intergenic
1178379685 21:32097380-32097402 AAGAGAGTGGAGTAGGGGGCGGG - Intergenic
1179213835 21:39349316-39349338 CAGACCCAGGCGAAGGGGGCGGG + Intronic
1179253644 21:39696719-39696741 CAGAGAAACAAGAAGGGAGGAGG - Intergenic
1179434277 21:41349673-41349695 GAGGTAGAGGAGAAGGGGGCTGG + Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1179929397 21:44557510-44557532 CAGAGGAAGGAGAGAGGGGGAGG + Intronic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1180840644 22:18957412-18957434 CAAGGAAAGGAAATGGGGGCTGG + Intergenic
1180943297 22:19674550-19674572 AACAGAAAGAACAAGGGGGCTGG - Intergenic
1181060844 22:20281362-20281384 CAAGGAAAGGAAATGGGGGCTGG - Intronic
1181080729 22:20413186-20413208 AAGAGAAAGGGGAAGGGGCAAGG + Intergenic
1181313201 22:21956567-21956589 CAGAGATGGGAGCAGGGAGCAGG + Intergenic
1181346307 22:22222639-22222661 CAGAGATGGGAGCAGGGAGCAGG + Intergenic
1181496141 22:23288523-23288545 CCCAGAAAGGACTAGGGGGCAGG - Intronic
1181539413 22:23565512-23565534 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1181624559 22:24114440-24114462 CACAGAAAAGAGTACGGGGCTGG - Intronic
1181776221 22:25161751-25161773 CAGGAAAAGGAGAAGGGGAGGGG - Intronic
1181814700 22:25429480-25429502 CAGAGCCCTGAGAAGGGGGCAGG - Intergenic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1182033015 22:27174902-27174924 CAGAGCAGGGAGAAGAGGGATGG + Intergenic
1182331725 22:29555736-29555758 CAGGGAAAGTAGAAAGGGCCTGG + Exonic
1182586808 22:31348084-31348106 CAGAGAAAGAGAAAGGGGCCGGG + Intergenic
1183216906 22:36486601-36486623 CAGAGATAGGAGAAGGGTCTGGG + Intergenic
1183257335 22:36770968-36770990 AAGAAAAAGGAGAAGCAGGCGGG - Intronic
1183464328 22:37972070-37972092 GAGAGAAAGGAGAGGGGGAGGGG + Intronic
1183546659 22:38457760-38457782 CAGGGAGAGGAGGAAGGGGCAGG + Intergenic
1183623009 22:38985789-38985811 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183633014 22:39044918-39044940 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183671396 22:39274836-39274858 AAGAGAAGGGGGCAGGGGGCTGG + Intergenic
1183733335 22:39630234-39630256 CAGAGAAGGGAGAAAGGGTTGGG - Intronic
1184093374 22:42303911-42303933 GAGAGAATGGAGAAAGGGGAAGG + Intronic
1184191816 22:42900027-42900049 CAGAGAGCTGAGATGGGGGCAGG - Intronic
1184328775 22:43812358-43812380 GAGATAAACGAGGAGGGGGCGGG + Intergenic
1184374377 22:44102540-44102562 CAGAGAGAGGTGAAGGGGCTGGG + Intronic
1184391358 22:44205338-44205360 CAGGGAAAGGAGCAAGGGCCTGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184704624 22:46202145-46202167 CAGAGGAGGCAGGAGGGGGCTGG - Intronic
1184987885 22:48147762-48147784 CAGAAAAAAGAGAATGGAGCTGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
1185418828 22:50723878-50723900 CAGAGAGGGAAGATGGGGGCTGG - Intergenic
1203325638 22_KI270738v1_random:13100-13122 AAGACAAATGAGAAGAGGGCAGG - Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949927396 3:9052522-9052544 AGGAGAAAGGAGACGGGGACTGG - Intronic
949953366 3:9247859-9247881 CAGAGAAAGGAGGAGCCTGCTGG + Intronic
950055882 3:10024091-10024113 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
950157224 3:10730765-10730787 CAGCGAAGGGAGATAGGGGCGGG - Intergenic
950191278 3:10978105-10978127 CAGAGAGAGGAAGAGGGCGCAGG - Intergenic
950218794 3:11178749-11178771 CGGAGAAAGCAGAAAGGGTCTGG - Intronic
950457182 3:13099778-13099800 CAGAGAGAGGAGCTGGGGGTAGG - Intergenic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
950727147 3:14923827-14923849 CAGACAAAGGCTATGGGGGCTGG - Intronic
950806963 3:15613485-15613507 GAGAGAAGGGAGAAGGGAGTGGG - Intronic
951963217 3:28352070-28352092 GAGACAAAGGAGACGGGGGAAGG - Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952508304 3:34028115-34028137 CAGAGAAAGAACAAGAGGGTCGG - Intergenic
952723945 3:36562154-36562176 CAGAGAGAAGAGAAAGGGCCAGG + Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953055444 3:39383940-39383962 AAGGGAATTGAGAAGGGGGCAGG + Intronic
953850483 3:46462785-46462807 CTGAGAACAGAGAAGGGGGCAGG + Intronic
953850485 3:46462792-46462814 CAGAGAAGGGGGCAGGGAGCTGG + Intronic
953852002 3:46471623-46471645 CGGAGAAAGGAGCAGGGAGCGGG + Intronic
953856566 3:46503800-46503822 CAGGGAAAGGGGGAGGGTGCAGG - Intergenic
953860555 3:46540768-46540790 CAGGGCCACGAGAAGGGGGCAGG - Intronic
953907858 3:46877304-46877326 CAGAGAAATCAGAGGGGGGCTGG - Intronic
953999254 3:47543006-47543028 CAGCGAAGGGAGGAGGGAGCCGG + Intergenic
954140713 3:48603776-48603798 CAGAGACAGGGGAAGGGGGTTGG - Intronic
954689037 3:52386112-52386134 CAGAGAAGAGAAAAGGGGGGAGG + Intronic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
955088078 3:55722197-55722219 CAGAGATAAGAGAATGGGGTTGG + Intronic
955238084 3:57157380-57157402 AAGACAAAGGAGTAGGGGCCTGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
956009634 3:64817047-64817069 AAGAGAAAGGAGCTGGGGGAGGG - Intergenic
956482788 3:69689591-69689613 CAGAGATGGGAGAAGGTGACAGG + Intergenic
956708915 3:72023411-72023433 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
956741582 3:72280001-72280023 GAGAGAAAGAAGAAAGGAGCAGG + Intergenic
957028566 3:75214054-75214076 AGTAGAAATGAGAAGGGGGCAGG - Intergenic
957540129 3:81557501-81557523 GAAAGAAAGGAGAAGGGAGAAGG + Intronic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
957616774 3:82539176-82539198 GAGAGAGAGGAGGAGGGGTCAGG - Intergenic
957734387 3:84187912-84187934 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
957758335 3:84522393-84522415 CAGTGATATGAGACGGGGGCGGG + Intergenic
957768280 3:84655453-84655475 CACAGAAAGGTGAAGGTGGAAGG + Intergenic
957825886 3:85443412-85443434 CAGAGAAATGGGAATGAGGCTGG - Intronic
958047445 3:88303172-88303194 GAGAGAAGGGAGAAGGGAGAAGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960164286 3:114384292-114384314 GGGAAAAAGGAAAAGGGGGCTGG + Intronic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960247156 3:115412476-115412498 CAAAGGAAGGACAATGGGGCTGG - Intergenic
960540064 3:118851904-118851926 CAGAAAAAGGAAAAGGGGAGGGG + Intergenic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961499283 3:127319972-127319994 GAGAGACAGCAGAATGGGGCAGG + Intergenic
961660274 3:128464942-128464964 GAGGGAAGGGAGAAGGGGGAAGG - Intronic
961714199 3:128847575-128847597 GGGAGGAAGGGGAAGGGGGCAGG + Intergenic
961717612 3:128869506-128869528 CAGGGAAAGAACAAGTGGGCTGG - Intergenic
961760335 3:129162476-129162498 CAGAGAAAGGAAAAGGGCAAGGG - Intergenic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962106640 3:132396614-132396636 CAGTGAAAGGTGAAGCCGGCTGG + Intergenic
962324785 3:134423901-134423923 CAGAGAGGGGAGCAGGGGCCAGG - Intergenic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962500013 3:135981763-135981785 GAGAGTAATGAGAAGGGGCCAGG + Intronic
962653377 3:137518149-137518171 GGGAGAAAGGAGAAGAGGGAAGG - Intergenic
962812634 3:138972497-138972519 CAGAGACAGGAGAAGCCAGCTGG + Intergenic
963121167 3:141778240-141778262 CAGGGAAAGCACAAGAGGGCTGG - Exonic
963638040 3:147824085-147824107 CACAGAAAGGAGCAGGGGAGTGG - Intergenic
963692761 3:148525435-148525457 CAGTGAAAGGTGAAGCTGGCTGG + Intergenic
963814473 3:149813780-149813802 CAGGGAAAGAAAAAGGGGGTGGG - Intronic
963880522 3:150523511-150523533 GCGAGGAAGGATAAGGGGGCAGG + Intergenic
964376346 3:156052165-156052187 GAGAGAAAGAAAAAGGGGGAGGG - Intronic
964931297 3:162027843-162027865 CAGGGAAAGGTGAAGGTTGCAGG + Intergenic
964993952 3:162851002-162851024 CATAGAAAGAAGAGGGAGGCCGG - Intergenic
965070008 3:163907814-163907836 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965389561 3:168088707-168088729 GAGAGAAACCAGAAGAGGGCAGG - Intronic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
965625213 3:170677952-170677974 CAGTGAAAGGAGACAGGGGTGGG + Intronic
965640384 3:170823455-170823477 CAGAGAAGGGAGATAGGGGTGGG + Intronic
965787647 3:172352869-172352891 CAGAGAGTGGAGACGGGGTCAGG - Exonic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966234755 3:177688169-177688191 CACAGAAAGGAAAAGAGGGAAGG - Intergenic
966305861 3:178533922-178533944 AAGAGAAGGGAGAAGAGGGGAGG - Intronic
966362758 3:179148284-179148306 CGGAGAAAGGAGTCGGGGGCGGG + Intronic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
966742310 3:183245255-183245277 AACAGAAAGGAGAAGGGGAATGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
966941180 3:184748409-184748431 GAGTGAAAAGAGAAGGGGTCAGG - Intergenic
967152598 3:186663569-186663591 CAGAGAAGGGAGATGGGGTGGGG - Intronic
967332817 3:188308953-188308975 AGGAGAAAGGAGAAGGGAGAAGG - Intronic
967381434 3:188863516-188863538 CAGTGTCAGGAGGAGGGGGCTGG - Intronic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967654261 3:192027478-192027500 GACAGAAAGGCAAAGGGGGCTGG - Intergenic
967664886 3:192159079-192159101 TAGAGAAATGAGGAGGGAGCTGG - Intronic
967862283 3:194161125-194161147 GAGAGAAAGGAGTATGGGGTGGG - Intergenic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968075836 3:195815812-195815834 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075848 3:195815857-195815879 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075860 3:195815902-195815924 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075872 3:195815947-195815969 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075897 3:195816037-195816059 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075909 3:195816082-195816104 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075921 3:195816127-195816149 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075933 3:195816172-195816194 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075945 3:195816217-195816239 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076095 3:195816780-195816802 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076131 3:195816908-195816930 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076231 3:195817253-195817275 CTGCGTAAGGAGAAGGAGGCCGG - Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968274339 3:197428385-197428407 CTGAGCAAGGAGAAGGGCGGTGG + Intergenic
968651260 4:1761152-1761174 CAGTGACAGGAGATGGGGGCGGG - Intergenic
968726590 4:2250747-2250769 CAGAAAAGGGAGAAATGGGCTGG - Intronic
968870693 4:3240579-3240601 GAGAGAAGGGAGAATGGTGCCGG - Exonic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969264779 4:6057338-6057360 CAGAGAAGGGAGGAGGGAGTTGG - Intronic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969481370 4:7448751-7448773 GAGAGAAAGGAAAAGAGGGAGGG - Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
970005878 4:11410306-11410328 CAGAGGAAAGAGATGGGAGCTGG + Intronic
970323106 4:14894995-14895017 CAGAGAAAGGGGGTAGGGGCAGG - Intergenic
970417360 4:15872742-15872764 GATAGAAAGAAAAAGGGGGCCGG + Intergenic
970652887 4:18197947-18197969 AAGAGAATGGAGAGGGGGTCAGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971094666 4:23387296-23387318 CAGGAAATGGAGAAGGGTGCAGG - Intergenic
971130065 4:23798125-23798147 CAGAGAAGGGAGATGGGGTGGGG - Intronic
971424332 4:26501377-26501399 CACAGAAAGGAGATGGGGTGAGG - Intergenic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972138142 4:35918881-35918903 CAGAGAAGTGAGAAAGGAGCTGG + Intergenic
972351998 4:38244559-38244581 CAAGGGAAGGAGGAGGGGGCCGG - Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
973944862 4:55945902-55945924 CAGCGAAAGGAGATAGGGGTGGG - Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974904414 4:68037452-68037474 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
975783357 4:77862722-77862744 AAGAGAAAGAGGAACGGGGCGGG - Exonic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976267185 4:83195446-83195468 AAGAGCAAGGAGAAGAGGGCGGG - Intergenic
976467599 4:85388379-85388401 CAGAGAATGGAGAAGGTGCTTGG + Intergenic
976803417 4:89019017-89019039 CAGAGAAGTGAGAAGAGGCCAGG + Intronic
976986250 4:91302690-91302712 CAGAGAAAAGGGAAAGTGGCTGG - Intronic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
977263159 4:94822562-94822584 AAGAGAAGGGAGAAGGGAGTTGG - Intronic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977805131 4:101288526-101288548 AGGAGAAGGGAGAAGGGAGCGGG + Intronic
978244094 4:106551518-106551540 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
978407691 4:108397132-108397154 CAGAGAAAGGGGTGGGGGGAGGG + Intergenic
980888961 4:138793777-138793799 GAAAGAAAGGAGAAGAGGGGAGG + Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
980928013 4:139158075-139158097 CAGAGAAGGGAGATAGGGGTGGG + Intronic
981269345 4:142826450-142826472 AAGAGAATGGAAAAGGGGACAGG - Intronic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982180825 4:152746810-152746832 CAGCGAAGGGAGATGGGGGTGGG + Intronic
982495672 4:156088891-156088913 AAGAGAGAGGAGAAGGTGCCAGG - Intergenic
982612695 4:157596685-157596707 CAGCGAAGGGAGAAAGGGGTGGG + Intergenic
983056023 4:163100040-163100062 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983056581 4:163103990-163104012 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
983195406 4:164800703-164800725 CAGAGAAAGCTGTAGAGGGCTGG - Intergenic
983805323 4:171986207-171986229 CAGAGAAAGGAGATAAGGGTGGG + Intronic
984217059 4:176926579-176926601 CAGTGAGAGGAAAAGAGGGCCGG + Intergenic
984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG + Intergenic
985078065 4:186237807-186237829 CAGAGAGGTGGGAAGGGGGCGGG - Intronic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
986023669 5:3829008-3829030 GAGAGAAAACAGCAGGGGGCAGG + Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986140542 5:5025963-5025985 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
986254590 5:6091621-6091643 CAGAGAAAGGAGGAAGGGACAGG + Intergenic
986429193 5:7664979-7665001 CAAAGTGAGGAGGAGGGGGCGGG - Intronic
986865516 5:11981859-11981881 CAGAGAAAGTAGAATGTGGAAGG - Intergenic
987011787 5:13773854-13773876 CAGACAAAGGAGGAGTGGGTGGG + Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987368114 5:17168209-17168231 CAGAGAGATGAGAAGCAGGCAGG + Intronic
987497646 5:18668944-18668966 CAGCGAAGGGAGATAGGGGCAGG + Intergenic
987503954 5:18746306-18746328 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
987622640 5:20355117-20355139 AAGAGAAAGGGGAAAGGAGCTGG - Intronic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
988665110 5:33318334-33318356 CAGAGAGAGGAGATGGGGATTGG + Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989180911 5:38575992-38576014 CAGAGGAAGGTGATGGGGGAAGG + Intronic
989186678 5:38632730-38632752 AAGAGAAAGGATAAAAGGGCAGG + Intergenic
989408269 5:41086725-41086747 AAGAGAAACCAGAAGGAGGCTGG - Intergenic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
990513870 5:56514508-56514530 CAGAGACAGGGGAAGGTGCCAGG - Intronic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
991423149 5:66462232-66462254 CAGAAAAAGGAGAATAGAGCTGG - Intergenic
991501520 5:67281999-67282021 CGGAGAAGGGGGAAGGGGGAAGG - Intergenic
991982132 5:72243110-72243132 CAGAGATGGGAGAGGGGGTCAGG + Intronic
992080436 5:73231016-73231038 TAGACAATTGAGAAGGGGGCTGG - Intergenic
992384423 5:76270044-76270066 GAGACAAAGGAGAAAGGGGATGG + Intronic
993263214 5:85688446-85688468 CAGAGAGAGTAAAATGGGGCTGG - Intergenic
993418886 5:87674875-87674897 AGGAGAAAGGAGAAAGGAGCAGG - Intergenic
995352339 5:111193845-111193867 CAGAGTATGTAGAAGAGGGCAGG + Intergenic
995443976 5:112222623-112222645 CAGAGAAAGAAGAATGGAGTTGG - Intronic
995714495 5:115068784-115068806 CAGAAAAAGGAGAAGAGGAGGGG - Intergenic
996052206 5:118947547-118947569 CAGAGAGAAGAGAAGGGGAGAGG - Intronic
996337033 5:122395663-122395685 CACACAAAACAGAAGGGGGCAGG - Intronic
996387597 5:122925263-122925285 GAAGGAAAGGAGAAGGGGGAGGG - Intronic
996393241 5:122986480-122986502 CAGAAAAAAGAGAAGTGGGAGGG + Intronic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997191832 5:131945185-131945207 CAGAGAAAGCAGAGCGGAGCAGG - Intronic
997365057 5:133320319-133320341 CAGTGAAACCAGCAGGGGGCAGG - Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997506539 5:134422019-134422041 AAGAGAAAGGAGAAGAAGGAAGG - Intergenic
997529872 5:134575418-134575440 CAGAGAAACTGGAAGGAGGCTGG + Intronic
997535331 5:134616039-134616061 CTGAGACAGGAGAATGTGGCAGG + Intronic
997932504 5:138084022-138084044 CAGAGAAGTGAGGAGAGGGCAGG - Intronic
998174773 5:139894997-139895019 CAGATAAAGAAGAAGGGGAAGGG + Intronic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
998961031 5:147487221-147487243 CAAAGACAGGAGAAAGGGGGAGG - Intronic
999054283 5:148557161-148557183 CAGAGTAATGACATGGGGGCAGG + Intronic
999261599 5:150241886-150241908 CACAGAATGGGGAAGGGGCCAGG + Intronic
999319338 5:150603724-150603746 CAGAGGAAGGAGCACAGGGCTGG + Intronic
999717319 5:154371742-154371764 CAATGCAAGGAGAATGGGGCAGG - Intronic
999771521 5:154779802-154779824 TAGAGAATGTAGAGGGGGGCTGG - Intronic
1000242473 5:159421369-159421391 CAGAGAAGGGAGAGAGGAGCAGG - Intergenic
1000264225 5:159619469-159619491 CAGAGCAAGGACCCGGGGGCAGG - Intergenic
1000294086 5:159897886-159897908 CAGAGTAAGGACAAGGGCACTGG + Intergenic
1001265484 5:170271172-170271194 CAGAGAGAGAAGAAAGGGGAAGG + Intronic
1001411507 5:171515609-171515631 CCGAGAGAGGGGAAGGGGCCAGG + Intergenic
1001714347 5:173802775-173802797 CTGAGATATGAGAAGGGGACAGG - Intergenic
1001947962 5:175796515-175796537 CCGAGAAAGGAGGCGGGGGCTGG - Exonic
1002097999 5:176843424-176843446 GACAGAAAGCAGAAGGGGGTTGG + Intronic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002212058 5:177605019-177605041 GAGGGAAAGGAGGTGGGGGCTGG - Intronic
1002253630 5:177944023-177944045 CAGAGGTAGGAGCAGGGCGCAGG - Intergenic
1002460353 5:179370231-179370253 AGAAGAAATGAGAAGGGGGCTGG - Intergenic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1004012454 6:11702687-11702709 CAGAGAAAGGAGGTGAGGCCAGG + Intergenic
1004017056 6:11741785-11741807 GAGAGAGAGGGGAAGGGGGCAGG - Intronic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1004181803 6:13386970-13386992 CTGAGAAATGAGATGGAGGCTGG - Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004390109 6:15202849-15202871 AAGAGAAATGAGAAGGGGTCAGG + Intergenic
1004574899 6:16886263-16886285 CAGTGAAGGGAGATGGGGGTGGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005220277 6:23578798-23578820 GAGAGATAGGAGATGGGGTCAGG + Intergenic
1005223927 6:23620001-23620023 GAGAGAGAGGGGGAGGGGGCGGG + Intergenic
1005755581 6:28922989-28923011 CAGAGAAAAGAGAGTGGGGGTGG + Intronic
1005886826 6:30103370-30103392 CTGAGAGTGGAGATGGGGGCGGG - Exonic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006303684 6:33207166-33207188 CAGAGAAAGGAGAGGGGTGGGGG - Intergenic
1006398492 6:33802198-33802220 CAGAGGAAGGCACAGGGGGCAGG + Intronic
1006567806 6:34974309-34974331 AAGAGAAAGGGGAAGGGGAAGGG - Intronic
1006575030 6:35038779-35038801 CAGAAAAAGGAAAAGTGGCCAGG - Intronic
1006789020 6:36686613-36686635 AAGGGAAAGGACAAGGGGGAGGG - Exonic
1006972429 6:38060448-38060470 CAGAGAGAGGAGAAAAGGGAGGG - Intronic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007589681 6:43013745-43013767 AGGAGAGGGGAGAAGGGGGCGGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007765578 6:44157930-44157952 CCCAGAAAGGAGAAAGGGGGAGG + Intergenic
1007950594 6:45868730-45868752 CAGATAAAGGAGTAGGGTGTGGG + Intergenic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008276843 6:49551855-49551877 AAGAGAAACAAGAGGGGGGCGGG - Exonic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008613463 6:53205035-53205057 CAGAGAGATAGGAAGGGGGCAGG - Intergenic
1008816124 6:55568902-55568924 CACAGAAAGAAGAAAGGGTCAGG + Intronic
1008862981 6:56173376-56173398 AAGGGAAAGGAGAAGGGGAAGGG + Intronic
1009359827 6:62797329-62797351 CAGAGAAGGGAGATGGGGTGGGG - Intergenic
1009464087 6:63950469-63950491 CAGAGAAGGGAGATAGGGGTGGG - Intronic
1009514533 6:64598163-64598185 AAGAAAAAAGAGAAGGGGCCAGG + Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010071204 6:71748460-71748482 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1010869681 6:81021991-81022013 AAGAGAAAGGAGAAGGGGTAGGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012523646 6:100151016-100151038 CAGAGAAAGGAGCAGCTAGCAGG + Intergenic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1012961344 6:105625317-105625339 AAGAGAAAAGGGAAGGGGGGGGG + Intergenic
1013307442 6:108862644-108862666 CAGAGATAGGGGAAGGGAGAGGG + Intronic
1013348236 6:109282957-109282979 AAGAGAAAAGAGAAGAGGGGAGG - Intergenic
1013539189 6:111090599-111090621 AAGAGAAAGGGGTAGGGGACAGG - Intronic
1013764871 6:113563038-113563060 CAGAGAAGGATGAAGGTGGCAGG - Intergenic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014795506 6:125719833-125719855 CTGAGAAAGGAGTTGGGGGTAGG + Intergenic
1014952051 6:127567890-127567912 CAGAGATAAAAGAATGGGGCAGG + Intronic
1015190308 6:130465015-130465037 GAGAGAAAGGAGAAGGTTCCAGG + Intergenic
1015208896 6:130672884-130672906 TGGAGAAAGGATGAGGGGGCGGG - Intergenic
1015337633 6:132058847-132058869 CACAGAAAGCAGAATGGGTCTGG + Intergenic
1015411062 6:132894425-132894447 TAGAGGAAGGAGGAGGGGGTTGG + Intergenic
1015434968 6:133174737-133174759 AAGACAAAGGAGAAGGGGAAGGG - Intergenic
1015471628 6:133612758-133612780 CAGAGAAAGGAGCATGGAGAGGG - Intergenic
1015589611 6:134810437-134810459 CAGAGAAAGAAGAGGAGGGAGGG - Intergenic
1015889513 6:137955486-137955508 CAGGGCAAGAAGAAGAGGGCGGG + Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018349333 6:162940406-162940428 GAGAGATAGGAGAAATGGGCAGG - Intronic
1018582732 6:165321468-165321490 CAGAGAAAAGAGAAGGCAACTGG + Intergenic
1018791430 6:167151229-167151251 AAGAGAAAGCACAAGGGGCCAGG + Intronic
1019026267 6:168966125-168966147 CAGAGAAAAGAGGAGAGGGGAGG - Intergenic
1019227799 6:170529579-170529601 GAGAGAAGGGAGCAGGGGACTGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019410728 7:905480-905502 AGGAGAAAGGAGAAGGGAGAAGG + Intronic
1019410780 7:905733-905755 AAGGGAAAGGAGAAGGGAGAAGG + Intronic
1019410793 7:905803-905825 AGGAGAAAGGAGAAGGGAGAAGG + Intronic
1019410963 7:906640-906662 AAGGGAAAGGAGAAAGGGGGCGG + Intronic
1019562828 7:1666631-1666653 CAGAAAGAGGGGGAGGGGGCTGG + Intergenic
1019637172 7:2082150-2082172 CAGAGAAAGGGAAGGGAGGCAGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020668097 7:11072869-11072891 CAGAGAAAAGAGGAGGTGTCAGG + Intronic
1020728202 7:11843736-11843758 TAGAAAAGAGAGAAGGGGGCAGG - Intergenic
1021261786 7:18467389-18467411 CAGAGAAAGCAGCAGAGGCCTGG - Intronic
1021263934 7:18495764-18495786 CACAGATAGGAGAAGGGCACCGG + Intronic
1021510417 7:21427687-21427709 CTGGGAAATGAGTAGGGGGCGGG + Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1021867476 7:24972341-24972363 AAGAGAAAAGAGAATGTGGCTGG - Intronic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022417677 7:30191948-30191970 TAGAGGAAAGACAAGGGGGCGGG + Intergenic
1022573031 7:31472078-31472100 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023308498 7:38856601-38856623 CAGAGAAAAGAGAAAGGGTGGGG + Intronic
1023792389 7:43763208-43763230 CAGAGCTGGGAGGAGGGGGCTGG + Intronic
1023968798 7:44977195-44977217 TGGAGAAGGAAGAAGGGGGCAGG + Intronic
1024263671 7:47590299-47590321 GAGAGAAAGAAGAAGAGGGAAGG - Intergenic
1024785070 7:52898158-52898180 GAGAGAAAGGAGGAGAGGGAGGG + Intergenic
1024807171 7:53156397-53156419 AAGACAAATGAGAAGAGGGCGGG - Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025319516 7:58079792-58079814 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025489153 7:61090255-61090277 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025554199 7:62283679-62283701 AAGACAAATGAGAAGAGGGCAGG - Intergenic
1025560582 7:62369595-62369617 AAGACAAATGAGAAGAGGGCAGG + Intergenic
1025665454 7:63580766-63580788 CCGAGAAAGGAGAAGCAGCCGGG + Intergenic
1026158951 7:67852217-67852239 AAGAGAAAGGAGAAAGAGGAGGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026623384 7:71971151-71971173 CAAAGAAAGGAGATGAGGCCAGG + Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1026939755 7:74280683-74280705 GAGAGAGAGGAGGAGGAGGCTGG - Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027633305 7:80636164-80636186 CAGAGAACGGAGAGGGGAGGAGG + Intronic
1028235851 7:88360938-88360960 TCCAGAAAGGAGATGGGGGCTGG + Intergenic
1028815717 7:95141521-95141543 CAGAGAAGGGAGAGGAGAGCTGG - Intronic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029419199 7:100463709-100463731 GAGAGACAGGAGAGAGGGGCAGG + Intronic
1029538057 7:101167263-101167285 AAGAGAGAAGAGATGGGGGCAGG + Intergenic
1029564124 7:101323736-101323758 CATAGAAAGGAGAACCGGGCTGG - Intergenic
1029657230 7:101935311-101935333 CAGCGAAGGGAGAAAGGGGTGGG - Intronic
1030152350 7:106420154-106420176 CAGAGAATGGAGAGGTGGGGAGG - Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030384292 7:108848730-108848752 GAGAGAAAGGAGGAGAGGGGAGG - Intergenic
1030441978 7:109597290-109597312 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
1030614941 7:111729261-111729283 CAGATAGAGGAGAAAGGAGCTGG + Intronic
1030678152 7:112406303-112406325 CAGAGAAAGGTGTCGGGGGAAGG + Intergenic
1030798524 7:113819522-113819544 CAAAGAATGGAAAAAGGGGCAGG + Intergenic
1031483618 7:122304950-122304972 CAGAGGAAGCAAAAGGGGGGTGG - Intronic
1031543367 7:123023322-123023344 CAGATAGAGGAGATGGGGGTTGG + Intergenic
1031777926 7:125923989-125924011 CAGTGAAGGGAGAAAGGGGTGGG - Intergenic
1031941836 7:127797600-127797622 CAGGGAAAGGAAGATGGGGCAGG + Intronic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032173544 7:129605812-129605834 CAGATAGAGGGGAAGCGGGCGGG - Intergenic
1032398263 7:131606274-131606296 CAGAGAAGGGAGAAGAGGTTAGG - Intergenic
1032479757 7:132236854-132236876 GAGAGAAAGGAGAAGGCTGGGGG - Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033137726 7:138798635-138798657 CAGAGAAAGTACAAGGGGCAGGG - Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033437609 7:141347713-141347735 CAGAGAAGGCAGACGGGGGGTGG - Intronic
1033601619 7:142892820-142892842 CAGAGAATGGAAAAGGGAACAGG - Intergenic
1033909823 7:146248915-146248937 CAGTGAAGGGAGAAAGGGGTGGG + Intronic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1034227818 7:149497177-149497199 CAGAGAAAGGAGCCGCGGGTGGG + Intronic
1034336114 7:150324621-150324643 CAGAGAAAGTAGGATGGGTCTGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034390014 7:150778927-150778949 AAGAGAAAGGAGATGGGAGTGGG - Intergenic
1034466141 7:151230269-151230291 AAGAGAGAGGAGAAAGGGACTGG + Intergenic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1034993266 7:155561282-155561304 AAGAGAAAGGGGAATGGGGATGG + Intergenic
1035070413 7:156140568-156140590 CAGAGAGAGGAGAAAGAGGCAGG + Intergenic
1035229824 7:157458292-157458314 CAGAGAAAGGAGGAGAGCGGTGG + Intergenic
1035291307 7:157840953-157840975 TTGAGAGAGGAGGAGGGGGCAGG - Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1036077575 8:5518884-5518906 CAGAGAAATGAGAGGGCAGCTGG - Intergenic
1036283932 8:7426804-7426826 CAAAGAGAGGAGAAAAGGGCTGG - Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036337543 8:7884726-7884748 CAAAGAGAGGAGAAAAGGGCTGG + Intergenic
1036538533 8:9677857-9677879 GAAAGAAAGGAGAAGGGGAATGG - Intronic
1036589706 8:10157770-10157792 GAGAGAAAGAAGAAGAGGGCGGG - Intronic
1037440356 8:18909947-18909969 CAGCGAAAGGAAAAAGTGGCAGG + Intronic
1037583611 8:20261546-20261568 GGGAGAATGCAGAAGGGGGCTGG - Intronic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037670800 8:21013601-21013623 CAGAGGAAGGAGGGGGGTGCAGG - Intergenic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1037833291 8:22201457-22201479 AAGAGAAAGGAGCAGGACGCAGG - Intronic
1037835218 8:22211567-22211589 CAGAGAAAAGAGATGGGGTAAGG - Intronic
1037876491 8:22551420-22551442 CGGAGCCAGGACAAGGGGGCAGG - Intronic
1037992597 8:23331322-23331344 CAGAGGAGGGAGAAGGGCTCTGG - Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038310545 8:26443118-26443140 CACTGAAAGGAGAAAGGGGGAGG + Intronic
1038539997 8:28384421-28384443 CAGAGAAGGGAGTTGTGGGCAGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1038617702 8:29110437-29110459 CAGAGAAAGGGAAGAGGGGCTGG + Intronic
1039473943 8:37829587-37829609 CAGAGAAAGGGACAGGGGTCTGG - Intronic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039897457 8:41726129-41726151 CAGAGAAAGGAAGTGGAGGCAGG - Intronic
1040399065 8:47029953-47029975 GAGAGAAAGGAGAGGTGGGGTGG + Intergenic
1040638416 8:49302867-49302889 CAGAGAAAGGAGACATGGCCTGG + Intergenic
1041309733 8:56503162-56503184 CAGGGAAAGGAGATGGGGTCTGG + Intergenic
1041347292 8:56912731-56912753 CAGAGAAAGTAGAAGTGCCCAGG - Intergenic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1042877431 8:73452032-73452054 CAGAGCAAGGAGCTGGGTGCAGG + Intronic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043517359 8:81007047-81007069 CATAGAGAAGTGAAGGGGGCAGG - Intronic
1043920704 8:85980246-85980268 GAGAGAGAGGAGGAGGGGCCAGG - Intergenic
1044157141 8:88861471-88861493 CAGAGAGAGGATAAAGGGACGGG - Intergenic
1044803010 8:95976365-95976387 CTGAGACAGGTGAAAGGGGCTGG - Intergenic
1044922470 8:97180614-97180636 CAGCGAAGGGAGATGGGGGTGGG - Intergenic
1045130806 8:99149927-99149949 CACAGACAGGAGAAGGGGTATGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1045769298 8:105716034-105716056 CAGAGAAAAGAGATGCTGGCAGG + Intronic
1046077482 8:109330885-109330907 CAGAGAATGGGGTAGGGGGAGGG + Intronic
1046438337 8:114225401-114225423 CAGAGAAAGGAAAGGGAGGAAGG - Intergenic
1046520672 8:115321053-115321075 TAGAGCAGGAAGAAGGGGGCTGG - Intergenic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1047139529 8:122121937-122121959 GAGAGAAAGGAAAAGAGGGATGG - Intergenic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047329615 8:123874870-123874892 CAGAGAAATGAGATGGTAGCTGG - Intronic
1047354887 8:124111179-124111201 AAGAGAAAAGAAAAGGGGGAAGG + Intronic
1047489596 8:125363595-125363617 AGGAGAAAGGAGGAGGGGGAGGG + Intronic
1048010132 8:130448793-130448815 CAGAGAAGGGAGTAGGTGGTGGG + Intergenic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048711357 8:137214968-137214990 GAGAGAATGGAGGTGGGGGCGGG + Intergenic
1048764568 8:137830268-137830290 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1048830388 8:138471105-138471127 TAGAGAAAGGTGAGAGGGGCAGG + Intronic
1049235649 8:141510936-141510958 CCCAGGCAGGAGAAGGGGGCTGG + Intergenic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1050252332 9:3758001-3758023 TAGACAAAGGAAAAGGGGGTTGG - Intergenic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1051527603 9:18064204-18064226 AAGAGCAAGGAGAAGGGTGTGGG + Intergenic
1051585938 9:18726902-18726924 CTGAGAAAAGAGACTGGGGCTGG - Intronic
1051594989 9:18816142-18816164 CAGAGACTGGGGAAGGGAGCGGG - Intronic
1051640905 9:19223774-19223796 CAGAGAAAGGAGTAATGGGCAGG - Intergenic
1052020974 9:23524886-23524908 TAGAGAGAGGAGAAGGGAGGTGG - Intergenic
1052282882 9:26753141-26753163 CAGAGAATGGTGAAGGGGAGTGG - Intergenic
1052560166 9:30075328-30075350 CAGAAAAAGGAAAAGGGGAGGGG - Intergenic
1053263860 9:36696078-36696100 CAGGGACAGGAGAAGGGGTGAGG - Intergenic
1053453739 9:38214713-38214735 TAGAGGAAGGAGAAGGGGAAAGG + Intergenic
1053454960 9:38226893-38226915 CAGAGTAAGGGGGCGGGGGCTGG + Intergenic
1053522519 9:38794657-38794679 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1053541398 9:38977513-38977535 GAGAGAAAGGAGAGGAGGGAAGG + Intergenic
1053805819 9:41800556-41800578 GAGAGAAAGGAGAGGAGGGAAGG + Intergenic
1054194747 9:62019079-62019101 CAGAGACAGGAGGAGAGGACAGG - Intergenic
1054337134 9:63817337-63817359 CACAGAAAGGAGAACTGGCCTGG + Intergenic
1054624740 9:67386395-67386417 GAGAGAAAGGAGAGGAGGGAAGG - Intergenic
1054643661 9:67569611-67569633 CAGAGACAGGAGGAGAGGACAGG + Intergenic
1054807776 9:69410007-69410029 CAGCGAAAGGAGATGGGGTGGGG + Intergenic
1055626366 9:78180982-78181004 CAGAGAAGGGAGATAGGGGTAGG - Intergenic
1055627259 9:78186697-78186719 CAGAGAAGGGAGATAGGGGTGGG - Intergenic
1055792279 9:79935682-79935704 GAAAGAAAGGAGACGGGGGTGGG - Intergenic
1056139420 9:83660670-83660692 CAGAGAAAGGGGGACGGGGTGGG - Exonic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1056332713 9:85534886-85534908 GAGAGAGAGGAGAAGGAGACAGG - Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056532441 9:87498663-87498685 CAGAGAAAGGGGAGGCGGGGAGG + Intronic
1057516607 9:95727274-95727296 AAGAGGAAAGAGAAGGGGGGTGG - Intergenic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1058569610 9:106326495-106326517 AAGAGAAAAGAAAAGAGGGCGGG - Intergenic
1058575863 9:106400413-106400435 TAGAGATAGGAGAAGGTAGCAGG + Intergenic
1058766763 9:108189461-108189483 CCAAGATAGGAGAAGGGGGTAGG + Intergenic
1058940953 9:109812224-109812246 CTGAGAAGGGAGAAGGGAGGAGG + Intronic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1059165567 9:112073509-112073531 CAGAGAGAGGAGGATGGGGGTGG - Intronic
1059202828 9:112433992-112434014 CAGAGAAAGGATCAGAGGGCCGG + Intronic
1059363383 9:113765865-113765887 AAGAGAAAGGAAAAGGGTGGTGG - Intergenic
1059385328 9:113959903-113959925 CGTTTAAAGGAGAAGGGGGCCGG - Intronic
1059518142 9:114914737-114914759 CCCAGAAAGGAGAAGGGTGTGGG + Intronic
1059542505 9:115144330-115144352 AAGGGAAAGGAGAAGGGGAGGGG - Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1060171077 9:121461560-121461582 AAGAGAAGGGAAAAGGGGGCTGG + Intergenic
1060338598 9:122751717-122751739 GAGAGAAAGGAGAATACGGCTGG + Intergenic
1060718955 9:125961275-125961297 CAGAGAAAGGACAGCGGTGCTGG - Intronic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1060813088 9:126620882-126620904 CAGCCAATGGAGAAGGGGGTAGG + Intronic
1060879967 9:127111195-127111217 CAAACAACGAAGAAGGGGGCAGG - Intronic
1061013945 9:127971343-127971365 AATGGAAAGGAGGAGGGGGCTGG - Intronic
1061275555 9:129568018-129568040 CTGGGAAAGGAGAGGGTGGCAGG + Intergenic
1061374466 9:130215797-130215819 CAGGGAAAGGTGCAGAGGGCTGG + Intronic
1061615946 9:131779014-131779036 CAGAGATGGAAGAAGGGGCCAGG + Intergenic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1061652859 9:132065365-132065387 CAGGGAAAGGAGAAGAGCGGCGG + Intronic
1061890124 9:133614886-133614908 CAGAGAAAGGAGAATGGCAGGGG + Intergenic
1061940872 9:133883096-133883118 CAGAGAGAGCAGCAGGGGGTGGG - Intronic
1062228272 9:135465990-135466012 GGGAGAAAGGAGATGGAGGCAGG + Intergenic
1062240723 9:135536377-135536399 GACTGCAAGGAGAAGGGGGCGGG - Intergenic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062483857 9:136764626-136764648 CAAACAATGGACAAGGGGGCCGG - Intronic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1185450598 X:279010-279032 CAGCGAAGGGAGATGGGGGAGGG + Intronic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185545720 X:942296-942318 GAGAGAAAGAAGAAGAGGGGGGG + Intergenic
1185617549 X:1432531-1432553 AAGAAAAGGGAGAAAGGGGCCGG + Intronic
1185857931 X:3553245-3553267 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1185884893 X:3773667-3773689 CAGAGAAATGAGAAGGCAGGAGG - Intergenic
1186026494 X:5319377-5319399 CCAAGCAAGGAGAATGGGGCAGG + Intergenic
1186342215 X:8657054-8657076 CAGAGAAGTGGGAAGGGGGCAGG + Intronic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1187086050 X:16044813-16044835 CAGCGAAGGGAGATGGGGGTGGG + Intergenic
1187097726 X:16165112-16165134 GAGAGAAAGGAGAGAGGGGGTGG - Intergenic
1187298251 X:18023658-18023680 CGGAGAAGGGAGAAGGGGTGTGG - Intergenic
1187377096 X:18764689-18764711 GTGAGGAAGGAGGAGGGGGCAGG + Intronic
1187426827 X:19185355-19185377 GAGAGAAAGGAGAGGGGAGGAGG - Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188510613 X:30932151-30932173 CAGAGAAAGGGGAAGGGCTGGGG + Intronic
1189110593 X:38286077-38286099 AAGAGGAAGGAGAAGGGGAAGGG - Exonic
1189110638 X:38286203-38286225 GAGAGGAAGGAGAAGGGGAGGGG - Exonic
1189124605 X:38433164-38433186 CAGAGACCAGAGAAGGGGTCAGG - Intronic
1189140703 X:38602682-38602704 AAGAGAATGGAGAGGTGGGCGGG + Intronic
1189169769 X:38897828-38897850 GTGAGAAAGGACAAGGTGGCCGG + Intergenic
1189203495 X:39217973-39217995 CAGAGATAGGCCAAGGGGACAGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1190598070 X:52066215-52066237 GAGAGGAAGGAGATGGGGGAGGG + Intronic
1190610754 X:52187858-52187880 GAGAGGAAGGAGATGGGGGAGGG - Intronic
1190842117 X:54154903-54154925 GACAGAAAAGAGAAGGGGCCGGG + Intronic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1190937221 X:55007875-55007897 CAGAGAAAGGGGAGGAGGGAGGG + Exonic
1191171469 X:57451818-57451840 CAAAGAAAGCAGGATGGGGCAGG - Intronic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191836655 X:65470386-65470408 AAGGGAGAGGAGATGGGGGCTGG + Intronic
1191846213 X:65549977-65549999 CAGACACAGGAGGAGAGGGCAGG + Intergenic
1192143953 X:68668206-68668228 AAGAGAAAGAAGAAGGAGGAGGG - Intronic
1192184339 X:68936504-68936526 CAGAGAAGGGAGGAGAGAGCTGG + Intergenic
1192206816 X:69101854-69101876 AAGAGCAAGGAAAGGGGGGCCGG - Intergenic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192538157 X:71946184-71946206 CACAGACAGGAGCAGGAGGCAGG + Intergenic
1192617524 X:72643148-72643170 CAGAGAAAAGGGAAGGAGACTGG + Intronic
1193994042 X:88343514-88343536 CAGAGAAGGGAGATAGGGGTGGG + Intergenic
1195327154 X:103767032-103767054 CAGAGAAGGGAGACAGGGGTGGG + Intergenic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195907267 X:109856768-109856790 CAGAGAGAGAGGATGGGGGCAGG + Intergenic
1196237581 X:113300064-113300086 CAGAGAGAGGAGGAGGGGAAGGG - Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1197355141 X:125430325-125430347 CAGAGACAGGAGAAGGAGAAGGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197754033 X:129982745-129982767 GAGAGAGAGGAGAAGGAGGTCGG + Intronic
1198068574 X:133124907-133124929 CAGAGAAAGGGGAGGGGGCATGG + Intergenic
1198116481 X:133549697-133549719 GAGAGACAGGAGAGGGGGGAAGG - Intronic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198640958 X:138756252-138756274 CAGAGAAAAGAGAAGGCAGCTGG + Intronic
1199034397 X:143033243-143033265 GAGAATAAGGAGAACGGGGCTGG + Intronic
1199297049 X:146171219-146171241 AGGAGAAAGGAGAAGGAGGAAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200108869 X:153728921-153728943 CCGAGCCAGGAGGAGGGGGCTGG + Intronic
1200307757 X:155045719-155045741 CACAGAAAAGGGAAGGGGGCTGG + Intronic
1200377255 X:155796252-155796274 CTCAGAAAGGGGGAGGGGGCAGG - Intergenic
1200942641 Y:8801665-8801687 CAGTGAAAGGAGATAGGGGTGGG - Intergenic
1201365862 Y:13205512-13205534 CAGAAAAGGGAGATGGGGGTGGG + Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1201595196 Y:15660488-15660510 CAAAGCAAGAAGAAGGGGGAAGG - Intergenic