ID: 1019787161

View in Genome Browser
Species Human (GRCh38)
Location 7:2984372-2984394
Sequence GTGTCAGTCCCAGAGTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 12, 3: 41, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019787161_1019787168 12 Left 1019787161 7:2984372-2984394 CCTTCAAACTCTGGGACTGACAC 0: 1
1: 0
2: 12
3: 41
4: 228
Right 1019787168 7:2984407-2984429 TGTTTTCGGACCTTCAAACTGGG 0: 1
1: 0
2: 0
3: 11
4: 183
1019787161_1019787167 11 Left 1019787161 7:2984372-2984394 CCTTCAAACTCTGGGACTGACAC 0: 1
1: 0
2: 12
3: 41
4: 228
Right 1019787167 7:2984406-2984428 TTGTTTTCGGACCTTCAAACTGG No data
1019787161_1019787163 -2 Left 1019787161 7:2984372-2984394 CCTTCAAACTCTGGGACTGACAC 0: 1
1: 0
2: 12
3: 41
4: 228
Right 1019787163 7:2984393-2984415 ACCATGGACTCCCTTGTTTTCGG 0: 1
1: 0
2: 0
3: 16
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019787161 Original CRISPR GTGTCAGTCCCAGAGTTTGA AGG (reversed) Intronic
900758549 1:4454723-4454745 GTGTCAGTCTCAGTGTGTGGTGG - Intergenic
900905655 1:5555332-5555354 GTGTAAGTCCCGGAGCATGAAGG + Intergenic
901717512 1:11168414-11168436 GTGTCACTCACAGAGTCTGATGG - Intronic
902088593 1:13883868-13883890 GTGTAAGTCCTGGAGTCTGAAGG + Intergenic
905475612 1:38225542-38225564 GTGTAAGTCCCGGAGTCTAAAGG + Intergenic
906054561 1:42905102-42905124 GTGTAAGTCCTGGAGTGTGAAGG + Intergenic
906260849 1:44388561-44388583 ATGTAAGTCCCAGAGTCAGAAGG + Intergenic
909979468 1:82081504-82081526 GTGTAAGTCCTAGAGTCTGAAGG + Intergenic
910498929 1:87866231-87866253 GTGTAAGTCCCAGAGTCTGATGG + Intergenic
910806439 1:91193361-91193383 GTGTCAGGCACAGAGTTAGCAGG - Intergenic
913163158 1:116163686-116163708 GTGTCAGACCTAGAGCTTGCAGG + Intergenic
913321189 1:117589678-117589700 GTTTAAGTCCCAGAGTTTGAAGG - Intergenic
913455929 1:119030704-119030726 CTGTAAGTCCCAGAGTCTAAAGG - Intergenic
916388905 1:164308631-164308653 ATGTCAGTCCCAGAATATGGAGG - Intergenic
916751484 1:167726382-167726404 TTGTCTGTCCCAGATTCTGATGG - Intronic
918416608 1:184315563-184315585 GTTTCAAACCCAGAGGTTGATGG - Intergenic
918421058 1:184364568-184364590 GTGTAAGTCCCAGAGTCAGAAGG + Intergenic
918463268 1:184797101-184797123 GTTTCAGGTCCACAGTTTGATGG + Intronic
919801179 1:201355530-201355552 GGGGCAGAGCCAGAGTTTGATGG + Intergenic
920431943 1:205924265-205924287 GTGCCAGGCCCAGAGGTGGAAGG + Intronic
922977363 1:229796682-229796704 GTCATAGTCCCAGAGTTAGACGG + Intergenic
923899902 1:238314456-238314478 GTGTAACTCCCAAAGTCTGAAGG + Intergenic
1063021626 10:2134837-2134859 GTGTAAGTCCCAGAGTCCAAAGG - Intergenic
1063804553 10:9623469-9623491 GAGTAAGTCCTAGAGTTTAAAGG + Intergenic
1064236694 10:13582610-13582632 GCATAAGTCCCAGAGTCTGAAGG - Intergenic
1065835613 10:29655338-29655360 GTGCAAGTCCCAGAGTCTAAAGG + Intronic
1067265704 10:44742493-44742515 CTGTCAGTTTCAGTGTTTGATGG - Intergenic
1068583574 10:58771207-58771229 GTGGCTGTGCCAGAGTCTGAAGG + Intronic
1068937463 10:62649946-62649968 GTGCAAGTCCCAGAGTTCAAAGG - Intronic
1069619851 10:69830069-69830091 GAATCAGTCCCAGACCTTGAAGG + Intronic
1069869281 10:71523392-71523414 TTGGTAGTCCCCGAGTTTGAGGG - Intronic
1071946781 10:90654966-90654988 GTGTAAGTCCCAGAGTCCAAAGG + Intergenic
1072590075 10:96820898-96820920 GTGTAAGTCCCAGAGTCCAAAGG - Intergenic
1073150955 10:101311127-101311149 ATGTGAGTCCCAGAGGATGAGGG - Intergenic
1075346652 10:121687139-121687161 GCGTGAGTCCCTGAGATTGAGGG - Intergenic
1077862404 11:6194869-6194891 GTGTCAGTCCCAGAGATTCTGGG + Intergenic
1079652428 11:22946429-22946451 GAGTAAGTCCCAGAGTCTGAAGG - Intergenic
1080020573 11:27555507-27555529 TAGTCAGTCCTAGAGTCTGAAGG + Intergenic
1080193238 11:29576605-29576627 TTGTCAGTCCCAAAGTGTCATGG + Intergenic
1083414992 11:62519790-62519812 GTGTCTGTCCCTAAGGTTGAAGG - Exonic
1084300809 11:68250797-68250819 GTATAAGTCCCAGAGTCTGAAGG + Intergenic
1085317234 11:75552994-75553016 GTGTGAGTCCCATTGTTTAAGGG + Intergenic
1085568838 11:77541425-77541447 GTGTAAGTCCCAGAGTCCAAAGG - Intronic
1087287086 11:96276510-96276532 GTGTCACTCTCAGCTTTTGAGGG - Intronic
1088235854 11:107721842-107721864 GTGTAAGTCCCAGAGTTCAAAGG + Intergenic
1091701984 12:2669487-2669509 GAATGAGTCCCAGAGTTTCATGG - Intronic
1091934268 12:4423029-4423051 GCTTCATTCCCAGAGTTTGCAGG + Intergenic
1093004154 12:14034015-14034037 GTGTAAGTCCCAGAGTGGAAAGG - Intergenic
1093938734 12:25029761-25029783 GTTTGAGCCCCAGAGTTCGAAGG - Intronic
1096573032 12:52534790-52534812 GGGTAAGTACCAGAGTTTTAGGG - Intergenic
1096836223 12:54352993-54353015 GTGTCAGTGCCAGAGCTGGGTGG + Intergenic
1099900275 12:88699138-88699160 GTGTAAATCCCGGAGTCTGAAGG - Intergenic
1100666275 12:96756794-96756816 GTGTCAGTCCCAGGATTTCTGGG + Intronic
1102666489 12:114578348-114578370 GTGTAAGTCCCAGAGTCTGAAGG - Intergenic
1102721590 12:115021301-115021323 GTGTCAGCCCAAGAGTTAGAGGG + Intergenic
1103951988 12:124556270-124556292 GTGTCAGTCACAGGGATGGATGG + Intronic
1104263342 12:127205831-127205853 GTGTAAGTCTCAGAGTCTCAAGG + Intergenic
1107827513 13:44342129-44342151 GTATCAGTCCTAGATTCTGAAGG - Intergenic
1107966534 13:45603065-45603087 GTGTAAGTCCTGGAGTCTGAAGG + Intronic
1108164725 13:47680127-47680149 GTATCTGTCACAGAGTTTGATGG + Intergenic
1108732190 13:53246646-53246668 GTGTAAGTCCCAGAGTCTCAAGG + Intergenic
1108754879 13:53487577-53487599 GTGCAAGTCCTAGACTTTGAAGG - Intergenic
1109010985 13:56943720-56943742 GTGGAAGTCTCAGAGTCTGAAGG - Intergenic
1109388498 13:61664934-61664956 GTGTGAGTCCCAGAGCTCAAAGG + Intergenic
1114653959 14:24304838-24304860 GTGGCAGTCCCAGGGTCTGGGGG + Intronic
1115722620 14:36179716-36179738 GTGCCAGTCCCAGAGTCCAAAGG - Intergenic
1116459235 14:45152450-45152472 CTCTCAATACCAGAGTTTGAAGG + Intronic
1116769389 14:49109706-49109728 GTGTAAGTCCCAGAATTCAAAGG + Intergenic
1118260754 14:64244589-64244611 GTGTGAGTCCCAGGGTCTGGAGG - Intronic
1119437234 14:74605476-74605498 TTGTCAGACCCAGAGTTTCCGGG + Intronic
1119573664 14:75698820-75698842 GTTTGAGCCCCAGAGGTTGAGGG + Intronic
1121241426 14:92432912-92432934 GTGTCATTCCCTGTGTTTAAGGG + Intronic
1121486162 14:94316867-94316889 GTTTAAGTCCCAGAGTTTAAAGG - Intronic
1121705327 14:95988891-95988913 GTGTAAGTCCTGGAGTCTGAGGG - Intergenic
1125190102 15:36981912-36981934 GTGTAAGTCTTGGAGTTTGAAGG - Intronic
1125449838 15:39796690-39796712 GTGTAAGTTCCAAAGTTGGAGGG - Intergenic
1125989203 15:44089356-44089378 TTGTCAGTACCAGAGTTTCCAGG + Intronic
1126257077 15:46640463-46640485 GTCTTGGTCCCAAAGTTTGAGGG + Intergenic
1126282265 15:46967463-46967485 GTGTAAGTTCTAGTGTTTGATGG + Intergenic
1129910337 15:79221370-79221392 GAGAGAGGCCCAGAGTTTGAGGG - Intergenic
1130343536 15:83020354-83020376 GTTTCAGTCCTAGAGTTGAAAGG + Intronic
1130556776 15:84928317-84928339 GGGGCAGACCCAGAGATTGAAGG - Intronic
1130694456 15:86116647-86116669 GTGTAAGTCCCATAGTGTGAAGG - Intergenic
1132421930 15:101677398-101677420 GTGTAAGTCCCAGAGTTGGTGGG - Intronic
1136182645 16:28565011-28565033 GTGTAAGTCTCAGAGTCTAAAGG + Intronic
1137897155 16:52226409-52226431 GTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1138846034 16:60567708-60567730 GTGTTAGTTCCAGAGTCTAAAGG - Intergenic
1141861499 16:86719723-86719745 GTGTCAGTGCCAGGGTCTGAAGG - Intergenic
1143303398 17:5927670-5927692 GTGGCCGTCCCAGTGTTTGCAGG + Intronic
1144021551 17:11242926-11242948 GTGTCATTCCTAGAGTTCTAAGG - Intronic
1148808824 17:50277920-50277942 GTGGAAGTCCCCGAGTTTGTTGG - Intronic
1149307515 17:55363410-55363432 GTGTAAGTCCCAGAGTGCAATGG + Intergenic
1149672827 17:58430594-58430616 GTGTAAGTCCCAGAGTACAAAGG - Intronic
1151342660 17:73481751-73481773 GTGTAAGTCCTAGAGTCTGCAGG - Intronic
1151444984 17:74157599-74157621 GTGTAAGTCCCAGAGTCCAAAGG - Intergenic
1152046670 17:77941215-77941237 GTGTAAGTCCCAGAGTCCAAAGG - Intergenic
1152144366 17:78559407-78559429 GAGTCAGTCCCAATGTTTTAGGG - Intronic
1152723394 17:81933706-81933728 GTGGCACTCGCAGAGTCTGAGGG + Intronic
1153185483 18:2481505-2481527 GTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1153656402 18:7286640-7286662 TTGTAAGTCCCAGAGTCTGAAGG + Intergenic
1155588395 18:27395769-27395791 GTATAAGTCCCAGACTCTGAAGG + Intergenic
1155632350 18:27908140-27908162 GTGTCGATCCCACAGGTTGAGGG + Intergenic
1156029716 18:32698346-32698368 GTGTCAGTCAGTGAGTTAGAGGG + Intronic
1156950982 18:42897422-42897444 TTGTCAGTCACAGAGTTATAAGG - Intronic
1157750522 18:50174130-50174152 ATGTAAGTACCAGAGTCTGAGGG - Intronic
1158452168 18:57576464-57576486 TTGTGAGTCACAGATTTTGAAGG - Intronic
1159277938 18:66245253-66245275 GTTTAAGTCCCAGAGTCTGAAGG + Intergenic
1159819948 18:73128791-73128813 GTGCGAGTCCCAGAGTTCAAAGG - Intergenic
1160240829 18:77121225-77121247 GTTTGAGCCCCAGAGATTGAGGG + Intronic
1165386328 19:35512594-35512616 GTGTTGGTCCCAAAGTTTGGTGG + Exonic
1166303417 19:41924457-41924479 GTGTCTGTCACAGAGATGGATGG + Intronic
926687119 2:15706645-15706667 GTGTAAGTCCCAGAGTCCAAAGG + Intronic
928184438 2:29096950-29096972 GTGCCAGGCCCAGAGCTTCATGG - Intergenic
930631832 2:53761518-53761540 GTATGAGTCCTGGAGTTTGAAGG - Intronic
931215690 2:60242086-60242108 GTGTTAGTCCCAGAGTCTGAAGG - Intergenic
931419638 2:62114728-62114750 GTGTCACGCCCAGAGCTTGGAGG + Intronic
931938771 2:67229077-67229099 GTGTAAGTTGCAGAGTCTGAAGG + Intergenic
935391798 2:102560516-102560538 GCTACAGTCCCAGAGTTTCAGGG + Intergenic
935485251 2:103645358-103645380 GTATAAGTCCCAGAGCCTGAAGG - Intergenic
935573435 2:104686673-104686695 GTGTCAGTCCCATAAGCTGAAGG + Intergenic
937471829 2:122180595-122180617 GTGTAAATCCCTGAGTCTGAAGG + Intergenic
937493981 2:122398766-122398788 GTGTAGGTCCCAGAGTCTGAGGG - Intergenic
938560749 2:132470141-132470163 GTGTTTGTCCCTGAATTTGAGGG + Intronic
939720630 2:145646017-145646039 ATATAAGTCCCAGAGTTGGAAGG + Intergenic
939934855 2:148278879-148278901 GTGTCAGTCCTGGAGTTCAAAGG + Intronic
940511452 2:154620504-154620526 GTGTCAGTCCTGGAGTCTGAAGG + Intergenic
942084467 2:172430872-172430894 GAGTCATTCCCAGAGGTGGAAGG + Intronic
943847361 2:192669202-192669224 GTGCAAGTCCCTGAGTTTTAAGG - Intergenic
944755591 2:202758703-202758725 GAGTCAGAGCCAGACTTTGAAGG + Intronic
945783728 2:214207899-214207921 GTGTAAGTCCAAGAGTCTAAAGG - Intronic
946224890 2:218259188-218259210 GAGTCAGCCCCAGGGCTTGATGG + Intergenic
946317915 2:218930516-218930538 GTGTAAATCCAAGAGTTTAAAGG + Intergenic
946764590 2:223028457-223028479 GCTTCAGTCCCAGAGTTTGATGG + Intergenic
947028453 2:225765088-225765110 GTGTAAGTCCCAGAGCTTGAAGG - Intergenic
947058894 2:226139308-226139330 GTGCTCTTCCCAGAGTTTGAGGG + Intergenic
1169417840 20:5432873-5432895 GTGTAAGTCCCAGGATTTGAAGG + Intergenic
1171748856 20:29027599-29027621 GTGTTGGGCCCAGAGGTTGAAGG + Intergenic
1173225551 20:41160459-41160481 GTCTCAGAGCCAGAGTTTCAGGG - Intronic
1174037871 20:47679148-47679170 GTGTCTGCCCCAGAGGTTCAGGG - Intronic
1175947227 20:62564587-62564609 GTGTCAGTTCCAGAGCATGGAGG + Intronic
1177300370 21:19236531-19236553 GTGTAAGTCCAAGAGTCCGAAGG - Intergenic
1177588737 21:23134032-23134054 GTGTCAGTAAGAGAGTTAGAAGG - Intergenic
1177798760 21:25806803-25806825 ATGTAAGTCCCAGAGTCTGAAGG - Intergenic
1184448173 22:44565944-44565966 GTGTCTGTTCCAGTGTCTGATGG - Intergenic
1184514848 22:44955648-44955670 GGGTAAGTCCCAGAGTCTGAAGG - Intronic
951564749 3:24002187-24002209 GTATCAGTCCCAGAGTCTGAAGG + Intergenic
952685940 3:36148493-36148515 GTGTAAGTCCAAGAGTCCGAAGG - Intergenic
953444179 3:42948599-42948621 GTGTAAGTCCAAGAGTCTAAAGG + Intronic
953521480 3:43647346-43647368 GTATAAGCCCCAGAGTCTGAAGG + Intronic
953638973 3:44687879-44687901 GTGCAAGTCCCAGAGTCTGAAGG + Intergenic
953857373 3:46509869-46509891 ATGTAAGTCCCAGAGTTCAAAGG + Intergenic
954446810 3:50551237-50551259 GAGTCAGGCCCAGAGTCTGTGGG - Intergenic
954631912 3:52052382-52052404 CTGTCAGTCCCTGAGTCTGGAGG - Intronic
956249833 3:67224395-67224417 GTGCAAGTCCCAGAGTCCGAAGG + Intergenic
956255870 3:67282768-67282790 GTGTAAGTCCCAGAGTCCAAAGG + Intergenic
956894412 3:73645112-73645134 GGGTATGTCCCAGAGTCTGAAGG + Intergenic
957454836 3:80428204-80428226 GTGTAAATCCCAGAATTTGGAGG + Intergenic
957788028 3:84905867-84905889 CTTTCAGTCCCACCGTTTGATGG - Intergenic
957791670 3:84949716-84949738 GTGTCAGTCCCAGAATTCAAAGG + Intergenic
959295610 3:104530968-104530990 CTGTCAGTCCCGAACTTTGAGGG + Intergenic
960577756 3:119244152-119244174 GTATAATTCCAAGAGTTTGAAGG + Intergenic
962420589 3:135225610-135225632 GCTTCAGTTCCAGAGTTTTATGG - Intronic
962717494 3:138139230-138139252 GAGTAAGTCCTAGAGTCTGAAGG - Intergenic
963515798 3:146306557-146306579 GTGCAAGTCCCAGACTTTGGTGG - Intergenic
964475908 3:157097440-157097462 ATGTAAGTCCCAGAGTTGGAAGG + Intergenic
964493575 3:157264216-157264238 ATGTAAGTCCCAGAGTCTGAAGG - Intronic
965430595 3:168582898-168582920 GTGTAAGTCCCAGAGTCCAAAGG - Intergenic
969303333 4:6310119-6310141 GTGTAAGTCCCAGAGTCCAAAGG - Intergenic
969871203 4:10106326-10106348 GTGTCAGTGTCAGAATATGAAGG - Intronic
970793332 4:19885993-19886015 CTGTAAGTCCCAGAATTGGAAGG - Intergenic
971456618 4:26851089-26851111 GTGCCAGTCCCAGAGTCTAAAGG - Intergenic
972306573 4:37836242-37836264 GTTCAAGTCTCAGAGTTTGATGG + Intronic
975202072 4:71602910-71602932 GTGTAAGTCCAAGAGTCTAAAGG + Intergenic
975287878 4:72641393-72641415 GTGTAGGTCCTAGAGTTTGCAGG + Intergenic
976844399 4:89471333-89471355 GTGTGAGTCCCAGCGTCTGAAGG - Intergenic
977127671 4:93189940-93189962 GTGTCATTCTCAGAGTTCAAAGG - Intronic
977204936 4:94157223-94157245 GTGTAAGTCCAAGAGTTCAAAGG + Intergenic
979378945 4:119985117-119985139 GAGTCAGTCCCAGTGCTTCAAGG - Intergenic
979689350 4:123544025-123544047 CTGCTAGTCCCAGAGTTTGGCGG + Intergenic
979993153 4:127399727-127399749 GTGTGAGCAGCAGAGTTTGACGG - Intergenic
979997138 4:127444508-127444530 GTGTGATTCCCAGAGTCTAAAGG - Intergenic
980415062 4:132476801-132476823 GTATAAGTCCCAGAGTCTGAAGG + Intergenic
980933906 4:139208036-139208058 GTGCAAGTCCCAGAGTCTAAAGG + Intergenic
981269188 4:142824098-142824120 GTTTAAGTCCCAGAGTCTGAAGG - Intronic
981549876 4:145933059-145933081 GTGTCATCCCCAGAGTGAGATGG + Intronic
981567276 4:146114401-146114423 GTGTAAGTCCTGGAGTTTGAAGG + Intergenic
984278452 4:177638362-177638384 GTGTAAGTTCCAAAGTCTGAAGG - Intergenic
986191748 5:5502831-5502853 GTGCAAGTCCCAGAGTTCAAAGG - Intergenic
986232196 5:5876631-5876653 GTGCAAGTCTCAGAGTTTGAAGG + Intergenic
986520732 5:8614909-8614931 GTGTAAATCCCAGAGTCTGCAGG + Intergenic
987218415 5:15764012-15764034 GTGTAAGCCCCAGAGCCTGAAGG + Intronic
989624449 5:43415843-43415865 GTGCCAGAACCAGAGGTTGAGGG - Intergenic
989955353 5:50352730-50352752 GTGTGAGTCCTGGAGTCTGAAGG - Intergenic
991461931 5:66867905-66867927 ATGACAGTGCCAGAGTCTGAAGG + Intronic
992356889 5:75994971-75994993 GAGTAAGTCCCAGGGTCTGAAGG + Intergenic
993278072 5:85887952-85887974 GTGTAAGTTCCAGAGTCTTAAGG - Intergenic
993762836 5:91818183-91818205 GCTTCAGTTCCAGAGTTTGGAGG - Intergenic
995148362 5:108811760-108811782 GTGTAAATCCCAGAGTAAGAAGG + Intronic
995861417 5:116644731-116644753 GTGTGAGTCCCAAAGTCTAAAGG + Intergenic
997807557 5:136934177-136934199 GTGTAAGACCCAGAGTTGAAAGG - Intergenic
999146710 5:149400809-149400831 GTGTAAGTCCCAGAGTCCCAAGG + Intronic
1000225550 5:159257780-159257802 GTGTAAGTCCTAGAGTTCAAAGG - Intergenic
1000231251 5:159317201-159317223 GTAGCAGTGCCAGAATTTGAAGG - Intronic
1000679756 5:164168702-164168724 GTGTAAGTCCAAGAGTCTAAAGG + Intergenic
1001142051 5:169152796-169152818 GTTTCAGACTCAGAGTGTGAGGG + Intronic
1001217337 5:169868143-169868165 GTGTCAGGCCCAGAGCAGGATGG - Intronic
1002637870 5:180617096-180617118 GTGGGTGTCCCAGAGTCTGAGGG - Intronic
1002637908 5:180617246-180617268 GTGTGTGTCCCAGAGGCTGAGGG - Intronic
1002637919 5:180617296-180617318 GTGGGTGTCCCAGAGTCTGAGGG - Intronic
1002637931 5:180617346-180617368 GTGGGTGTCCCAGAGTCTGAGGG - Intronic
1002638060 5:180617847-180617869 GTGGGTGTCCCAGAGGTTGAGGG - Intronic
1003232073 6:4263332-4263354 GTGTAAGTCCCAGAGTCCAAAGG + Intergenic
1003829660 6:9993816-9993838 GTGTAAATCCCAGAGGTGGAAGG - Intronic
1004895102 6:20140623-20140645 GTGTAAGTCCCAGAGTCCAAAGG - Intronic
1006292198 6:33146719-33146741 GTGCAAGTCCCTGAGTGTGAAGG + Intergenic
1008422399 6:51317077-51317099 GTTTAAGTCCCAGAGTTCCATGG + Intergenic
1010563809 6:77384133-77384155 GTGTAAGTCCAAGAGTCTAAAGG + Intergenic
1010639899 6:78311952-78311974 GTGTCAGACCCAGAATTCGAAGG + Intergenic
1010734292 6:79426113-79426135 GTATAAGTCCCAGAGTCAGAAGG + Intergenic
1011185995 6:84676605-84676627 GTTTCAGCCCCAGAGGTTGATGG + Intergenic
1011186008 6:84676659-84676681 GGTTCAGTTCCAGAGGTTGATGG + Intergenic
1011186082 6:84676992-84677014 GGTTCAGCCCCAGAGGTTGATGG + Intergenic
1011780989 6:90789178-90789200 GTATAAGTCTCAGAGTCTGAAGG + Intergenic
1012002257 6:93667593-93667615 TTGCAAGTCCCAGAGTTTAAAGG - Intergenic
1012422653 6:99081444-99081466 GTGTAAGTCCCGGAGTTCAAAGG + Intergenic
1014288518 6:119530999-119531021 TTGTCATTCCCAGATGTTGAGGG + Intergenic
1015806089 6:137110079-137110101 GTCTGGGTCCCAGAGTCTGAAGG - Intergenic
1016670440 6:146699360-146699382 GTGCAAGTCCCAGAGTCCGAAGG + Intronic
1016778339 6:147930709-147930731 GTGCAAGTCCCAGAGTCCGAAGG + Intergenic
1018067465 6:160133950-160133972 GTTTCAGTCACAGAATTTGTTGG + Exonic
1018830402 6:167438166-167438188 GTCTAAGTCCAAGAGTCTGAAGG - Intergenic
1019461987 7:1164714-1164736 GTGTTAGTCCCAGAGCCGGAAGG + Intergenic
1019502786 7:1373272-1373294 TTCTCCGTCCCAGAGTTAGAAGG - Intergenic
1019787161 7:2984372-2984394 GTGTCAGTCCCAGAGTTTGAAGG - Intronic
1020162619 7:5783760-5783782 ATGTCAGGCCCTGAGTTAGAGGG + Intergenic
1021355120 7:19644716-19644738 GTGTAAGTCCCAGAGTGCAAAGG - Intergenic
1024865096 7:53896297-53896319 GTGCAAGTCCCAGAGTTCCAAGG - Intergenic
1027705793 7:81531861-81531883 GTATAAGTCTCAGAGTCTGAAGG + Intergenic
1029484408 7:100830454-100830476 GTTTCAGTCCAGGAGTTTGAGGG + Intronic
1029948097 7:104554890-104554912 GTGAAAGTCCCAGAGTCAGAAGG + Intronic
1030615116 7:111730602-111730624 GGGTTAGACCCACAGTTTGATGG + Intronic
1030898023 7:115085719-115085741 GTGCAAGCCCCAGAGTCTGAAGG + Intergenic
1031712298 7:125064052-125064074 GTGCCAGTTCCAGAGTTCAACGG + Intergenic
1032166286 7:129547629-129547651 GTGTAAGTCCCAGAGTCTGATGG + Intergenic
1032591397 7:133194993-133195015 GTTTAAGTCCCAGAGTTCAAAGG - Intergenic
1034384441 7:150727554-150727576 GTGTAAGTCCAAGAGTTCAAAGG - Intronic
1036149719 8:6286206-6286228 CTGTGAGTCCCAGAGTCCGAAGG + Intergenic
1037632825 8:20673626-20673648 GTGTAAGTCCAAGAGTCTGAAGG + Intergenic
1038329258 8:26595138-26595160 GCTTGAGCCCCAGAGTTTGAGGG + Intronic
1039055428 8:33532631-33532653 GTGTAAGTCCCAGAGTCTGAAGG - Intergenic
1041204711 8:55487197-55487219 GTGTAAGTCTTAGAGTCTGAAGG + Intronic
1041724250 8:61003550-61003572 TTGTTAGTCACAGAATTTGATGG + Intergenic
1041971535 8:63748482-63748504 GAGTCAGTCACAGAGTTGGATGG - Intergenic
1042027492 8:64439494-64439516 GTGTCAGGCCTGGAGTTAGAAGG - Intergenic
1043192985 8:77250323-77250345 ATGTGAGTCCCAGAGTTCAAAGG - Intergenic
1044053811 8:87542876-87542898 TTGTCAGTGCCAAAGTCTGAAGG + Intronic
1044439790 8:92209718-92209740 GTGTAAGTCCTTGAGTGTGAAGG - Intergenic
1044590269 8:93907559-93907581 TTGAGAGTCCCAGAGTTGGAGGG + Intronic
1045064338 8:98432310-98432332 GTGTCACTCCCAGCATTTGAAGG + Exonic
1046188029 8:110748557-110748579 GTGTAAGTCCAAGAGTCCGAAGG + Intergenic
1047966029 8:130047498-130047520 GTGTCAGTTCCAGAGTCTCAGGG + Intergenic
1050731318 9:8713169-8713191 CTGTCAGTGCCAGAATTTCAGGG + Intronic
1052041031 9:23739334-23739356 GTGGCAGCTCCAGTGTTTGAAGG - Intronic
1055378700 9:75682336-75682358 GTGTAAGTTCCAGAATCTGAAGG - Intergenic
1057472325 9:95368830-95368852 TTGTCTGTCCCAGAGTTAGGAGG + Intergenic
1057886869 9:98836452-98836474 CTGTCAGTCCCAGTGTGAGATGG + Intronic
1059949415 9:119446437-119446459 TTTTCAGTCTCAGAGTTTGATGG + Intergenic
1059985752 9:119818804-119818826 GTGTAAGTCCCAGAGTCCAAAGG - Intergenic
1060054646 9:120403038-120403060 GTGTCATTCCCAGAGAGTGGAGG + Exonic
1186312555 X:8336376-8336398 GTATCAGTCTCAGAGGTTAAGGG - Intergenic
1186507440 X:10104227-10104249 GTGTAAGTCCCAGAGTCTGAAGG + Intronic
1188990984 X:36819954-36819976 GTGTGAGTCCCAGAGTCTAAAGG - Intergenic
1190507120 X:51137219-51137241 GTGTCAATCCTAGCGTTTAAAGG + Intergenic
1194410095 X:93546711-93546733 GTGCAAGTACCAGAGTTTAAAGG + Intergenic
1194626882 X:96235672-96235694 GTGTAAGTCCCAGAGTCCAAAGG - Intergenic
1195272200 X:103242906-103242928 GTGTCTGGCCCAGAGGATGAGGG - Intergenic
1196226418 X:113172671-113172693 GTGTAAATCCCTGAGTCTGAAGG - Intergenic
1197034813 X:121860398-121860420 GGGGCAGTCCCAGAGATTCAGGG + Intergenic
1198099557 X:133412994-133413016 TTGTCATTCCCACATTTTGAAGG - Intronic
1198219259 X:134584912-134584934 GTGTCAGTTGCAGAATTTGTGGG - Intronic
1198527390 X:137515479-137515501 GTGTAAGTCCTGGAGTCTGAAGG - Intergenic
1200015628 X:153160552-153160574 GTGTAAGTCCCGGAGTCTGAAGG - Intergenic