ID: 1019788487

View in Genome Browser
Species Human (GRCh38)
Location 7:2994865-2994887
Sequence TGCCATGAACATAAGGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019788487_1019788491 1 Left 1019788487 7:2994865-2994887 CCCACGCCCTTATGTTCATGGCA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1019788491 7:2994889-2994911 CGCTAGTCACAAAGCGAAGATGG 0: 1
1: 0
2: 0
3: 2
4: 35
1019788487_1019788493 26 Left 1019788487 7:2994865-2994887 CCCACGCCCTTATGTTCATGGCA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1019788493 7:2994914-2994936 TCAATCTAGGTGCCCATCAACGG 0: 35
1: 284
2: 933
3: 2192
4: 3092
1019788487_1019788494 29 Left 1019788487 7:2994865-2994887 CCCACGCCCTTATGTTCATGGCA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1019788494 7:2994917-2994939 ATCTAGGTGCCCATCAACGGTGG 0: 3
1: 55
2: 433
3: 1039
4: 1469
1019788487_1019788492 13 Left 1019788487 7:2994865-2994887 CCCACGCCCTTATGTTCATGGCA 0: 1
1: 0
2: 0
3: 6
4: 90
Right 1019788492 7:2994901-2994923 AGCGAAGATGGAATCAATCTAGG 0: 1
1: 0
2: 2
3: 14
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019788487 Original CRISPR TGCCATGAACATAAGGGCGT GGG (reversed) Intronic
901170584 1:7254072-7254094 TGACATGAGCATAAGGAAGTGGG + Intronic
902041384 1:13495040-13495062 AGCCATGGACACAAGGGGGTGGG + Intronic
907819792 1:57955941-57955963 TGCCAAGAAGATAAGGCAGTTGG + Intronic
909465306 1:75967239-75967261 TGCAATGAAGGTAAGGGGGTAGG - Intergenic
910673105 1:89792955-89792977 TGCAATGAACATGAGGGTGCAGG - Intronic
912677116 1:111693231-111693253 TGCCATAACCATAATGGGGTGGG + Intronic
919987257 1:202684585-202684607 TGCCATGAACATGGGGGTGCAGG + Intronic
920711102 1:208295851-208295873 CCCCATTAACATAAGGGCGAGGG - Intergenic
923426916 1:233879758-233879780 TGCAATGAACATATGGGTGCAGG + Intergenic
1067481159 10:46598361-46598383 TGCCATAAAAATCAGGTCGTTGG - Intergenic
1067613593 10:47743461-47743483 TGCCATAAAAATCAGGTCGTTGG + Intergenic
1070468303 10:76748566-76748588 TGCAATGAACATATGGGTGCAGG - Intergenic
1071629002 10:87203424-87203446 TGCCATAAAAATCAGGTCGTTGG + Intergenic
1072471463 10:95717820-95717842 TGCCATTAACATCAGAGCATGGG + Intronic
1084646514 11:70462002-70462024 TGCCAGGAACAAAATGGGGTGGG - Intergenic
1088689694 11:112315222-112315244 TGCCATGAACATAGAGGAGGAGG + Intergenic
1092084032 12:5741029-5741051 TGCCATGAACATAGGGCAGTAGG - Intronic
1092275194 12:7055504-7055526 TGAAATGAACATGAGGGTGTGGG + Intronic
1093524275 12:20089597-20089619 TGCAATGAACATATGAGTGTAGG - Intergenic
1093748172 12:22766856-22766878 TGCAATTAATATAAGGGAGTGGG - Intergenic
1098451567 12:70624082-70624104 TACCCTGAACATAAGGTCGATGG + Intronic
1099362645 12:81724779-81724801 TGCAATAAACATAAGGGGGAAGG + Intronic
1105388218 13:19951927-19951949 TGCAATGAACATGAGAGTGTAGG - Intergenic
1105714589 13:23050043-23050065 TGCAATGAACATAAGAGTATGGG - Intergenic
1109443964 13:62408445-62408467 TGCAATGAACATGAGAGCGCAGG - Intergenic
1110236117 13:73219845-73219867 AGCTATGAACATAAGGGAGAAGG - Intergenic
1111161102 13:84395813-84395835 TGCAATAAACATAAGGGTATTGG - Intergenic
1112604983 13:100895710-100895732 TGCAATGAACACAACGGTGTGGG - Intergenic
1114506349 14:23217433-23217455 TGCCCTGAAGAGAAGGGCCTTGG + Intronic
1119937202 14:78602905-78602927 TGCCATGAACTGAAGGGCAGGGG - Intronic
1130726396 15:86443903-86443925 TGCAATAAACATAAGGGTGCAGG + Intronic
1131623549 15:94093589-94093611 TGCCATGAACACAGGAGTGTAGG + Intergenic
1131677257 15:94683073-94683095 TGTCATGAACACCATGGCGTAGG - Intergenic
1142114772 16:88350902-88350924 TTCCACGAACATCAGGGTGTTGG - Intergenic
1148717105 17:49723575-49723597 TGCCAAAAACATGAGGGCCTGGG + Intronic
1155897320 18:31346414-31346436 TGCCATGAACAAAAGAGAGCTGG - Intronic
1160278124 18:77458797-77458819 AGCCAAGAACAGAAGGGTGTGGG + Intergenic
1160513841 18:79467606-79467628 AGCCGTGAACATGAGCGCGTGGG + Intronic
925779554 2:7369838-7369860 GGCCAGGAACATAAGAGCTTTGG + Intergenic
927130782 2:20057610-20057632 TGCAATGAACATGAGGGTGCAGG - Intergenic
927220721 2:20706414-20706436 TGCCATGAACAAAATGGCTGAGG - Intronic
938337065 2:130509944-130509966 TGCCAGGAACATAAGGCTGTCGG - Intergenic
938352773 2:130610787-130610809 TGCCAGGAACATAAGGCTGTCGG + Intergenic
941674213 2:168326526-168326548 TGTCATGAACATATGGTCTTGGG - Intergenic
1183603206 22:38851981-38852003 TGCCATGCACAGAACGGTGTTGG + Intergenic
1184676594 22:46046296-46046318 TGCCATGAGGATAAGGGCTGAGG + Intergenic
1185353064 22:50348263-50348285 TGCCATGATCATATGGACATTGG + Intronic
953021946 3:39120241-39120263 TGCCATGAAGATCAGGGAGACGG + Intronic
956623701 3:71246346-71246368 TGCCATGAGCAAAAGGGCACAGG + Intronic
958058842 3:88450801-88450823 TGCAATGAACATAAGCAGGTAGG + Intergenic
963835645 3:150055637-150055659 TGCCATGTACACACAGGCGTGGG + Intergenic
965402386 3:168227506-168227528 TGCAATGAACATCAGAGCGTAGG + Intergenic
965442936 3:168738665-168738687 TGCCTTGAATAAAAGGGGGTAGG + Intergenic
971992725 4:33920877-33920899 TGCTATGAACATCAGTGTGTAGG + Intergenic
975226139 4:71874920-71874942 TGCCATAAACATATGAGTGTGGG + Intergenic
978839998 4:113200777-113200799 TGCAATAAACATAAGGGTGCAGG + Intronic
989151047 5:38300209-38300231 TTCCAGGAACATAAAGGCCTGGG + Intronic
990777502 5:59318943-59318965 TGCAATGAACAGAAGGGCTATGG - Intronic
990786812 5:59430343-59430365 ATCCATGAACATAAGCGCTTCGG + Intronic
995834917 5:116390434-116390456 TGCCATGAACTCAAGGTAGTAGG - Intronic
995976296 5:118039325-118039347 TGACATGAACAAAAGGCAGTTGG - Intergenic
996616691 5:125450539-125450561 AGCCATGAACATATGTGCGATGG - Intergenic
998270425 5:140701398-140701420 TGCCTTGTACATCAGGGAGTTGG + Intronic
1001364137 5:171120290-171120312 TGCCCTGAAAAGAAGGGCCTTGG - Intronic
1001575255 5:172759092-172759114 TGCCATGACTAGAAGGGAGTCGG - Intergenic
1003067946 6:2919361-2919383 TTCCAAGAACAGTAGGGCGTTGG + Intergenic
1008608637 6:53165645-53165667 TGCCATAAACATATGAGCGCAGG - Intergenic
1009653004 6:66500152-66500174 TGCAATGAACATGGGGGTGTAGG + Intergenic
1010772560 6:79848177-79848199 TGCCATGAAGGGAAGGGCCTTGG + Intergenic
1011708801 6:90030158-90030180 GGCCGTGGACATAAGGGGGTGGG - Intronic
1012021307 6:93924025-93924047 TGCCATGAAATTAGGGGAGTGGG + Intergenic
1017994903 6:159523500-159523522 TGCCATGACCTTAAGGGGGTGGG - Intergenic
1019788487 7:2994865-2994887 TGCCATGAACATAAGGGCGTGGG - Intronic
1021469616 7:20986366-20986388 GGCAATGAACTTAAGGGCCTTGG + Intergenic
1022450058 7:30505638-30505660 TTGAATGAACATAAGGGCATAGG + Intronic
1031471920 7:122176657-122176679 TGTCATTAACATCAGGGCATGGG - Intergenic
1031540934 7:122993641-122993663 TGCCTTGGAGATAAGGGCATGGG + Intergenic
1034755309 7:153612103-153612125 TGCAATGAACATAAGAGTGCAGG - Intergenic
1040651719 8:49456668-49456690 TGCCATGAACATAAGTAATTGGG + Intergenic
1043711018 8:83419320-83419342 TTCCAAGAACAAAAGGGCCTAGG + Intergenic
1044390674 8:91647057-91647079 TGCAATGAACATAAGAGTGCAGG + Intergenic
1045897501 8:107237120-107237142 TGCCATGAACTTAAGGTGGGTGG + Intergenic
1046002143 8:108434004-108434026 TGCAATGAACATAGGGGTGCAGG - Intronic
1046133846 8:110001107-110001129 TGCAATGAACATGGGGGTGTAGG + Intergenic
1046182140 8:110664430-110664452 TGCCATGAACACAGGGGTGCGGG + Intergenic
1046565836 8:115899934-115899956 TGCTATAAAAATAAGGGGGTGGG - Intergenic
1048905982 8:139089511-139089533 TGCCATAAACATGAGGGTGCAGG + Intergenic
1053002716 9:34586113-34586135 TGCTATGAACATCAGTGGGTGGG - Intronic
1054863295 9:69974780-69974802 GGCCATGGAAACAAGGGCGTAGG + Intergenic
1058425954 9:104875394-104875416 TGCCATGAACATAAGGGAAGTGG + Intronic
1192045954 X:67674575-67674597 TGCCATGAACATGGGGGTGGTGG - Intronic
1192065224 X:67877988-67878010 TGCAATGAACATAAGAGTGAAGG - Intergenic
1192283945 X:69713818-69713840 TGCCATGAACATTTGTGTGTAGG + Intronic
1193957857 X:87885340-87885362 TGCCATGAAGAGAAGGACATAGG - Intergenic
1194219548 X:91174780-91174802 TGCCTTGACAATAAGGGCCTTGG - Intergenic
1196577854 X:117341184-117341206 TGCAATAAACATAAAGGTGTAGG - Intergenic
1200556060 Y:4638544-4638566 TGCCTTGACAATAAGGGCCTTGG - Intergenic