ID: 1019788001

View in Genome Browser
Species Human (GRCh38)
Location 7:2991500-2991522
Sequence CCTTCCCACCAGAAGCTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019788001_1019788006 -4 Left 1019788001 7:2991500-2991522 CCCAACAGCTTCTGGTGGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1019788006 7:2991519-2991541 AAGGATGGAAACTGAGCAGGAGG No data
1019788001_1019788005 -7 Left 1019788001 7:2991500-2991522 CCCAACAGCTTCTGGTGGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1019788005 7:2991516-2991538 GGGAAGGATGGAAACTGAGCAGG No data
1019788001_1019788009 5 Left 1019788001 7:2991500-2991522 CCCAACAGCTTCTGGTGGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1019788009 7:2991528-2991550 AACTGAGCAGGAGGGGCATGAGG 0: 1
1: 0
2: 1
3: 50
4: 379
1019788001_1019788008 -2 Left 1019788001 7:2991500-2991522 CCCAACAGCTTCTGGTGGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1019788008 7:2991521-2991543 GGATGGAAACTGAGCAGGAGGGG No data
1019788001_1019788007 -3 Left 1019788001 7:2991500-2991522 CCCAACAGCTTCTGGTGGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1019788007 7:2991520-2991542 AGGATGGAAACTGAGCAGGAGGG 0: 1
1: 0
2: 7
3: 67
4: 511

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019788001 Original CRISPR CCTTCCCACCAGAAGCTGTT GGG (reversed) Intronic
903779812 1:25814092-25814114 TCGTCCCACCAGAAGCTGGCTGG + Exonic
904940051 1:34159340-34159362 CCTTTCCACCACAAGCTCCTGGG - Intronic
905874408 1:41422962-41422984 TGTTCCAACCAGAAGCTGTGTGG + Intergenic
906621168 1:47280822-47280844 CATTTCCAGCAGAAACTGTTTGG + Exonic
911776383 1:101818759-101818781 CCTTCCCCCCAAAAGCTTTTTGG + Intronic
912340239 1:108907397-108907419 CCTTTCCCCCAGAAACTATTTGG - Intronic
915648190 1:157288759-157288781 CCCTCCCTCCAGGAGCTGCTGGG - Intergenic
917478589 1:175390166-175390188 CCTTGGCACCTGATGCTGTTTGG + Intronic
919449386 1:197752404-197752426 CCTTCCCACAAGAAACATTTGGG + Intronic
919973046 1:202593074-202593096 CCCTCCCACCTAAAGCTGTTTGG - Exonic
921726035 1:218524691-218524713 CCTGCCCACAAGAGGCTCTTGGG + Intergenic
922459676 1:225805558-225805580 CCCTCTCTCTAGAAGCTGTTAGG + Intergenic
924528157 1:244870258-244870280 ACTTGCCACCTGAAGTTGTTGGG + Intergenic
1063987701 10:11523811-11523833 CATTCCCACCAGAAACACTTGGG + Intronic
1065234156 10:23630589-23630611 CCTTCTCCCCAGTAGCTGCTAGG - Intergenic
1067453380 10:46396505-46396527 CCTTCACCCCAGGTGCTGTTTGG + Intergenic
1067583855 10:47463261-47463283 CCTTCACCCCAGGTGCTGTTTGG - Intronic
1067633858 10:47988609-47988631 CCTTCACCCCAGGTGCTGTTTGG - Intergenic
1067657201 10:48203880-48203902 CCTTCGCACCAGGTGGTGTTGGG + Intronic
1067731382 10:48814109-48814131 CCTTCCCATCAGAACCTCCTCGG - Intronic
1069047932 10:63762613-63762635 CCCTCACACCAGAGGGTGTTGGG - Intergenic
1076435107 10:130435221-130435243 TGTTCCCACCAGAAGCTCTGGGG - Intergenic
1077387700 11:2278906-2278928 CCATGCAACCAGAAGCTGTCCGG + Intergenic
1080574485 11:33585744-33585766 CCTTCCAGCCAGAAGCTATGTGG - Intronic
1081818645 11:45969066-45969088 CCTTCTCCCCAGAGGCTATTTGG + Intronic
1086120878 11:83303625-83303647 CCTAGCCACCAGCAGCTGTGAGG + Intergenic
1088502635 11:110497924-110497946 ACTTCCCAACAGCAGGTGTTGGG + Intergenic
1089644452 11:119869440-119869462 TCTGCCCAGCAGCAGCTGTTGGG + Intergenic
1091229317 11:133977495-133977517 GCTTCCCACATGAAGCAGTTAGG + Intergenic
1094828097 12:34287565-34287587 CCTTTCCAGCAGATGCTGTATGG + Intergenic
1094833617 12:34312051-34312073 CCTCCCCAGCAGAACCTGTATGG - Intergenic
1098807125 12:75034264-75034286 AAGGCCCACCAGAAGCTGTTTGG + Intergenic
1104742225 12:131186441-131186463 CATTCACACCAGAATTTGTTGGG - Intergenic
1105811514 13:24000425-24000447 CCTCCCCACCAAGAGCTGTCTGG - Intronic
1105996114 13:25673678-25673700 CCTACGCACCAATAGCTGTTTGG - Intronic
1106368606 13:29108694-29108716 CCTGCCCACCAAATGCTGTGTGG - Intronic
1109548581 13:63861118-63861140 CCTACCCACCTGAAGTAGTTTGG + Intergenic
1109860523 13:68191928-68191950 CTTTCTCTCCAGAAGCTTTTAGG + Intergenic
1112241564 13:97687024-97687046 CGTTCCCACCTGCAGCTCTTTGG + Intergenic
1112508097 13:99987554-99987576 CCTTCCCCGCAGGAGCTGATCGG + Intergenic
1113539641 13:111096209-111096231 CCCCTCCACCAGAAGTTGTTTGG + Intergenic
1114779495 14:25522260-25522282 TCCTACCACCAGCAGCTGTTAGG + Intergenic
1116761605 14:49022057-49022079 CCTTCCCACCAGCTGCTACTTGG + Intergenic
1117971990 14:61260872-61260894 TCTTCCTACCAGAAGTTGTTTGG - Intronic
1118892426 14:69921343-69921365 CCTTCCCAGGGGAGGCTGTTAGG + Intronic
1119726452 14:76924541-76924563 TCTTTCCACCAAAAACTGTTTGG - Intergenic
1126388585 15:48120634-48120656 CCTTTCCCCTAGAAGTTGTTTGG - Intergenic
1127534644 15:59878828-59878850 CCTCCCCACCAGCAGCCCTTTGG + Intergenic
1128173696 15:65534648-65534670 TCTTTCCACCAGACTCTGTTAGG - Intronic
1129008089 15:72391348-72391370 CCTTGGCCCCACAAGCTGTTGGG + Intergenic
1129689048 15:77702908-77702930 CCTGCCCTCCAGGAGCTGCTGGG - Intronic
1133228895 16:4357029-4357051 CCTTCACACCAGAGCCTGGTGGG - Intronic
1133313613 16:4867908-4867930 CCTTCAGACCAGCAGCTCTTGGG + Intronic
1134336663 16:13305966-13305988 CCTGCCCTCCAGAAGCTCATGGG + Intergenic
1136714960 16:32271421-32271443 CCTTGCAACCAGAAGAGGTTAGG + Intergenic
1136752955 16:32658308-32658330 CCTTGCAACCAGAAGAGGTTAGG - Intergenic
1136815158 16:33212056-33212078 CCTTGCAACCAGAAGAGGTTAGG + Intronic
1136821634 16:33322136-33322158 CCTTGCAACCAGAAGAGGTTAGG + Intergenic
1136828197 16:33378675-33378697 CCTTGCAACCAGAAGAGGTTAGG + Intergenic
1136833263 16:33477446-33477468 CCTTGCAACCAGAAGAGGTTAGG + Intergenic
1138988855 16:62365655-62365677 CATTCCCAGCAGAAGTTGTCTGG + Intergenic
1139853367 16:69963435-69963457 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1139882336 16:70186344-70186366 CCTTCCTAGCAGAGGCTGCTGGG - Intronic
1140370173 16:74409160-74409182 CCTTCCTAGCAGAGGCTGCTGGG + Intronic
1141417015 16:83883515-83883537 CCTTCACACCATCATCTGTTTGG + Intergenic
1202993735 16_KI270728v1_random:35031-35053 CCTTGCAACCAGAAGAGGTTAGG + Intergenic
1203011653 16_KI270728v1_random:247074-247096 CCTTGCAACCAGAAGAGGTTAGG - Intergenic
1203055092 16_KI270728v1_random:918348-918370 CCTTGCAACCAGAAGAGGTTAGG - Intergenic
1143904479 17:10198266-10198288 CCTTCCCACCAGCCGCCGTCCGG + Exonic
1143947104 17:10603112-10603134 CCTTCCCACTAGACTCTGTGGGG - Intergenic
1147458041 17:40550771-40550793 TCTTCCCACCAGACCCTGCTGGG - Intergenic
1147894372 17:43740984-43741006 CCTTCCCAGCACTAGCTGCTGGG + Intergenic
1148458091 17:47821599-47821621 TCCTCCCACCTGAAGCTGGTGGG - Intronic
1148630043 17:49100350-49100372 CCTCCCCACCAGTAGGTGTGTGG + Intergenic
1150168695 17:62968494-62968516 CCTTACCTTGAGAAGCTGTTGGG + Intergenic
1153611200 18:6887042-6887064 CTTTACCACCAAAAGCTGTCAGG + Intronic
1154275965 18:12960612-12960634 CCTCCCCATAAGCAGCTGTTTGG - Intronic
1156516842 18:37687421-37687443 CCTGCTCTCCAGAAGCTGTAGGG - Intergenic
1157695173 18:49716679-49716701 CCTTCCCAAGGGAAGCTGTGAGG - Intergenic
1157949891 18:52024336-52024358 TCTTCCCACCCGCAGCTATTTGG - Intergenic
1158187952 18:54792707-54792729 CCTTAACACCAGAGACTGTTAGG - Intronic
1159386759 18:67735750-67735772 ACTTCCTCCCAGCAGCTGTTGGG - Intergenic
1162202672 19:9032468-9032490 GCTCCCCAGCAGAAGCTGTATGG + Intergenic
1167133057 19:47600330-47600352 CCTGCCTCCCAGAAGCTGTCAGG + Intergenic
925812948 2:7718962-7718984 CCTTCCCATCAGAAGCTAACAGG - Intergenic
926704199 2:15825351-15825373 CCTTCCCACCAGGAGCTAGAGGG - Intergenic
926985027 2:18613162-18613184 CCTTCCCACCAGCACCTTCTAGG - Intergenic
929217547 2:39431608-39431630 CCTCCCCACCAATATCTGTTTGG - Intronic
935102455 2:100009912-100009934 CTTTCCCAGCAGAAGCAGGTGGG + Intronic
938870105 2:135466547-135466569 ACTTGCCACTAAAAGCTGTTTGG + Intronic
938962280 2:136354583-136354605 TCTACCCACAAGCAGCTGTTGGG - Intergenic
939615402 2:144356540-144356562 ACTTCCCAGCAGAAGCTTTAAGG + Intergenic
940928065 2:159390592-159390614 CCTTCCCTCCAGCAGCAGTCAGG - Intronic
942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG + Intergenic
945579359 2:211573261-211573283 CATTCCCTCCAGAAGCTCTAGGG - Intronic
947192682 2:227524929-227524951 CATCCCCAGCAAAAGCTGTTGGG - Intronic
947339596 2:229123629-229123651 CCTTCCCACCAGCAGTGTTTGGG + Intronic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947697074 2:232200386-232200408 CATTCCCACCAGAAGGAATTTGG + Intronic
948590073 2:239043616-239043638 CCTTCCCACCTGGAGCTTGTAGG + Intergenic
1170701140 20:18704682-18704704 TCTACCCACTAGAAGCTGGTAGG - Intronic
1172151954 20:32796929-32796951 CCTTCCCAACAGCACCTGTGTGG + Intronic
1174453447 20:50633640-50633662 CCTTCCCATCAGAAGCCTTCTGG + Intronic
1175433243 20:58922181-58922203 CCTTTGCTCCAGGAGCTGTTTGG - Intergenic
1180109261 21:45640442-45640464 ACTGCCCACCAAAAGCTGCTGGG - Intergenic
1181176092 22:21036972-21036994 CCTTGTCACCAGAAACTGTAGGG - Intergenic
1183617401 22:38954023-38954045 CTTTGCCACCAGAAGGAGTTGGG - Intronic
1184107111 22:42374314-42374336 CGTTCCCTCCAGAAGCTTTGAGG + Intergenic
949554876 3:5144202-5144224 CATTCCCAGCAGTGGCTGTTGGG + Intronic
952354174 3:32570083-32570105 CCTTCCCAGGGGAAGCTGTCAGG + Intronic
952530874 3:34260509-34260531 CCTTCCCATAAGGAGGTGTTAGG + Intergenic
952611750 3:35217931-35217953 ACTTTCCACCATAAGCTATTGGG - Intergenic
954466291 3:50656997-50657019 ACTTCCCACCTGAAGCTGGGAGG + Intergenic
955140092 3:56260279-56260301 GCTTCCCATAAGAAGATGTTTGG - Intronic
961447100 3:126985960-126985982 CCTTCCCAGCAGACTTTGTTGGG + Intergenic
964662134 3:159131754-159131776 CCTTCCCACCTGTACCAGTTGGG - Intronic
969071270 4:4541632-4541654 CCTTCCCCCAAAAAGCTGTAGGG + Intronic
973861148 4:55066257-55066279 ACGTCCCACCAGGAGCTGTGTGG - Intergenic
974014209 4:56634254-56634276 CCTTCCCACCTGACTGTGTTAGG - Intergenic
974624038 4:64399539-64399561 CCCTCCCACCAGAAGCCCTGAGG + Intronic
978382535 4:108144657-108144679 CCTGCCCTCCAGCAGCTGTGTGG - Intronic
982949235 4:161668381-161668403 CCTTCCCAACAGAAACTATCAGG + Intronic
984993973 4:185409923-185409945 CCTTCCCTCCATAGGCTCTTGGG - Intronic
986895605 5:12362975-12362997 CCTTCCCACACGAAACTTTTAGG + Intergenic
987304651 5:16625814-16625836 CCTCCCCAAAAGAAGCTGTGAGG - Intergenic
992591799 5:78303352-78303374 CCCTCCCTCCAGAAGCTCTAGGG + Intergenic
995804805 5:116039170-116039192 CCTTCCCACCAAACCCTGTTCGG - Intronic
996354612 5:122581831-122581853 CCTTCCAGACAGAAGCTGCTGGG - Intergenic
997361153 5:133295846-133295868 TCTTCCCATCAGAGGCTCTTAGG + Intronic
998678048 5:144432089-144432111 CCTTGCAAACAGATGCTGTTTGG + Intronic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1003514086 6:6804093-6804115 CCATCTCCCCAGAAGCTTTTTGG + Intergenic
1006983535 6:38163475-38163497 GCTGGCCTCCAGAAGCTGTTGGG - Intergenic
1007591014 6:43021008-43021030 CCTTCCCAGCAGAACCTGGCTGG - Exonic
1007819832 6:44553078-44553100 CCTCCACACCCGAAGCTGCTCGG + Intergenic
1009048491 6:58254210-58254232 CCTTCCCACCACCAGGTATTAGG - Intergenic
1010184112 6:73123004-73123026 CTTTCCCATCAGAAGTTCTTAGG - Intronic
1010897192 6:81378852-81378874 CCTTCCCTGTAGAAGCTTTTGGG + Intergenic
1011464699 6:87643277-87643299 CGTTCCCAACAGAAGCTCTGGGG - Intronic
1011599651 6:89048238-89048260 ACTCCCCATCAGAACCTGTTTGG - Intergenic
1015226349 6:130861530-130861552 GCTTGTCACCAGAAGCTGTTGGG - Intronic
1017564196 6:155666778-155666800 CCTTCCTATCAGCATCTGTTGGG + Intergenic
1018451655 6:163914084-163914106 GCATCCCAACAGAAGCTGTGAGG - Intergenic
1018622140 6:165739992-165740014 CATTCCCACCAGTAGCAGATAGG - Intronic
1019333867 7:473500-473522 CCTGCCCACAAGAAGCTCTGAGG + Intergenic
1019660531 7:2221382-2221404 CGTTCCCTCCAGAAGCAGATAGG + Intronic
1019788001 7:2991500-2991522 CCTTCCCACCAGAAGCTGTTGGG - Intronic
1020664356 7:11020809-11020831 CCTACTCAACAGAAGCTTTTAGG + Intronic
1021203350 7:17751485-17751507 GCTTCTCAGCAGCAGCTGTTTGG + Intergenic
1023353047 7:39339507-39339529 CCTTGCCCCCTGAAGCTCTTTGG - Intronic
1023924132 7:44652846-44652868 CCCTCCTACCAGAAGACGTTGGG - Intronic
1024396895 7:48879863-48879885 CCTAGCCCCCAGAAGTTGTTTGG + Intergenic
1026306793 7:69149395-69149417 CCTTCTCACCCCAAGCTGGTTGG + Intergenic
1032604132 7:133330685-133330707 CCTACCCAACAGAAGCTGTGAGG - Intronic
1034163237 7:149007416-149007438 GCTTCCCACCAGGAGCTGTGGGG + Intronic
1036026402 8:4913796-4913818 CCTTCCCACCAGACTCTTTGGGG + Intronic
1036239501 8:7070187-7070209 CCTTCTGACCAGAGGCTCTTTGG - Intergenic
1045692813 8:104776961-104776983 TCTTCTCACCAGAAGGTGTCAGG - Intronic
1047379765 8:124348850-124348872 CCTCCCCACTAGAAGAGGTTTGG + Intronic
1048921917 8:139239272-139239294 CCTGCCCACAAGCAGCTCTTGGG + Intergenic
1049622386 8:143604569-143604591 CCTCACCTCCAGAGGCTGTTGGG + Exonic
1050085364 9:1959599-1959621 CCTTTACAGCAGCAGCTGTTTGG - Intergenic
1051252963 9:15180756-15180778 CCTTCCCACCTTGAACTGTTAGG - Intronic
1051937502 9:22460676-22460698 AATTCCCACCAGCAGGTGTTTGG - Intergenic
1053242122 9:36504589-36504611 CCCTCCCTGCAGAGGCTGTTGGG + Intergenic
1053281259 9:36820956-36820978 CCATCCCACCAGAAGCTAGAGGG + Intergenic
1055080087 9:72260123-72260145 CCTTCCATCCAGAAGCTTCTTGG - Intergenic
1056748146 9:89323070-89323092 CTTTCCCACCAAAACCTGTACGG - Intronic
1057537418 9:95926122-95926144 CATTCCCACCAGCAGCAGATGGG - Intronic
1058175114 9:101726424-101726446 CTGTACCACCAGAAGGTGTTTGG - Intronic
1185923188 X:4116719-4116741 CCTTCCCTCCAGAAGTCTTTAGG - Intergenic
1186435430 X:9538955-9538977 CCTTGCCAGCAAAAGCTGCTGGG + Intronic
1186985185 X:15005177-15005199 CCTTCTCAGCAGAAGCTTATAGG + Intergenic
1187965537 X:24607747-24607769 CCTACCAACAAGTAGCTGTTGGG + Exonic
1190642258 X:52492293-52492315 CCTTCCCATCAAGAGCTGTTTGG + Intergenic
1190645415 X:52520574-52520596 CCTTCCCATCAAGAGCTGTTTGG - Intronic
1190682704 X:52841728-52841750 CCTTCTCATCAAGAGCTGTTTGG - Intergenic
1190953131 X:55165441-55165463 CCTTCTCATCAAGAGCTGTTTGG + Intronic
1193268904 X:79506705-79506727 CATGCACACCTGAAGCTGTTGGG - Intergenic
1195207971 X:102623225-102623247 CCTTCACACCAGAAGAGATTGGG - Intergenic
1195733018 X:107984553-107984575 CCCTACCACAAGAAGCTGTGAGG - Intergenic
1198470050 X:136937919-136937941 ACTTCCCACCTCAAGCTGATTGG + Intergenic