ID: 1019783488

View in Genome Browser
Species Human (GRCh38)
Location 7:2958771-2958793
Sequence TGGCAGAGTGGACCACACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019783484_1019783488 -10 Left 1019783484 7:2958758-2958780 CCCTCGATGACACTGGCAGAGTG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1019783488 7:2958771-2958793 TGGCAGAGTGGACCACACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1019783481_1019783488 15 Left 1019783481 7:2958733-2958755 CCAGGAAGTCCTGAGGGGCGTGT 0: 1
1: 0
2: 0
3: 6
4: 105
Right 1019783488 7:2958771-2958793 TGGCAGAGTGGACCACACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 152
1019783482_1019783488 6 Left 1019783482 7:2958742-2958764 CCTGAGGGGCGTGTCACCCTCGA 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1019783488 7:2958771-2958793 TGGCAGAGTGGACCACACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019783488 Original CRISPR TGGCAGAGTGGACCACACCA GGG Intronic
900542854 1:3212680-3212702 TGGCAGAGAGGACCGCAGCGAGG - Intronic
900917809 1:5650804-5650826 TGGGAGGGTGGAGAACACCAAGG + Intergenic
901028907 1:6294743-6294765 TGGCAGATGGGCACACACCAAGG + Intronic
903003296 1:20281765-20281787 AGTGAGAGTGGCCCACACCAAGG - Intergenic
903502981 1:23812097-23812119 TGGGAGAGTGGAGCACCCCAGGG + Intronic
903539455 1:24088977-24088999 TGGCAGAGTAGAAGACAGCATGG - Intronic
903648186 1:24907187-24907209 GGGCAGATTGGACCACATCGAGG + Intronic
905300321 1:36982397-36982419 TGGCAGAGTGGCCTTCTCCAAGG - Intronic
920248124 1:204603591-204603613 TGGCTGCGTGGTCCACAGCAAGG - Intergenic
920558933 1:206925218-206925240 TGCCAGGCTGGAGCACACCATGG + Intergenic
920944659 1:210516903-210516925 TGGCTCAGTGGAGCACTCCAAGG - Intronic
922449573 1:225725979-225726001 TGGGACAGTGGCCCAGACCATGG + Intergenic
1063302611 10:4864851-4864873 TGGAAGACTGGCCCACACAAGGG - Intergenic
1067093979 10:43286279-43286301 TGGTGGAGGGGACCACACCAAGG + Intergenic
1067836315 10:49643889-49643911 TGGGGGAGGGGACCAGACCAGGG + Intronic
1073148978 10:101298849-101298871 TGGGAGAGTGGATCTCATCAAGG + Intergenic
1077315200 11:1916596-1916618 GTGCAGAGTGGACAGCACCAGGG + Intergenic
1084462386 11:69303100-69303122 TGGCAGAGGGGACCAAATCTGGG + Intronic
1085694730 11:78694505-78694527 TGGCAGAGTGGGCCAGATCTTGG - Intronic
1085949516 11:81312793-81312815 TGGCAGAGTGCCCTCCACCAAGG - Intergenic
1089211831 11:116809275-116809297 TTGCAGAGAGGACCACAGGATGG + Intergenic
1091780897 12:3213998-3214020 TGGCAGAGTGGAAAAGAGCAGGG + Intronic
1093199675 12:16171790-16171812 TGGCAGAGTGGAGCACAAAATGG + Intergenic
1094861434 12:34470584-34470606 TGGCAGAATGGACAAAAACAGGG + Intergenic
1098163077 12:67666156-67666178 TGGCAGACTGGCCCACAGGATGG + Intergenic
1101410083 12:104460207-104460229 AGGCAGAAGGGACCACAGCATGG + Intronic
1101572232 12:105964334-105964356 TGTTAGAGTGGCCCTCACCAAGG + Intergenic
1101732758 12:107440274-107440296 TGGCTGTGTGGAGGACACCAAGG - Intronic
1121506551 14:94482095-94482117 GGTCAAACTGGACCACACCAAGG + Intergenic
1121875183 14:97444778-97444800 TGGCAGAGTGGATCAAAATATGG + Intergenic
1122785398 14:104161124-104161146 AGGAAGTGTGGACCACAGCAGGG + Intronic
1126383456 15:48070894-48070916 TGGCAGACAGGTTCACACCAGGG + Intergenic
1127705391 15:61541830-61541852 TTGCTGCTTGGACCACACCAGGG + Intergenic
1127877328 15:63122293-63122315 GGGCTGAGTGGACCCCACCCGGG + Intronic
1128560912 15:68667164-68667186 GGGCAGAGTGGGCCAAGCCATGG - Intronic
1128632270 15:69279294-69279316 GGGCAGAGATGGCCACACCAAGG - Intergenic
1129677944 15:77642542-77642564 TGGCAGAGCTGAGCACTCCATGG - Intronic
1129717658 15:77861570-77861592 TGGAAAATTGGGCCACACCATGG - Intergenic
1129737559 15:77974664-77974686 TGGGAGGGTGGATCAGACCATGG - Intergenic
1129848509 15:78778952-78778974 TGGGAGGGTGGATCAGACCATGG + Intronic
1133587531 16:7210335-7210357 TGACAGCGTGGACCACACTGTGG + Intronic
1137029060 16:35505846-35505868 TCGCAGCGTGGCCCACACCTGGG - Intergenic
1137954700 16:52817287-52817309 TGGCCAAGTGGACGAGACCAGGG + Intergenic
1138617790 16:58184722-58184744 TGGCAGACTGGAACACTGCAGGG - Intronic
1140934736 16:79659990-79660012 TTGCAGAGGGAACCACTCCAAGG - Intergenic
1142467220 17:143071-143093 TGGATGAGTGGACAACAGCATGG + Intergenic
1144276348 17:13672116-13672138 AGGGAGAGTGCACCACACCAAGG + Intergenic
1146637026 17:34514123-34514145 TGGCAGTGAGGACCACACAGAGG - Intergenic
1146778428 17:35644199-35644221 TAGCACAGTGGACAAGACCATGG - Intronic
1147183379 17:38700974-38700996 TGGTAAAGTGGAACACAGCAGGG + Intergenic
1149082489 17:52675877-52675899 TGGCAGAGTGTCCCATCCCAGGG + Intergenic
1153172602 18:2333233-2333255 AGGCAGAGTGGAGCAAAGCATGG - Intergenic
1156068611 18:33176234-33176256 TGTCAGACTGGACAACTCCATGG - Intronic
1156187419 18:34678939-34678961 TGTAAGAGTGGACTACAACAAGG - Intronic
1157802981 18:50635912-50635934 AGGCCTAGTGGACCACACCATGG - Intronic
1159068612 18:63596987-63597009 TGGTAGAGTGGACTAGTCCAGGG + Exonic
1159245216 18:65797061-65797083 GGAGAGAGTGGACCACATCACGG - Intronic
1160064588 18:75562844-75562866 TGGCCCAGTTGGCCACACCATGG - Intergenic
1160542058 18:79629250-79629272 TGGCACGGGGGACCACACCCGGG + Intergenic
1160571429 18:79819875-79819897 AAGCAGAGTGGACCTTACCAGGG - Intergenic
1160571746 18:79822243-79822265 TGGCAGAATGGTCCAGACCAGGG + Intergenic
1162726006 19:12690006-12690028 AGGCAGCGAGGACCACACCCTGG - Exonic
1164629455 19:29752610-29752632 TGGCAGAGTGGGCCACATGTTGG - Intergenic
1165988722 19:39793227-39793249 TGGCACAGAGGACCACAGCCTGG - Intergenic
1168676335 19:58280502-58280524 TGTTGGAGGGGACCACACCAGGG + Exonic
926425478 2:12735432-12735454 TGGCGGAGGAAACCACACCAGGG - Intronic
928622668 2:33106985-33107007 TGTCACAGGGGACCACACAAAGG - Intronic
934156445 2:89205333-89205355 TGGCGGAGTTGACCACAAGAGGG - Intergenic
934210873 2:89977427-89977449 TGGCGGAGTTGACCACAAGAAGG + Intergenic
935128747 2:100245781-100245803 TGGCAGAGGGGACTACCCCTAGG - Intergenic
938145875 2:128834659-128834681 AGGCAGAGTGGTCCACACTGAGG - Intergenic
940430379 2:153583561-153583583 TGGGAAAGTGGACCACAAAAAGG - Intergenic
943728211 2:191273963-191273985 TGTCAAAGTGAACCAAACCAAGG + Intronic
945718505 2:213387931-213387953 TGGCAGAGTGGGAAGCACCAGGG + Intronic
946671533 2:222110239-222110261 TGGCACACTGGCGCACACCATGG + Intergenic
947142202 2:227029951-227029973 TGTCAGTGTGGAACACACAAGGG + Intronic
1168941222 20:1712838-1712860 AGGGGGAGTGCACCACACCAAGG + Intergenic
1170281797 20:14657427-14657449 TGGCAGAGTGAAGCACTGCAGGG + Intronic
1172202441 20:33136039-33136061 TGCCAGAGTGCACCCCAGCAGGG - Intergenic
1173249671 20:41357921-41357943 TGGCATGGCGGACCTCACCAAGG + Exonic
1173933956 20:46845257-46845279 TGGCTGATTTGACCACACCCAGG + Intergenic
1175223861 20:57433595-57433617 TAGTAGAGTGGGCAACACCAGGG + Intergenic
1175542594 20:59757130-59757152 GGGCTGTGGGGACCACACCACGG - Intronic
1175768145 20:61605304-61605326 AGGCAGAGTGGGCCCCACCAAGG - Intronic
1176056321 20:63151047-63151069 TGGCAGAGTGGGCCGCACCGAGG + Intergenic
1176094915 20:63336185-63336207 GGGCAGAGAGGACAAAACCATGG + Intergenic
1178375600 21:32065078-32065100 TGGCAGAGTGGAAACCAGCAAGG - Intergenic
1178763933 21:35431677-35431699 TTGCAGAGTGGAAAATACCAGGG + Intronic
1179325750 21:40342692-40342714 TGGGAGATTGTGCCACACCAAGG - Intronic
1180079858 21:45481735-45481757 TGGCAGAGCCGACAGCACCACGG - Intronic
1185101900 22:48845058-48845080 TGGCAGAGTGGACCAGGAGATGG - Intronic
955677436 3:61463367-61463389 CAGCAGAGTGGATCACAGCAAGG - Intergenic
956335854 3:68162527-68162549 GAGCAGAGTGGTCCAGACCAGGG - Intronic
957453600 3:80412412-80412434 TGGGATAGTGGACCACAGAATGG + Intergenic
958050239 3:88335472-88335494 TGGCAGAGCTGACCAAGCCATGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
962264430 3:133935181-133935203 TGGCAGAGAAGACCACAAAAGGG - Intronic
964564384 3:158033781-158033803 TGGCAAAGAGGACGTCACCAAGG + Intergenic
966092827 3:176160361-176160383 AGGGAGAGTGCACCACATCAAGG + Intergenic
967135321 3:186508214-186508236 TGGGAGATGGGACCACACCATGG + Intergenic
969377604 4:6773200-6773222 GGGGAGAGTGGGCCACCCCAGGG - Intergenic
969712098 4:8850313-8850335 GGGCAGAGCTGACCACCCCAAGG - Intronic
972072425 4:35038414-35038436 GGGCAGAGTGGATCACTCCCCGG - Intergenic
976269497 4:83217088-83217110 GGGCAGGGTGGCCCACTCCAAGG + Intergenic
978027547 4:103896470-103896492 GGGAAGAGTGTACCACATCAAGG + Intergenic
978319852 4:107481598-107481620 AGGCAGGGTGAAGCACACCAAGG + Intergenic
980136799 4:128865766-128865788 TGGTAGCTTTGACCACACCATGG - Intronic
980328060 4:131374350-131374372 TGGCACAGTGGTCCTCAGCATGG - Intergenic
985485433 5:145992-146014 TGGCAGAGCTCACCACACCATGG + Intronic
986044880 5:4027194-4027216 TTGCCGTGTGGGCCACACCATGG - Intergenic
987916935 5:24227236-24227258 TGGGGGAGTGTACCACATCAAGG - Intergenic
990966738 5:61456433-61456455 CGGCAGAGGTGACCCCACCAAGG + Intronic
994945530 5:106383169-106383191 TGGCAGAGCGGGCCACTCAAAGG - Intergenic
996025373 5:118639238-118639260 AGGGAGAGAGCACCACACCAAGG + Intergenic
997476334 5:134144649-134144671 AGGCAGAGTGGGCCTCTCCATGG - Intronic
997913955 5:137904875-137904897 AGGGAGAGTGAAACACACCATGG + Intronic
1000134836 5:158337226-158337248 TGGCAGAGTGGAACCCAGCAAGG - Intergenic
1001539590 5:172528105-172528127 TGGAGGAGTGGACAAGACCAGGG - Intergenic
1002437394 5:179239960-179239982 TGGCAGAGTGGCACACACAGAGG + Intronic
1003051515 6:2785018-2785040 TGGCAAAGTAGACCACACACTGG - Exonic
1006086706 6:31600825-31600847 AGGGCGAGTGGACGACACCAAGG - Intergenic
1006406508 6:33848784-33848806 AGGCAGAGGGGATCCCACCAGGG - Intergenic
1006985556 6:38173303-38173325 TGGGAGAGTGGAACACTCCTGGG - Exonic
1007473525 6:42105317-42105339 TGGCAGAGAGGACCGACCCAGGG + Exonic
1014235080 6:118944982-118945004 AGGCAGAATGCACCACATCAAGG + Intergenic
1015310212 6:131758619-131758641 TGGCAGACTGGAACTCTCCAGGG + Intergenic
1016887501 6:148971631-148971653 TGGCAGAAGGGAACACAGCACGG + Intronic
1018039609 6:159910389-159910411 TGGCAGAGGTCACCACAGCAGGG + Exonic
1018674035 6:166203508-166203530 TGGAAGAGTGGCCCAGGCCAGGG - Intergenic
1018829550 6:167432913-167432935 TGGCAGAGTGGAAGAGGCCATGG + Intergenic
1019783488 7:2958771-2958793 TGGCAGAGTGGACCACACCAGGG + Intronic
1023191953 7:37592528-37592550 TGGCAGAGTAGACATCCCCAGGG + Intergenic
1025592847 7:62884734-62884756 TTGCAGAGTGGACAAAAACAGGG - Intergenic
1025597104 7:62943810-62943832 TTGCAGAATGGACCAAAACAGGG - Intergenic
1028077267 7:86532377-86532399 TGGCAGAATAGACCAAGCCAAGG - Intergenic
1028383182 7:90222240-90222262 TGGGTGCATGGACCACACCAAGG + Intronic
1029847485 7:103427754-103427776 TGGCAGGGTCAACTACACCAGGG + Intronic
1030255495 7:107505773-107505795 AGGGAGAGTGTACCACATCAAGG - Intronic
1033237614 7:139650600-139650622 TGTGAGAGGAGACCACACCAGGG - Intronic
1033439061 7:141362257-141362279 TGGCAGAGGGTGCCCCACCAGGG + Intronic
1034211234 7:149365036-149365058 AGGCAGAGTGCACCACAACCAGG + Intergenic
1034237710 7:149585596-149585618 TGGGTGAGAGGAGCACACCATGG + Intergenic
1034556106 7:151851421-151851443 TGGCAGAGTTGCCCACAGCGAGG - Intronic
1035968449 8:4220977-4220999 TGGCAGAGGAGAGCACCCCAAGG - Intronic
1036156946 8:6350906-6350928 CGGCTGAGGGGACCACCCCAGGG + Intergenic
1038401716 8:27288975-27288997 GGGCAGAGTGGAAAAGACCAGGG + Intronic
1041951783 8:63511075-63511097 AGGCATCGTGGAGCACACCATGG + Intergenic
1056040306 9:82658895-82658917 GGGCATAGTGGCGCACACCATGG - Intergenic
1056227775 9:84513052-84513074 TGTCAGAGGGGACCAGAACATGG + Intergenic
1057239619 9:93397231-93397253 TGGCAGAGTAGCAAACACCAGGG - Intergenic
1061163862 9:128911349-128911371 TGGGAGAGTGGACCAGGGCAGGG + Intronic
1062383362 9:136298341-136298363 CGGCAGAGGGGTCCACTCCATGG - Intronic
1062731439 9:138112446-138112468 GGGCAGATTGGCCCACACAACGG - Exonic
1190258804 X:48785409-48785431 AGGCAGACTGGATCACACCCTGG - Intergenic
1191616777 X:63177616-63177638 AGGGAGAGTGCACCACATCAAGG + Intergenic
1191619520 X:63201307-63201329 AGGGAGAGTGCACCACATCAAGG - Intergenic
1191787612 X:64934163-64934185 TAGCAGAAGGGACCACAACAAGG - Intronic
1192204027 X:69084316-69084338 TGGCAAAGTGGACCCTGCCAAGG + Intergenic
1192718490 X:73668135-73668157 TGGCAAAGTAGACCAAACAAAGG - Intronic
1197371233 X:125628307-125628329 AGGGAGAGTGCACCACATCAAGG + Intergenic
1199170254 X:144726803-144726825 AGGGAGAGTGTACCACATCAAGG + Intergenic
1200143490 X:153913601-153913623 CTGCAGAGGAGACCACACCAGGG + Intronic
1200701354 Y:6405234-6405256 TGACACAGTAGTCCACACCATGG - Intergenic
1201032757 Y:9759464-9759486 TGACACAGTAGTCCACACCATGG + Intergenic