ID: 1019783557

View in Genome Browser
Species Human (GRCh38)
Location 7:2959111-2959133
Sequence TGGGAAATTACAGCGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019783557_1019783562 -4 Left 1019783557 7:2959111-2959133 CCCACACACGCTGTAATTTCCCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1019783562 7:2959130-2959152 CCCAAGGGCAGTGTTCCTTATGG 0: 1
1: 0
2: 2
3: 18
4: 124
1019783557_1019783564 8 Left 1019783557 7:2959111-2959133 CCCACACACGCTGTAATTTCCCA 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1019783564 7:2959142-2959164 GTTCCTTATGGTGACTGACGAGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019783557 Original CRISPR TGGGAAATTACAGCGTGTGT GGG (reversed) Intronic
902138000 1:14327364-14327386 TGGGAAGGGACAGCGTGTGGGGG - Intergenic
905857469 1:41323432-41323454 TGGGCACTTACGGCCTGTGTTGG - Intergenic
909179373 1:72402022-72402044 TGGCAAAATACAGGGTCTGTAGG - Intergenic
918125646 1:181580995-181581017 TAGGAAATTACATCCTATGTTGG + Intronic
918290773 1:183105840-183105862 TGGGAGATTACAGCTTCTGCAGG - Intronic
921188295 1:212688276-212688298 TGGTAAATTGGAGTGTGTGTTGG - Intronic
921576069 1:216836498-216836520 TGGGAGATTACAGTGTTGGTAGG - Intronic
922090155 1:222388198-222388220 TGGGAAATTCAAGTGGGTGTTGG - Intergenic
924252435 1:242145961-242145983 TGGCAAATGACAGGGTGTGGTGG - Intronic
1063025751 10:2177713-2177735 TGGCAAATTGGAGCGTGTCTTGG + Intergenic
1069514358 10:69065843-69065865 GGGGGAATTACTGCGTGGGTTGG - Intergenic
1073114087 10:101081190-101081212 TGGGAAATTGCAGGGAGTTTGGG - Intergenic
1073895592 10:108152691-108152713 TGGAAAATTGCAGCTGGTGTTGG + Intergenic
1074797886 10:116967309-116967331 TTGGAAAGTACAGCTTTTGTGGG + Intronic
1074883624 10:117677866-117677888 TGGGAGGATACAGTGTGTGTGGG - Intergenic
1081231730 11:40592720-40592742 TGGGAGATGACAGGGTGTCTTGG - Intronic
1081577349 11:44327346-44327368 TGGGAAAGTGCTGAGTGTGTGGG + Intergenic
1082832300 11:57627723-57627745 GAGGAGATTAGAGCGTGTGTTGG + Intergenic
1083422949 11:62565985-62566007 TTGGAAATGACAGGGTGAGTGGG + Intronic
1089760718 11:120721126-120721148 TGGGCAATTACAACATCTGTGGG + Intronic
1096024284 12:48347883-48347905 TGAGAACTCACAGAGTGTGTGGG - Intronic
1103518872 12:121524641-121524663 GTGGAAATAACAGCGTTTGTGGG + Intronic
1106698171 13:32200800-32200822 TGGTAACTGACAGCATGTGTGGG - Intronic
1114825970 14:26080269-26080291 TGGGAACTTACAGTTTCTGTTGG - Intergenic
1116962825 14:50984109-50984131 TGAGAAATTACATTGTGTGGAGG + Intronic
1118198191 14:63647893-63647915 TGGGCAGTTACAGTGTGGGTTGG - Intergenic
1123981404 15:25607974-25607996 TGGTAAATTATACAGTGTGTTGG - Intergenic
1137500590 16:49008650-49008672 TGCAAAAATACAGTGTGTGTAGG - Intergenic
1137905953 16:52322266-52322288 TGGGACATTCCTGTGTGTGTTGG - Intergenic
1138092559 16:54188316-54188338 TGGGAAATTACAGCATCGTTTGG - Intergenic
1141596526 16:85100275-85100297 TGGGAAAACACAGCGTGGGTTGG + Intronic
1145723108 17:27090677-27090699 TGGGAAACCACAGTGGGTGTGGG - Intergenic
1146960939 17:36978041-36978063 TCAGAAATTACAGCTTGAGTGGG + Intronic
1147815811 17:43209415-43209437 TGGGAAATTACAACCTGGGAAGG - Intronic
1151561475 17:74872206-74872228 TGGGAAGTTCCAGCTTCTGTTGG - Intronic
1153308556 18:3655077-3655099 TGGGAAATTGCAGTGGGGGTTGG - Intronic
1153963976 18:10164435-10164457 TGGGAAATTGCACCAGGTGTGGG - Intergenic
1154253733 18:12765660-12765682 TGGGAAATGTCAGCGTGGGGTGG - Intergenic
1165554422 19:36617704-36617726 TGGGAAATTACTGAGTGGATAGG + Intronic
1167235724 19:48313593-48313615 TGGGAAATTGCTGGGTGTGGTGG + Intronic
925178327 2:1800313-1800335 AGGGAAATTCCAACCTGTGTTGG + Intronic
926599133 2:14822669-14822691 TGGGAGGTTACACCGTGTGATGG - Intergenic
933764172 2:85695721-85695743 TGGGAAAGTACTGGGGGTGTGGG + Intronic
936057078 2:109269357-109269379 CTGGAAATTACACGGTGTGTGGG - Intronic
936917606 2:117655727-117655749 ATGGAAATTACAGCGGGGGTTGG + Intergenic
940343778 2:152608191-152608213 TGGGAAATTACAGCCCGGTTAGG - Intronic
940762898 2:157757333-157757355 TGGGAAATTTCAGCTTTTTTTGG - Intronic
941407582 2:165110092-165110114 TGGTAAATTACTGCGTGTTTGGG - Intronic
941733512 2:168946399-168946421 TGGCAAATTACAAAGTGAGTAGG + Intronic
948176866 2:235950363-235950385 TAGGATATCACAGGGTGTGTGGG + Intronic
1169284306 20:4295153-4295175 GGGGGAATGACAGTGTGTGTGGG + Intergenic
1183471238 22:38007800-38007822 TGGGGAATTACAGCGTTGCTGGG + Intronic
1184175821 22:42788235-42788257 TGGGAAAGGCCAGCGTGTGTGGG - Intergenic
950243127 3:11389560-11389582 CGGGAAAATACCGCCTGTGTGGG + Intronic
950402195 3:12777800-12777822 TGGGAAAATGCAGGATGTGTTGG + Intergenic
952769756 3:36988020-36988042 TGGGAAAGAACAGGGTGTATAGG + Exonic
954680460 3:52343267-52343289 TGGGACATACCAGAGTGTGTGGG + Intronic
959110777 3:102119876-102119898 TGGGCAATTTTAGCGTGTGTTGG - Intronic
960150395 3:114243357-114243379 TGGGATATTACAGCATGAGATGG - Intergenic
961137970 3:124529628-124529650 TGGGAAACTACAGGGTGGTTTGG + Intronic
961666790 3:128497738-128497760 TGGAAAAATACAGCCTTTGTCGG - Intergenic
962481412 3:135801609-135801631 TGGGCAATTACAGTGTGAGAAGG + Intergenic
962932383 3:140050365-140050387 TGTGAAATTGCCGTGTGTGTAGG - Intronic
969096479 4:4736338-4736360 TGGGAAAGTCCAGAGTGTGTGGG + Intergenic
969861490 4:10039419-10039441 TGGGAAACTACAGGTTTTGTTGG - Intronic
972561880 4:40236087-40236109 ATGGGAATTACAGTGTGTGTTGG + Intronic
977104030 4:92857354-92857376 TGTGAATGTACAGGGTGTGTTGG + Intronic
986714092 5:10510244-10510266 AGGGAAAATACAAAGTGTGTGGG + Intronic
997580852 5:135015985-135016007 TGGGAAACTACAGAGTGACTGGG + Intergenic
997897274 5:137730401-137730423 TGGGAAATTGCAGTGTGTACTGG + Intronic
1000535732 5:162476338-162476360 TGGGAAAGTAAAGCTTGTATAGG + Intergenic
1014005178 6:116409752-116409774 TGGGAAACTACAGTGTGTAATGG + Intronic
1017323619 6:153121225-153121247 TTGGTAAATACAGCCTGTGTGGG - Intronic
1018081786 6:160265327-160265349 TGTCAATTTACAGCATGTGTTGG + Intronic
1018696311 6:166394204-166394226 TGGGAAAGTACAGTATCTGTGGG + Intergenic
1019783557 7:2959111-2959133 TGGGAAATTACAGCGTGTGTGGG - Intronic
1030928397 7:115487278-115487300 TGGACAAATACAGAGTGTGTGGG + Intergenic
1032634227 7:133689088-133689110 TGAGAAATTGCTGGGTGTGTTGG - Intronic
1034887439 7:154808699-154808721 TGGGAAATTACAGGGATTGACGG + Intronic
1040290853 8:46123397-46123419 TGGGGCATTACAGCTTGTGCAGG + Intergenic
1040295869 8:46148795-46148817 TGGGGAATTACAGCCTGCCTAGG + Intergenic
1040299887 8:46182466-46182488 TGGGGAACTACAGCCTGTCTGGG + Intergenic
1041708733 8:60874035-60874057 TGGGCAATTGGAGGGTGTGTTGG + Intergenic
1046225774 8:111278640-111278662 AGGGAAATTACTGAGTGTTTTGG - Intergenic
1049304210 8:141891026-141891048 TGGGAAATAATTGCGTGTGATGG + Intergenic
1050573774 9:6970549-6970571 GGGGAAATTAGAGCTTGTGGTGG + Intronic
1051694720 9:19755551-19755573 GGGGAAATTACAGCAAGAGTTGG + Intronic
1056609388 9:88114862-88114884 CGGGAAATCACAGTGGGTGTGGG - Intergenic
1192449348 X:71233796-71233818 TGGGAAAATAAAGTGTGTTTGGG - Intergenic
1194619649 X:96154417-96154439 TGGGAATTTAAAAAGTGTGTAGG - Intergenic
1197306274 X:124845737-124845759 AGGGAAATTACAGGGTGTGATGG + Intronic