ID: 1019781254

View in Genome Browser
Species Human (GRCh38)
Location 7:2941284-2941306
Sequence CAGGTTAATCACTGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019781254_1019781263 16 Left 1019781254 7:2941284-2941306 CCTGCACCCCAGTGATTAACCTG 0: 1
1: 0
2: 2
3: 18
4: 295
Right 1019781263 7:2941323-2941345 GGCGTGCAGGAAGCAGCCCGAGG 0: 1
1: 0
2: 0
3: 25
4: 201
1019781254_1019781260 -5 Left 1019781254 7:2941284-2941306 CCTGCACCCCAGTGATTAACCTG 0: 1
1: 0
2: 2
3: 18
4: 295
Right 1019781260 7:2941302-2941324 ACCTGAGACGATGAAGAAAGGGG No data
1019781254_1019781259 -6 Left 1019781254 7:2941284-2941306 CCTGCACCCCAGTGATTAACCTG 0: 1
1: 0
2: 2
3: 18
4: 295
Right 1019781259 7:2941301-2941323 AACCTGAGACGATGAAGAAAGGG No data
1019781254_1019781262 3 Left 1019781254 7:2941284-2941306 CCTGCACCCCAGTGATTAACCTG 0: 1
1: 0
2: 2
3: 18
4: 295
Right 1019781262 7:2941310-2941332 CGATGAAGAAAGGGGCGTGCAGG No data
1019781254_1019781258 -7 Left 1019781254 7:2941284-2941306 CCTGCACCCCAGTGATTAACCTG 0: 1
1: 0
2: 2
3: 18
4: 295
Right 1019781258 7:2941300-2941322 TAACCTGAGACGATGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019781254 Original CRISPR CAGGTTAATCACTGGGGTGC AGG (reversed) Intronic
900520922 1:3105157-3105179 CAGGCTCCTCACTGGGGAGCAGG + Intronic
901822553 1:11839487-11839509 CAGGTGAATCACTTGAGTTCAGG - Intronic
901852573 1:12025285-12025307 CAGGAGAATCACTTGAGTGCAGG - Intronic
901956405 1:12788737-12788759 CAGGATTCTCACTGGGGTCCTGG + Intergenic
901979784 1:13024792-13024814 CAGGATTCTCACTGGGGTCCTGG + Intronic
902002299 1:13204146-13204168 CAGGATTCTCACTGGGGTCCTGG - Intergenic
902021529 1:13349910-13349932 CAGGATTCTCACTGGGGTGCTGG - Intergenic
902900649 1:19513436-19513458 CAGGTGGATCACTGGAGTTCAGG - Intergenic
904124775 1:28230488-28230510 CAGGAGGATCACTTGGGTGCAGG + Intronic
905371225 1:37483593-37483615 CAGCTTACTCACTGGGGTGCTGG - Exonic
906576213 1:46892692-46892714 CAGGTACCTCACTGGGGGGCTGG - Intergenic
906595708 1:47074894-47074916 CAGGTACCTCACTGGGGGGCTGG + Intronic
906839221 1:49118527-49118549 CAGCTTCATCCCTGGGATGCAGG - Intronic
908351817 1:63293372-63293394 CAGGCAAATCACTTGGGTCCAGG + Intergenic
910356543 1:86363080-86363102 CAGGATAATGACAGTGGTGCTGG + Intronic
912872664 1:113324046-113324068 CAGGTGAATCACTGGAATCCGGG - Intergenic
917370649 1:174290018-174290040 CAGGTTATACTCTGGGCTGCTGG + Intronic
922478618 1:225923722-225923744 CAGGTTCATTTCTGGGGAGCTGG + Exonic
922569097 1:226622695-226622717 CAGGTTACCAACTGGAGTGCAGG - Intergenic
922569100 1:226622714-226622736 CAGGTTACCAACTGGAGTGCAGG - Intergenic
922569103 1:226622733-226622755 CAGGTTACCAACTGGAGTGCAGG - Intergenic
922569106 1:226622752-226622774 CAGGTTACCAACTGGAGTGCAGG - Intergenic
922569109 1:226622771-226622793 CAGGTTACCAACTGGAGTGCAGG - Intergenic
922569112 1:226622790-226622812 CAGGTTACCAACTGGAGTGCAGG - Intergenic
924277713 1:242405106-242405128 CAGGTGAATCACTGGAGGTCAGG - Intronic
1063126534 10:3141332-3141354 CAAGTTAAGCAGTGTGGTGCTGG - Intronic
1063419548 10:5900759-5900781 CAGCTAAATCACTGGGGTCTTGG + Intronic
1064143164 10:12807089-12807111 CAGGTGTATCATGGGGGTGCTGG - Intronic
1064679759 10:17798309-17798331 CAGGTAGATCACTGGAGTCCAGG + Exonic
1065325297 10:24545519-24545541 CTGGATAATTACTGGGGTGGGGG - Intronic
1066014916 10:31231658-31231680 CAGATTCATCCATGGGGTGCAGG + Intergenic
1066383830 10:34924722-34924744 CAGGTGAATCACTTGAGTGCAGG + Intergenic
1068306966 10:55224022-55224044 CAGGTGAATCACTTGAGTTCAGG + Intronic
1068788798 10:61005213-61005235 CAGCTTCATCCCTGGGATGCAGG - Intergenic
1068994139 10:63183086-63183108 CAGGTGAATCACTGGAGGTCAGG - Intronic
1069555644 10:69396042-69396064 CAGGTGAATCACTTGAGTTCAGG + Intronic
1069677255 10:70257166-70257188 CAGGATAATCACTTGAGTCCAGG + Intronic
1069945660 10:71983676-71983698 CAGGTGAATCACTTGAGTTCAGG - Intronic
1072950976 10:99846508-99846530 CAGGTGAATCACTGGAGCCCAGG + Intronic
1073261014 10:102190413-102190435 CAGGAGAATCACTTGGGTCCAGG - Intergenic
1076188542 10:128467089-128467111 CAGGCTTATCCCTGGAGTGCAGG - Intergenic
1076343949 10:129767812-129767834 CAGGATCGACACTGGGGTGCTGG - Exonic
1076357487 10:129863860-129863882 CCTGTTAATGACTGGGGTGTGGG + Intronic
1076357915 10:129866346-129866368 CAGGAGAATCACTTGAGTGCAGG - Intronic
1076621736 10:131793315-131793337 CAGGTGAATCACTTGGGCCCGGG - Intergenic
1078487883 11:11740633-11740655 CAGGCTAATACCTGGGGTTCAGG + Intergenic
1078716846 11:13847851-13847873 CAGGTCAAGCGCTGGGGTTCAGG + Intergenic
1078880506 11:15444244-15444266 CAGTTAAATCACAGGGGTTCTGG - Intergenic
1079383732 11:19960704-19960726 CAGGATAATCACTTGAATGCGGG - Intronic
1080827457 11:35860210-35860232 CAGGGTACTCTCTGGGGAGCAGG - Intergenic
1081933863 11:46891204-46891226 CAGGAGAATCACTTGGGTCCAGG - Intronic
1083034682 11:59625786-59625808 CAGGTGGATCACTGGAGTCCAGG - Intergenic
1083603331 11:63962116-63962138 CAGGCCTAACACTGGGGTGCTGG - Intergenic
1087588727 11:100156331-100156353 CAGCTTCATCCCTGGGATGCAGG - Intronic
1087879408 11:103397665-103397687 CAGGTTGATCACTTGAGTCCTGG + Intronic
1087885727 11:103480089-103480111 CAGGTGGATCACTTGAGTGCAGG - Intergenic
1090246982 11:125223455-125223477 CAGGTGAATCACTTGAGTCCAGG - Intronic
1091234903 11:134014908-134014930 CAGGTGAATCACTTGAGTTCAGG + Intergenic
1091556029 12:1574279-1574301 CAGGAGAATCACTGGGGCGCTGG - Intronic
1093248884 12:16774903-16774925 CAGGTTAATCACTTGAGGCCAGG - Intergenic
1093664105 12:21791885-21791907 CAGCTTCATCCCTGGGATGCAGG - Intergenic
1094647580 12:32341246-32341268 CAGGTGAATCACTTGGGCTCAGG + Intronic
1097209906 12:57359286-57359308 CAGGTGGATCACTTGGGTTCAGG - Intronic
1097901589 12:64878776-64878798 CAGTCTAATCGCTGGGTTGCAGG + Intronic
1097950127 12:65418688-65418710 CAGGGTACTCTCTGGGGAGCTGG - Intronic
1098336276 12:69408067-69408089 TATGTTAACCACTGGGGTGGTGG + Intergenic
1099972200 12:89511824-89511846 CAGGTGAATCACTCGAGTCCAGG + Intronic
1100643527 12:96505593-96505615 CAGGTGAATCACTTGGGCCCAGG - Intronic
1101841718 12:108332316-108332338 CAGGTGAATCACTTGAGTCCAGG + Intronic
1101862618 12:108495306-108495328 CAGGTCAAAGACTGGGGAGCTGG + Intergenic
1102107912 12:110341643-110341665 CAGGTGAATCACTTGGGGTCAGG + Intronic
1102287001 12:111665761-111665783 CAGGTCCATCACTGGGAGGCTGG + Exonic
1102672476 12:114631853-114631875 CAGGTAAATCACTTGGGCTCAGG + Intergenic
1104420034 12:128627618-128627640 CAAGATAATGCCTGGGGTGCCGG - Intronic
1104529675 12:129557485-129557507 CAGGAAAATCACTGGAGTCCAGG + Intronic
1105375075 13:19836534-19836556 CAGGACAATCACTGGAGTCCAGG - Intronic
1105421031 13:20252551-20252573 CAGGTGAATCACTTGGGGTCAGG - Intergenic
1105550170 13:21386774-21386796 CAGGTGAATCACTTGGGGCCAGG - Intronic
1105644745 13:22304590-22304612 CAGGTGAATCACTTGAGTCCAGG + Intergenic
1106252059 13:27989521-27989543 CAGGTGGATCACTGGAGTCCAGG - Intergenic
1106398815 13:29407704-29407726 CAGGTGAATCACTTGGGGTCAGG - Intronic
1106875586 13:34068675-34068697 CAGGTAAATCACTTGAGTTCAGG + Intergenic
1107077606 13:36339973-36339995 CAGGAGAATCACTTGAGTGCAGG + Intronic
1108255245 13:48603437-48603459 CATGCTAACCACTGGGCTGCAGG - Intergenic
1108906900 13:55487083-55487105 CAGGTTAATCACTTGAGGGCAGG - Intergenic
1109348009 13:61140722-61140744 CAGGTTGATCACTGGAGGTCAGG - Intergenic
1110441696 13:75533337-75533359 CAGGTGGATCACTTGAGTGCAGG + Intronic
1111937355 13:94570816-94570838 CAGGAGGATCACTTGGGTGCAGG + Intergenic
1113344831 13:109467099-109467121 CAGGTGAATCACTGGGGGATTGG - Intergenic
1115695275 14:35891037-35891059 CAGGTGGATCACTTGGGAGCAGG - Intronic
1116327009 14:43542546-43542568 CAGGTGAATCACTGGAGATCAGG + Intergenic
1117294517 14:54366777-54366799 GAGGTTAATCATTGTGGTGGTGG - Intergenic
1117451033 14:55850183-55850205 CAGGATAATCACTTGAGTCCAGG - Intergenic
1117864354 14:60130108-60130130 CAGGTGAATCACTTGAGTCCAGG + Intronic
1118564092 14:67119900-67119922 CAGGTGAATCACTTGGGGTCAGG + Intronic
1121688335 14:95856324-95856346 CAGCTAAACAACTGGGGTGCAGG + Intergenic
1121748995 14:96330534-96330556 CAGGTGGATCACTGGAGGGCAGG + Intronic
1122271030 14:100568537-100568559 CGGGTTAATCCCTGGGGCCCGGG - Intronic
1122795318 14:104203144-104203166 CAGGCTCATCCATGGGGTGCGGG + Intergenic
1124038246 15:26076681-26076703 CAGGTAAATCACTTGAGTCCAGG + Intergenic
1126199595 15:45971026-45971048 CAGGTGAATCACTTGAGTCCAGG - Intergenic
1126901390 15:53318237-53318259 CAGGCTAAAGGCTGGGGTGCAGG + Intergenic
1127552442 15:60054073-60054095 CAGGTTAAGACCTGGGCTGCAGG + Intronic
1127600434 15:60530382-60530404 CAGGTTTATCACTTGAGTCCAGG - Intronic
1128006267 15:64244653-64244675 CAGGTGGATCACTGGAGTCCAGG + Intronic
1128096416 15:64959868-64959890 CAGGTTAAGAACTGAGGTGAAGG + Intergenic
1129762213 15:78136341-78136363 CAGGTTAAACAAGGGGTTGCAGG - Intronic
1129794434 15:78365406-78365428 GAGGTTGATCAATGGGGTTCTGG - Intergenic
1130288804 15:82578534-82578556 CAGGTGGATCACTGGAGTTCAGG + Intronic
1130305117 15:82708328-82708350 CTTTTTAATCACTTGGGTGCAGG - Intronic
1130342261 15:83009706-83009728 CAGGCTATTCTCTGGAGTGCTGG - Intronic
1130996444 15:88907092-88907114 AGGGTTCATCACTGGGGTTCAGG - Intronic
1131369247 15:91866064-91866086 CATGTTACTCTCTGGGGTGGTGG + Intronic
1132993867 16:2812518-2812540 CTGGTTGAGGACTGGGGTGCAGG + Intergenic
1133311572 16:4850417-4850439 CAAGTTAACCAATGGGATGCAGG - Intronic
1135645302 16:24156500-24156522 CAGGTGAATCACTTGAGTCCAGG - Intronic
1135689641 16:24525931-24525953 CAGTTTAAACACTGGGGGCCAGG - Intergenic
1135998187 16:27268967-27268989 CAGGGAAGTCACTGAGGTGCAGG - Intronic
1137014869 16:35364560-35364582 AAGTTTAATCACCTGGGTGCTGG - Intergenic
1137341706 16:47613769-47613791 CGGGTTAAGAACTGGGGTGAAGG - Intronic
1137674903 16:50299406-50299428 CAGGATCTTCACTGGGGAGCAGG - Intronic
1137811906 16:51360355-51360377 CAGGTGAATCACTTGAGTCCAGG + Intergenic
1140292812 16:73678709-73678731 CTGTGTAATCACTGTGGTGCTGG - Intergenic
1140448123 16:75048176-75048198 CAGGTGAATCACTTGAGTCCAGG - Intronic
1141139710 16:81489440-81489462 CAGGTACATCACTTGGGTGCAGG + Intronic
1141439958 16:84023799-84023821 CAGGTGAATCACTGGAATTCGGG + Intronic
1146086199 17:29832357-29832379 CAGGAGGATCACTTGGGTGCAGG - Intronic
1149240476 17:54643009-54643031 CAGCTTCATCCCTGGGATGCAGG + Intergenic
1150288816 17:63969868-63969890 CAGGTGAATCACTTGGGGTCAGG - Intronic
1154211414 18:12382162-12382184 CAGGTGGATCACTTGGGTCCAGG + Intergenic
1155689278 18:28598136-28598158 ATGGTAAATCACTGGAGTGCAGG + Intergenic
1156093818 18:33505101-33505123 CAGGTCAAGCAGTGGGGGGCGGG - Intergenic
1157903467 18:51543341-51543363 CAGGAGAATCACTTGGGTCCAGG - Intergenic
1158349793 18:56553244-56553266 CAGGTCAGTCACGGGGCTGCAGG + Intergenic
1158984583 18:62801139-62801161 CAGGAGAATCACTGGGGCCCAGG - Intronic
1158990233 18:62861200-62861222 CAGGTGAATCACTTGGGCCCAGG - Intronic
1159487645 18:69085511-69085533 CAGGAGAATCACTTGAGTGCAGG + Intergenic
1159912549 18:74160089-74160111 CAGGTCAATCACTGGAGGTCAGG + Exonic
1161604158 19:5205444-5205466 CAGTTTCATCCCTGGGGTGGAGG - Intronic
1161747662 19:6070798-6070820 CAGGACAATCACTGGGCTGAGGG - Intronic
1162527092 19:11212467-11212489 CAGGTGAATCACTTGAGTTCAGG - Intronic
1165250170 19:34525805-34525827 CAGGTGAATCACTGGAGGTCAGG - Intergenic
1165350376 19:35271948-35271970 CAGGTTACTTTGTGGGGTGCTGG + Intronic
1166936243 19:46334951-46334973 CAGGTTCAGGAGTGGGGTGCTGG - Exonic
1166943138 19:46380075-46380097 CAGGTGAATCACTTGGGGTCAGG + Intronic
1167022547 19:46888914-46888936 CAGGAGAATCACTGGGGTGGAGG + Intergenic
1168165037 19:54541331-54541353 CAGGCTGATCACTGGAGTTCAGG - Intronic
1168208660 19:54872202-54872224 CAGGTGAATCACTTGAGTTCAGG - Intergenic
926148526 2:10411655-10411677 CAGGCTGAGCACTGGGATGCCGG - Intronic
926625060 2:15084288-15084310 CAGGTTGATCACTTGGGTCCAGG - Intergenic
927172414 2:20381124-20381146 CAGCTTAGTCCCTGGGCTGCTGG - Intergenic
927418613 2:22905889-22905911 CAGGAGAATCACTGGAGTCCAGG + Intergenic
928199655 2:29239506-29239528 GAGGTGAACCACTGGGGTGCTGG + Intronic
929275279 2:40018577-40018599 CAGGTGAATCACTTGAGTCCAGG - Intergenic
934496587 2:94806800-94806822 CAGGTGAATCACTTGAGTCCAGG - Intergenic
935586995 2:104809659-104809681 CAGGTTTATCAATGTGGTGCAGG - Intergenic
936533692 2:113294405-113294427 AAGGTCACTCACTGGGCTGCTGG + Intergenic
937251337 2:120525806-120525828 CAGGTTAACAAGTGGGGTGGGGG + Intergenic
937823122 2:126334531-126334553 CACCTTAATCTCTGGGGAGCTGG - Intergenic
938927218 2:136055069-136055091 CACAAAAATCACTGGGGTGCTGG - Intergenic
939564992 2:143776259-143776281 GAGTTTATTCTCTGGGGTGCGGG - Intergenic
941146304 2:161850296-161850318 CAGGAGAATCACTTGAGTGCAGG + Intronic
942536116 2:176966355-176966377 CAGGTGGATCACTTGAGTGCAGG - Intergenic
943062070 2:183049574-183049596 CATTTTAATCACCTGGGTGCAGG - Intergenic
943066265 2:183089864-183089886 CAGGAGAATCACTTGAGTGCAGG - Intronic
944669930 2:201986127-201986149 CACTTTAATCACTGGGGTCCCGG - Intergenic
945310513 2:208307004-208307026 CAGGTGAATCACTTGGGGCCAGG - Intronic
946426295 2:219599314-219599336 CAGGTTAATCACTTGAGGTCAGG - Intronic
947375481 2:229490877-229490899 CAGCTTGACCACTGTGGTGCTGG - Intronic
947408862 2:229812576-229812598 CAGGTGGATCACTTGAGTGCAGG + Intronic
947847727 2:233259058-233259080 CAAGTTAATCACTGAGATGATGG + Intronic
948458226 2:238117092-238117114 CAGGTTCAGCAGTGGGGTCCTGG - Intronic
948883802 2:240873224-240873246 CAGTGGAAACACTGGGGTGCTGG - Intronic
948929008 2:241118925-241118947 CAGCTTACTCACTGGGGTGCTGG - Intronic
1169369108 20:5015097-5015119 CAGGTTAATCACTTGAGTCCTGG - Intergenic
1172001893 20:31785263-31785285 GAGATTAATCACTTGGGTGGGGG - Intronic
1172211727 20:33204076-33204098 CAGGTAGATCAGTTGGGTGCAGG - Intergenic
1172491429 20:35341575-35341597 CAGGTGAATTCCTGTGGTGCAGG - Intronic
1173634147 20:44540186-44540208 CAGGTTGATCACTGGAGGTCAGG - Intronic
1173780019 20:45748055-45748077 GAGGTTAATCAGTAGGGTTCTGG + Intronic
1174041365 20:47702285-47702307 CAGGTGAATCACTTGAGTCCAGG - Intronic
1174225931 20:48999996-49000018 TAGAATAATCAATGGGGTGCTGG + Intronic
1177804074 21:25856637-25856659 CTGTTTATTCACTTGGGTGCAGG - Intergenic
1178126183 21:29517964-29517986 CAGGTAAATTACTAGGGTCCAGG - Intronic
1182603577 22:31486549-31486571 CAGGTGAATCACTTGAGTTCAGG + Intronic
1184732033 22:46375988-46376010 CACGTTCACCACTGTGGTGCAGG - Intronic
1185392988 22:50572710-50572732 CAGGTGGATCACTTGAGTGCAGG - Intronic
949988176 3:9555605-9555627 CAGGCTAAGCACTGGGGAGAAGG + Intergenic
950253210 3:11484164-11484186 CAGGTGAATCACTGGAGGCCAGG + Intronic
950399848 3:12761375-12761397 CAGGTGAATCACTTGAGTCCAGG + Intronic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
952503378 3:33985512-33985534 CAGCTTCATCCCTGGGATGCAGG - Intergenic
953947210 3:47160115-47160137 CATGTTAATAACTGGGGTGAAGG - Intronic
954458801 3:50614334-50614356 AAGTTCAATCCCTGGGGTGCAGG - Intronic
955045205 3:55353086-55353108 CATCAGAATCACTGGGGTGCGGG + Intergenic
955902752 3:63774621-63774643 CAGGAGAATCACTTGAGTGCAGG + Intergenic
957394163 3:79618648-79618670 CTTTTTAATCACTTGGGTGCAGG - Intronic
958554299 3:95654722-95654744 CAGGTTCATCACTGGGTTAATGG + Intergenic
959044427 3:101456852-101456874 CAGGTGGATCACTTGAGTGCAGG - Intronic
959244530 3:103847670-103847692 CAGGTTGATCACTTGGGCTCAGG - Intergenic
959453054 3:106526554-106526576 CAGCTTCATCCCTGGGATGCAGG + Intergenic
960312358 3:116132053-116132075 CAGGTGAATCACTTGAGTTCAGG - Intronic
961927461 3:130496213-130496235 CAGGAGAATCACTTGAGTGCAGG + Intergenic
965435674 3:168648032-168648054 CAGGTGAATCACTTGAGTCCAGG + Intergenic
965756141 3:172029482-172029504 CAGGTGAATCACTGGAGTTCAGG - Intergenic
966005259 3:175003288-175003310 CAGGATAATCACTGGAGGCCAGG + Intronic
966068391 3:175844185-175844207 CAGGTAAATCACTTGAGTCCAGG + Intergenic
966189366 3:177258303-177258325 CAGGTGAATCACTGGAGGTCAGG - Intergenic
968019496 3:195371884-195371906 CAGGTGAATCACTTGGGGCCAGG - Intronic
968155383 3:196376816-196376838 CTGGTTAATCACTGGAGCTCAGG + Intronic
968449862 4:670072-670094 CAGGTTGAAGACTTGGGTGCTGG - Exonic
968464356 4:743022-743044 CAGGTTCATCTCTGAGCTGCGGG + Intronic
968761043 4:2442909-2442931 CAGGGAGCTCACTGGGGTGCTGG + Intronic
968761072 4:2442975-2442997 CAGGGAGCTCACTGGGGTGCTGG + Intronic
974043744 4:56879788-56879810 CAGGAGAATCACTGGAATGCAGG + Intergenic
974413636 4:61575666-61575688 GAAGTTAATCACTGCGGTGAAGG + Intronic
977976223 4:103269863-103269885 CAGGTGAATCACTTGAGTTCAGG - Intergenic
978845497 4:113268577-113268599 CAGCTTCATCCCTGGGATGCAGG - Intronic
982238836 4:153278339-153278361 CAGGTGAATCACTTGGGACCAGG - Intronic
983211975 4:164967922-164967944 CAGGTGAATCACTGGAGGTCAGG + Intronic
986962721 5:13234962-13234984 GAAGTCACTCACTGGGGTGCAGG + Intergenic
987115036 5:14719430-14719452 CAGGGAAATCTCTGGGGTGGAGG + Intronic
987288390 5:16483772-16483794 CAGGTTAATCATAGGGTTCCAGG + Intronic
988684131 5:33511699-33511721 CAGGTGGATCACTTGGGTCCAGG - Intergenic
989749952 5:44881432-44881454 CAGGTTAATGAGTGGTGAGCTGG - Intergenic
991562166 5:67965434-67965456 CAGGTGAATCACTTGAGGGCAGG - Intergenic
992598925 5:78376795-78376817 CAGATTGATCTCTGGGGTGGAGG + Intronic
994456867 5:100020827-100020849 CAGGTTGATCACTTGAGTCCAGG - Intergenic
998390391 5:141783625-141783647 CCAGTTAATAACTGGGATGCAGG + Intergenic
1001081073 5:168667905-168667927 CATGCTAATGACTGGGGTGAAGG + Intronic
1001308922 5:170596718-170596740 CTGCTTAATCAGTGGGGTTCTGG + Intronic
1001366304 5:171144133-171144155 CAGGTGAATCACTTGAGCGCAGG + Intronic
1003166505 6:3683589-3683611 CAGGTGAATCTCTAGGCTGCAGG + Intergenic
1003891781 6:10570160-10570182 CAGGTGAATCACTTGAGTCCAGG - Intronic
1004038859 6:11954155-11954177 CAGCTTAATCACTGCGGGCCTGG + Intergenic
1005096766 6:22124820-22124842 CAGGTGAATCACTTGAGTCCAGG - Intergenic
1005144245 6:22669371-22669393 CAGGGTAATCACTGGTTTGGTGG - Intergenic
1005406210 6:25490468-25490490 CAGGTGGATCTCTGGGGTCCAGG + Intronic
1005912190 6:30320451-30320473 CAGGTTAATCACTTGAGGTCAGG - Intergenic
1006061099 6:31420022-31420044 CATGTGAATCCCTGGGGAGCAGG + Intergenic
1006372439 6:33653697-33653719 CAGGATAATCTCTGTGGTGCAGG + Intronic
1006927486 6:37665202-37665224 GAGTTTAAGCACTGGGGGGCTGG - Intronic
1006962312 6:37945600-37945622 CAGGTGGATCACTGGAGTTCAGG - Intronic
1008615287 6:53220338-53220360 CAGGTGAAGCACTTGAGTGCAGG - Intergenic
1011117666 6:83911814-83911836 CAGGTGAATCACTTGAGTTCAGG + Intronic
1012800471 6:103820557-103820579 CAGGTCAAGCAATGTGGTGCAGG - Intergenic
1013331681 6:109108437-109108459 CAGGTGGATCACTGGAGTTCAGG - Intronic
1014427911 6:121331445-121331467 CAGGTGAATCACTTGAGTTCAGG - Intronic
1015069659 6:129075991-129076013 CAGGAGAATCACTTGGGTCCAGG + Intronic
1016593910 6:145777134-145777156 CAGCTTCATCCCTGGGATGCAGG - Intergenic
1018344293 6:162884787-162884809 TAGGTTTATCATTGGGGAGCTGG - Intronic
1019436582 7:1025362-1025384 CAGGAAACTCACTGGGGTGTGGG + Intronic
1019735106 7:2646671-2646693 CAGGTGCATCACTGAGGTGGTGG + Intronic
1019781254 7:2941284-2941306 CAGGTTAATCACTGGGGTGCAGG - Intronic
1021034452 7:15780402-15780424 CAGGAGGATCACTGGAGTGCAGG - Intergenic
1021919640 7:25471881-25471903 CAGGAAAGTCACTGGGGAGCAGG + Intergenic
1022687513 7:32610417-32610439 CAGGTGAATCACTGGAGCCCAGG + Intergenic
1025626228 7:63224861-63224883 CAGGTGAATCACTTGGGGTCAGG - Intergenic
1025908420 7:65808103-65808125 CAGGTGGATCACTTGGGTCCAGG - Intergenic
1026712515 7:72755188-72755210 CAGGTGGATCACTTGAGTGCAGG + Intronic
1027055514 7:75046832-75046854 CAGGTGAAAGACGGGGGTGCGGG + Intronic
1027205556 7:76095005-76095027 CAGGTGGATCACTTGGGTCCAGG + Intergenic
1027548350 7:79558845-79558867 CAGGTGAATCACTTGAGTTCAGG - Intergenic
1027642722 7:80757173-80757195 CAAGTAAAGCACTGGGGTGATGG - Intronic
1027957931 7:84905639-84905661 CAGGTGAATCACTGGAGGTCAGG - Intergenic
1030194397 7:106838442-106838464 CTGTTTATTCACTTGGGTGCAGG - Intergenic
1030259440 7:107547186-107547208 GAGATTTATCTCTGGGGTGCAGG + Intronic
1030495718 7:110297204-110297226 CAGCTAAATGACTGGGGTCCAGG - Intergenic
1031758236 7:125674227-125674249 AAGGTAAATCACTGGGGTGTAGG + Intergenic
1031820280 7:126492276-126492298 CAGGTGAATCACTTGAGTCCAGG - Intronic
1032649478 7:133861759-133861781 CAGGTGAATCACTTGAGTTCAGG - Intronic
1033406958 7:141079057-141079079 CAGGTGAATCACTTGAGTTCAGG + Intronic
1036524420 8:9521493-9521515 CAGGTTAATAACTGGAGGCCAGG + Intergenic
1037089504 8:14896702-14896724 CAGGTTTATCACTGGAGGTCAGG - Intronic
1038847939 8:31247023-31247045 CAGGTGAATCACTTGAGTTCAGG - Intergenic
1039355587 8:36811837-36811859 CAGGTGCATCACTGGAGGGCAGG + Intronic
1039588447 8:38727099-38727121 CAGGCCTATCCCTGGGGTGCGGG + Intergenic
1039750253 8:40472313-40472335 CAGGTTCATCTATGTGGTGCAGG - Intergenic
1041247067 8:55898514-55898536 CAGGTGAATCACTTGAGTCCAGG - Intronic
1041932595 8:63303564-63303586 CAGGTAAATCACTTGGGCCCAGG - Intergenic
1042072703 8:64954009-64954031 CAGGAGAATCACTGGAATGCAGG + Intergenic
1042900832 8:73725702-73725724 CAGGTGAATCACTTGAGTCCAGG + Intronic
1044970116 8:97611229-97611251 CAGGTGAATCACTTGAGTTCAGG + Intergenic
1045311631 8:101008206-101008228 CAGGTCAGTCACTGGGCTGGGGG - Intergenic
1048493892 8:134919766-134919788 CAGGTAAATCACTGGGATTCAGG - Intergenic
1048581337 8:135731883-135731905 CAGGTTTCTCACTGGGTTCCCGG - Intergenic
1049649786 8:143760446-143760468 CAGGTGGATCACTGGAGTGCAGG + Intergenic
1050000098 9:1068483-1068505 CAGCTTCATCCCTGGGATGCCGG - Intergenic
1051340227 9:16103793-16103815 CCCGTAAATCACTGGGGGGCAGG - Intergenic
1053077980 9:35151279-35151301 CTGTTTAATCACCTGGGTGCAGG + Intergenic
1053660563 9:40273641-40273663 CAGGTGAATCACTTGAGTCCAGG + Intronic
1053910938 9:42902985-42903007 CAGGTGAATCACTTGAGTCCAGG + Intergenic
1054372683 9:64419859-64419881 CAGGTGAATCACTTGAGTCCAGG + Intergenic
1054524048 9:66102643-66102665 CAGGTGAATCACTTGAGTCCAGG - Intergenic
1054680310 9:67909634-67909656 CAGGTGAATCACTTGAGTCCAGG + Intergenic
1054901057 9:70370091-70370113 CAGGAGAATCACTTGAGTGCAGG + Intergenic
1056537248 9:87540280-87540302 CAGGAGAATCACTTGGGCGCGGG - Intronic
1059617188 9:115963701-115963723 CAGGTGGATCACTGGAGTTCAGG - Intergenic
1062403161 9:136381331-136381353 CAGGGTAAACACAGGGGTGCTGG + Exonic
1062477777 9:136737512-136737534 CAGGTGAATCACTTGAGTTCAGG - Intergenic
1062693129 9:137855587-137855609 CAGGTGAATCACTTGGGCCCAGG - Intronic
1185867126 X:3634020-3634042 CAGGTTAATCACTCGAGGTCAGG + Intronic
1186017778 X:5217753-5217775 CAGGAGAATCACTAGGGTTCAGG + Intergenic
1189513772 X:41690586-41690608 CAGGCAAATCACTGGAGTCCAGG - Intronic
1195355838 X:104039481-104039503 CAGGAGAATCACTGGAGTCCAGG + Intergenic
1195802196 X:108725403-108725425 CCAGTTGATCACAGGGGTGCAGG - Intronic
1196624679 X:117864756-117864778 CAGGTTAGGCTCTGGGGTACAGG + Intergenic
1197123940 X:122922718-122922740 CAGCTTTATCCCTGGGATGCAGG - Intergenic
1197907283 X:131439202-131439224 CAGGTTAATCACTGTTTTCCCGG - Intergenic
1198978622 X:142367196-142367218 CAGGTTGATCACTTGAGTCCAGG + Intergenic
1199241647 X:145554316-145554338 CTGGTTAGCCACTGTGGTGCAGG - Intergenic
1199733266 X:150658704-150658726 CATGAGAATCACTGGGGAGCTGG - Intronic
1200416960 Y:2922340-2922362 CAGGAGAATCACTGGAGTGGAGG - Intronic
1201307743 Y:12565025-12565047 CTGTTTAATCACCTGGGTGCAGG + Intergenic
1201362182 Y:13164549-13164571 CTTTTTAATCACTTGGGTGCAGG + Intergenic
1201581866 Y:15518125-15518147 CTTTTTAATCACTTGGGTGCAGG - Intergenic