ID: 1019782146

View in Genome Browser
Species Human (GRCh38)
Location 7:2947541-2947563
Sequence ACCTCTTTGCGGGAGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019782146_1019782155 6 Left 1019782146 7:2947541-2947563 CCCTCCCTCTCCCGCAAAGAGGT 0: 1
1: 0
2: 0
3: 12
4: 183
Right 1019782155 7:2947570-2947592 GTTACCTGCTCGGTTGATCTTGG 0: 1
1: 0
2: 0
3: 6
4: 42
1019782146_1019782153 -4 Left 1019782146 7:2947541-2947563 CCCTCCCTCTCCCGCAAAGAGGT 0: 1
1: 0
2: 0
3: 12
4: 183
Right 1019782153 7:2947560-2947582 AGGTCCTAAGGTTACCTGCTCGG 0: 1
1: 0
2: 0
3: 7
4: 71
1019782146_1019782158 19 Left 1019782146 7:2947541-2947563 CCCTCCCTCTCCCGCAAAGAGGT 0: 1
1: 0
2: 0
3: 12
4: 183
Right 1019782158 7:2947583-2947605 TTGATCTTGGATGGCAGCATAGG 0: 1
1: 0
2: 1
3: 13
4: 135
1019782146_1019782159 20 Left 1019782146 7:2947541-2947563 CCCTCCCTCTCCCGCAAAGAGGT 0: 1
1: 0
2: 0
3: 12
4: 183
Right 1019782159 7:2947584-2947606 TGATCTTGGATGGCAGCATAGGG 0: 1
1: 0
2: 0
3: 10
4: 111
1019782146_1019782157 10 Left 1019782146 7:2947541-2947563 CCCTCCCTCTCCCGCAAAGAGGT 0: 1
1: 0
2: 0
3: 12
4: 183
Right 1019782157 7:2947574-2947596 CCTGCTCGGTTGATCTTGGATGG 0: 1
1: 0
2: 0
3: 1
4: 53
1019782146_1019782160 21 Left 1019782146 7:2947541-2947563 CCCTCCCTCTCCCGCAAAGAGGT 0: 1
1: 0
2: 0
3: 12
4: 183
Right 1019782160 7:2947585-2947607 GATCTTGGATGGCAGCATAGGGG 0: 1
1: 0
2: 1
3: 8
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019782146 Original CRISPR ACCTCTTTGCGGGAGAGGGA GGG (reversed) Intronic
900466325 1:2827170-2827192 ACCTCTGTGTGGGAGGGTGAAGG + Intergenic
900507153 1:3035389-3035411 ACCTCTTTGGAAGGGAGGGAAGG - Intergenic
901633846 1:10660562-10660584 ACCTCTGGGAGGGAGTGGGAGGG + Intronic
902520219 1:17011644-17011666 ACCCCTTGGAGGGAGAGGGGAGG - Intronic
904562891 1:31410680-31410702 ACCTATTTCCGGGAAGGGGATGG + Intronic
904656725 1:32054315-32054337 ACTCCTTTGTGGGAGAGTGAAGG + Intronic
907297185 1:53462786-53462808 ACCTCTGTGGGAGGGAGGGAAGG - Intronic
911771200 1:101744597-101744619 TCCACTTTGAGGGACAGGGAAGG - Intergenic
912512643 1:110199287-110199309 GCCTCTTTCCTGGAGAGAGAAGG + Exonic
912756198 1:112326512-112326534 GGCTCTTTGCCGCAGAGGGAAGG - Intergenic
916669656 1:167003083-167003105 ATCTCTTTGGGGGAGAGTAAAGG + Intronic
917691849 1:177477886-177477908 ACCTGTTTTTCGGAGAGGGAGGG + Intergenic
919929250 1:202210470-202210492 ACCTATTTGAGAGAGAGGGAGGG + Intronic
920529335 1:206690497-206690519 ACCCCTTTGTGGGAGGAGGAAGG + Intronic
920679415 1:208060898-208060920 ACCTCCCTGGGGGAGGGGGAAGG - Intronic
922288157 1:224186904-224186926 ACTTTTTGGCGGGGGAGGGAAGG + Intronic
924083231 1:240420961-240420983 ACCTCCATGGAGGAGAGGGAAGG + Intronic
1063382821 10:5596983-5597005 ACCTCTTTGCAGGAGGCGGGTGG - Intergenic
1064248528 10:13689189-13689211 AACTCTTTGCGGGGGGGGGGGGG + Intronic
1064377536 10:14810433-14810455 ACCTCATGGTGGGGGAGGGAGGG + Intergenic
1066486233 10:35847778-35847800 ATCTCTGTGAGGGAGAGAGATGG + Intergenic
1073488004 10:103833945-103833967 CTCTCTTTCCGGGAGGGGGAGGG - Intronic
1074787767 10:116856438-116856460 TCCTCTTTCTGGGAGAGGTAGGG + Intronic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1078559482 11:12357982-12358004 TTCTCTTTGGGGCAGAGGGAAGG + Intronic
1080399338 11:31919820-31919842 AATGCTTTGCTGGAGAGGGATGG - Intronic
1080698010 11:34619953-34619975 TCCCTTTTGTGGGAGAGGGAAGG - Intergenic
1083195415 11:61082967-61082989 ACCTCTCTGCAGGACAGGGTGGG - Intergenic
1084180865 11:67445192-67445214 ATCTCTTTCTGGGAAAGGGAGGG - Intergenic
1087006239 11:93474887-93474909 ACCCTTTTGGGGAAGAGGGAAGG + Intergenic
1088621634 11:111690610-111690632 GCCTCTTTGGGGGTGAGGGGAGG - Intronic
1088723355 11:112613517-112613539 GGCTCTCTGCGGGAGAGGAAAGG + Intergenic
1089682833 11:120129024-120129046 ACCTGTTTATGGGAAAGGGAAGG + Intronic
1091617441 12:2060184-2060206 GCCCCTTTGCGAGAGTGGGATGG + Intronic
1092035772 12:5333197-5333219 TCCTCTTTGTGGGGGAGGCAGGG + Intergenic
1092801511 12:12172866-12172888 ACCTGTTTGAGAGAGAGGTAGGG + Intronic
1094040716 12:26118667-26118689 AGCTCTTTGGAGGGGAGGGAAGG + Intergenic
1097668892 12:62513228-62513250 TTCTTTTTGCGGGGGAGGGATGG + Intronic
1097964067 12:65560412-65560434 ACCCCTTTGCAGTATAGGGAAGG + Intergenic
1098685826 12:73419196-73419218 AACTCTTTGAGAGAGAGGCAAGG - Intergenic
1103048623 12:117760279-117760301 ACCCCTTTGGGGGAGAGAGCAGG - Intronic
1103120780 12:118377517-118377539 ACCTGTTTCCGGGAGGGGGGCGG - Intronic
1103444345 12:120984464-120984486 TTCTCTTTGTGGGAGAGAGAAGG + Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1106242356 13:27921686-27921708 GGCTTTGTGCGGGAGAGGGAGGG + Intronic
1108080743 13:46732465-46732487 CCCTCTTTGGGAGTGAGGGAGGG - Intronic
1108772363 13:53719286-53719308 ACCTCCTTGCAAGAGAAGGAAGG + Intergenic
1108779585 13:53812901-53812923 GCTTCTTTTCAGGAGAGGGAGGG + Intergenic
1114318454 14:21526856-21526878 ACTTCTTTTGTGGAGAGGGATGG - Intronic
1114557450 14:23570160-23570182 ACTTCTTCCCGGGAGAGGGAGGG + Intronic
1115802668 14:37012980-37013002 ACTTCTTTGGGGGAGAGTGGTGG + Intronic
1116937806 14:50760025-50760047 AGCTTTGAGCGGGAGAGGGAAGG - Exonic
1118713988 14:68546320-68546342 ACCTTGGTGAGGGAGAGGGAGGG + Intronic
1122834587 14:104424550-104424572 AGCTCTTGGCAGGGGAGGGACGG + Intergenic
1124159540 15:27255939-27255961 ACATCTTTGGTGGAGAGAGAGGG - Intronic
1125348516 15:38743352-38743374 TCCTCCTTGTGAGAGAGGGAGGG - Intergenic
1129396749 15:75254097-75254119 ACCTTTCTTTGGGAGAGGGATGG - Intergenic
1129473977 15:75771083-75771105 ACCTTTCTTTGGGAGAGGGATGG - Intergenic
1131568398 15:93506786-93506808 ACCTGTTGGCGGGTGAGGAAGGG + Intergenic
1132007393 15:98241203-98241225 ACCTCTCTGCAGGAGAGGCTGGG - Intergenic
1138615170 16:58159500-58159522 GTCTCTTTGGGGGAGAGGGGAGG - Intronic
1139446876 16:67003496-67003518 ATCTCTATGGGGGAGAGGAAGGG - Exonic
1141690550 16:85594075-85594097 ACTTCTTTGCAGAAAAGGGAGGG + Intergenic
1143031333 17:3969008-3969030 AGCACTTTACGGGAGAGAGATGG - Intergenic
1143107010 17:4535016-4535038 ACCCCGTTGCGGGAGAGGTGGGG - Intronic
1143497893 17:7322863-7322885 ACCTCTGGGGAGGAGAGGGAAGG + Exonic
1143765976 17:9138036-9138058 ACCTCATGGTGGGACAGGGAAGG - Intronic
1145104449 17:20103649-20103671 ACATGTATGTGGGAGAGGGAAGG - Intronic
1145357347 17:22171712-22171734 TCCTGTTTTCAGGAGAGGGAGGG - Intergenic
1146506585 17:33410813-33410835 AGCTCTTTGTGGGATGGGGATGG + Intronic
1146728650 17:35175488-35175510 ACCTAAATGCAGGAGAGGGAAGG + Intronic
1147212816 17:38881959-38881981 ACTTGTTTGGGGGAGAGGCAGGG + Intronic
1147393547 17:40123579-40123601 ACCTCTCAGGGGGAGGGGGAGGG + Intronic
1149424717 17:56544047-56544069 ACGTCTTTGCGGTAGGGGGGAGG + Intergenic
1151036321 17:70804679-70804701 TCCTTTTTGGGGGAGTGGGAGGG - Intergenic
1156088857 18:33440941-33440963 CCCTCTTTACCGGAGAGGGAAGG + Intronic
1156164063 18:34396773-34396795 TCCTCTTGGCAGAAGAGGGAGGG + Intergenic
1158260117 18:55597389-55597411 TTTTCTTTGGGGGAGAGGGAAGG - Intronic
1158288176 18:55908359-55908381 TTCTCTTTGGGGGAGAGGGGAGG - Intergenic
1159687288 18:71438333-71438355 CCCTCTCTCAGGGAGAGGGAAGG + Intergenic
1160432809 18:78823572-78823594 CCATCTTTGAGGGGGAGGGACGG - Intergenic
1160897266 19:1408530-1408552 ACCACTTTGGGGGGGTGGGATGG - Intronic
1161836720 19:6652652-6652674 ACCTCTTTGTGCAAAAGGGAAGG + Intergenic
1162146040 19:8612450-8612472 ACCTCTTTGATGGAGAAAGAGGG - Intergenic
1162826628 19:13256335-13256357 TTCTCTTTGAGGGAGAGAGAAGG + Intronic
1163832267 19:19552751-19552773 TCCACTTTGCGGGGGAGGGCCGG + Intergenic
1166601086 19:44094983-44095005 ACCTCTTTTTAGGAGAGCGAGGG + Intronic
1167078084 19:47261038-47261060 AGCTCTAGGCGTGAGAGGGAAGG - Intronic
925006806 2:449658-449680 AGCAGTCTGCGGGAGAGGGAAGG + Intergenic
925150885 2:1613914-1613936 ACCTCCTGCTGGGAGAGGGAGGG + Intergenic
925316505 2:2930625-2930647 ACCCCATGGCGAGAGAGGGAAGG - Intergenic
926217785 2:10915817-10915839 GCCTCTGTTCGGGAGAGGGCTGG - Intergenic
926904606 2:17794275-17794297 CCCTCTTTGAGGGTGGGGGATGG - Intronic
928921438 2:36532365-36532387 TCCTCTTTGAGAGAGTGGGAGGG + Intronic
928951976 2:36821329-36821351 ACCTGTTTGTGTAAGAGGGATGG - Intergenic
929557889 2:42936844-42936866 TCCTCTTTCCTGGAGAGGGATGG - Intergenic
929878132 2:45814046-45814068 CCCTCTGTGCGGGAGGGGGAGGG - Intronic
931431651 2:62213425-62213447 ACCTCCTTTCTGGAGAGGGATGG - Intronic
933671511 2:85011894-85011916 AACTATTAGCGGGACAGGGAGGG - Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935317332 2:101848652-101848674 CCCTTTTTGCAGGTGAGGGAGGG + Intronic
936971815 2:118183781-118183803 ACTTGTGTGCAGGAGAGGGAGGG + Intergenic
937460556 2:122082022-122082044 GCCTGTCTGCAGGAGAGGGAAGG - Intergenic
938766170 2:134461818-134461840 TCCCCTTTGTGGGAGAGGGCCGG - Intronic
940427282 2:153544817-153544839 ACCTCTTTGCAGAAAAGGAATGG + Intergenic
942302784 2:174578163-174578185 ACTACTTTGGGGGACAGGGAGGG - Intronic
942361792 2:175180927-175180949 AACTCGTTGCTGCAGAGGGAGGG - Intronic
1169347209 20:4838265-4838287 GCATCTTTGGTGGAGAGGGACGG + Intergenic
1169550230 20:6694907-6694929 ACATTTTTGTGGGGGAGGGAGGG - Intergenic
1170361675 20:15553236-15553258 AGCTCTATGATGGAGAGGGATGG - Intronic
1170573003 20:17642894-17642916 TCCTCTCTGTGGCAGAGGGAAGG + Intronic
1171244166 20:23596520-23596542 ACCTCTTTGCTGAACAGGGAGGG - Intergenic
1172830154 20:37827002-37827024 ACCTCTGTGAGGCACAGGGAGGG - Intronic
1174324559 20:49768917-49768939 ACCTCTTTTAGGTACAGGGATGG - Intergenic
1174616147 20:51837008-51837030 AAATCTTTGCGGGGGTGGGATGG + Intergenic
1176116846 20:63435847-63435869 ACCCATGTGCCGGAGAGGGAGGG - Intronic
1178894068 21:36544239-36544261 ACCTTTTTCAGGGAGAGGGATGG - Intronic
1179528911 21:42004391-42004413 AGATTTTTGAGGGAGAGGGAAGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1183781580 22:40002359-40002381 CCCTCTTTGGGGAAGAGGGAGGG + Intronic
1183929576 22:41228280-41228302 ACCTCTTTGAGGGTGGGAGAGGG + Intronic
1184116528 22:42425900-42425922 AACACCTTGGGGGAGAGGGAGGG + Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949723013 3:7012551-7012573 ACCTCTTCAGGGGAGAAGGATGG - Intronic
950665240 3:14491385-14491407 ACAGCTTTGGGGGAGAGGGCAGG + Exonic
953819985 3:46199431-46199453 ACCTCTTTGCTAAAGAGGGAGGG + Intronic
954410134 3:50366916-50366938 ACCACTTTGGGGGAGAGCAAGGG + Exonic
954980408 3:54740575-54740597 AGCTCTTTGTGGAAGGGGGAAGG - Intronic
955031287 3:55222444-55222466 ACCTCTTTGCTGCTGAGTGATGG + Intergenic
956625472 3:71262393-71262415 ACCTCTTTGGGGCAGAGGAGAGG + Intronic
958612516 3:96445851-96445873 ACCTCTTTCGGGGAGAGGGGTGG + Intergenic
960950869 3:122997666-122997688 GCATCTTTGCTGCAGAGGGAGGG - Intronic
962922178 3:139960098-139960120 AGCTTTTAGTGGGAGAGGGAAGG + Intronic
964544681 3:157820875-157820897 ACCTCACTGTGGGAGAGGCAAGG - Intergenic
967476388 3:189925500-189925522 TTCTCTTTGTGGGAGAAGGAGGG - Intergenic
970555179 4:17224727-17224749 ACCTCTTTGAGGGTGGAGGATGG - Intergenic
971505597 4:27363316-27363338 ATCTCTCAGCTGGAGAGGGATGG + Intergenic
973731041 4:53822548-53822570 ACCTTTTTGGAGCAGAGGGAGGG - Intronic
974088902 4:57289885-57289907 ATCTCTATGGGGGAGTGGGAGGG + Intergenic
974710102 4:65580690-65580712 TCCTCTTTGAGGGACAGGGGAGG - Intronic
974732939 4:65893471-65893493 TCCTCTTTGCAGGAGAGAAAAGG + Intergenic
976267155 4:83195217-83195239 AGCCCTTTGAAGGAGAGGGATGG + Intergenic
976903920 4:90212879-90212901 ACCTCTTAGCAGGAGAGGACTGG + Intronic
979377815 4:119967848-119967870 AGCTCTTTTTGGGAGAGGTAGGG - Intergenic
980120237 4:128720537-128720559 ACCTCCTTCAGGGAGGGGGAGGG + Intergenic
980572314 4:134636813-134636835 AACTCTATGGGGCAGAGGGAGGG + Intergenic
980914835 4:139024550-139024572 GCCTCTTTCCTGGAGAGGAAGGG + Intronic
995792896 5:115911772-115911794 ACATCTTTGGGGGAGCAGGAAGG + Intronic
1000575287 5:162968759-162968781 ACATGTTGGCAGGAGAGGGAAGG - Intergenic
1001106675 5:168860514-168860536 ACATCTTGGTGGGGGAGGGAAGG + Intronic
1002253471 5:177943296-177943318 ACCTCATTGGGGGAGTGGGGGGG - Intergenic
1008808024 6:55455324-55455346 ACATCTTGGAGGAAGAGGGAAGG + Intronic
1010649292 6:78432416-78432438 ACCACTTTGAGGTAGAAGGAAGG + Intergenic
1013408609 6:109864720-109864742 AACTCCTTGCAGGAGAGGCAGGG + Intergenic
1014681669 6:124438670-124438692 AGCTGTTTGCTGGAAAGGGAAGG - Intronic
1015472598 6:133622634-133622656 AGCTCTGTGCTGGAGAGGCATGG - Intergenic
1016684689 6:146867904-146867926 ACCTACTTGAGGGTGAGGGATGG - Intergenic
1018859178 6:167698649-167698671 ACCTGGTTGCTGCAGAGGGAGGG - Intergenic
1019197398 6:170290482-170290504 GCTTCTTCGCAGGAGAGGGAGGG + Intergenic
1019782146 7:2947541-2947563 ACCTCTTTGCGGGAGAGGGAGGG - Intronic
1021492195 7:21231440-21231462 ACCTCTTGGTGGGAGAGAAATGG - Intergenic
1022617966 7:31951876-31951898 ATCTCCTTGTGGAAGAGGGAAGG - Intronic
1023152691 7:37216602-37216624 ACCTCTTTGTGGGGGAGGAGTGG - Intronic
1024505615 7:50158943-50158965 ACCCCTGTGCGGGAAGGGGAGGG - Intronic
1030272033 7:107678971-107678993 ACCTTTTTGGGGGAGAGGGCAGG - Intronic
1030462169 7:109853286-109853308 AACTCTTTGAAGTAGAGGGATGG - Intergenic
1030793183 7:113755040-113755062 TCCTTTTGGTGGGAGAGGGATGG + Intergenic
1030870279 7:114747276-114747298 ACCTCTTTGTAGGACAGTGAGGG - Intergenic
1031632228 7:124057639-124057661 ACCTGTTTCAGGGACAGGGAAGG - Intergenic
1032122712 7:129168657-129168679 CCCTGCTTGCTGGAGAGGGAGGG - Exonic
1037985337 8:23287517-23287539 ACATCAATGCGGGAGAAGGAAGG + Intronic
1038227583 8:25670916-25670938 ACCATTTTGCGGGGGAGGGGGGG + Intergenic
1038617938 8:29112650-29112672 CCCTCTTTGAGGGTGAGGGTGGG + Intronic
1040747409 8:50662148-50662170 ACCTCATGGCAGGAGAGGGCTGG - Intronic
1045459129 8:102411897-102411919 CGCTCCTTGCGGGAGGGGGAAGG + Intronic
1045988282 8:108275846-108275868 AACTATTTGCGGGGGAGGGGTGG - Intronic
1048767645 8:137862285-137862307 GCCTCTTGGGGAGAGAGGGAGGG + Intergenic
1049802932 8:144526636-144526658 CCCTCTGTGCGGGAGCGGGGAGG + Exonic
1055062283 9:72082273-72082295 ACTTCTTTGCGGGAGAGCTGTGG + Intergenic
1056218043 9:84423579-84423601 AGCTCTTTGGGGGACTGGGATGG + Intergenic
1060090125 9:120735309-120735331 ACCTCTTCGGGGGAGAGAGTGGG + Intergenic
1060396387 9:123319661-123319683 TCCCCTTTGCGGGTGAGGGTTGG - Intergenic
1061478345 9:130884145-130884167 AGCTCCTTCCGGGAGATGGACGG + Exonic
1061937153 9:133864195-133864217 GGCTGTCTGCGGGAGAGGGAGGG - Intronic
1062266542 9:135689044-135689066 ACCTCCATGCAGGTGAGGGACGG + Intergenic
1062493702 9:136821788-136821810 AGTTCTCCGCGGGAGAGGGAGGG + Intronic
1186583835 X:10850339-10850361 ACATCTTTGGGGAAGGGGGAAGG - Intergenic
1196336170 X:114538381-114538403 AGCTCTTTGCGGGAGAGTTTTGG - Intergenic
1196633626 X:117973835-117973857 AGCTGTCTGCGGGGGAGGGAGGG - Intronic
1196859767 X:120015847-120015869 ACCTATTTGGGGCAGGGGGAGGG + Intergenic
1198487298 X:137100485-137100507 ACTTTTTTGGGGGAGAGGCAGGG + Intergenic
1201763964 Y:17563061-17563083 ACCCCTTTGCCGGACACGGAGGG + Intergenic
1201837589 Y:18342929-18342951 ACCCCTTTGCCGGACACGGAGGG - Intergenic