ID: 1019788705

View in Genome Browser
Species Human (GRCh38)
Location 7:2996463-2996485
Sequence CACCAAAAGCTGCCACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019788699_1019788705 -10 Left 1019788699 7:2996450-2996472 CCAACCCCACCCACACCAAAAGC 0: 1
1: 0
2: 3
3: 74
4: 728
Right 1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG No data
1019788698_1019788705 -9 Left 1019788698 7:2996449-2996471 CCCAACCCCACCCACACCAAAAG 0: 1
1: 0
2: 4
3: 67
4: 782
Right 1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG No data
1019788696_1019788705 -7 Left 1019788696 7:2996447-2996469 CCCCCAACCCCACCCACACCAAA 0: 1
1: 1
2: 19
3: 171
4: 1496
Right 1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG No data
1019788694_1019788705 0 Left 1019788694 7:2996440-2996462 CCAGCTCCCCCCAACCCCACCCA 0: 1
1: 2
2: 23
3: 307
4: 2384
Right 1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG No data
1019788693_1019788705 5 Left 1019788693 7:2996435-2996457 CCTAGCCAGCTCCCCCCAACCCC 0: 1
1: 0
2: 11
3: 123
4: 938
Right 1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG No data
1019788695_1019788705 -6 Left 1019788695 7:2996446-2996468 CCCCCCAACCCCACCCACACCAA 0: 1
1: 1
2: 16
3: 244
4: 1762
Right 1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG No data
1019788697_1019788705 -8 Left 1019788697 7:2996448-2996470 CCCCAACCCCACCCACACCAAAA 0: 1
1: 1
2: 9
3: 149
4: 1213
Right 1019788705 7:2996463-2996485 CACCAAAAGCTGCCACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019788705 Original CRISPR CACCAAAAGCTGCCACTGCC TGG Intronic
No off target data available for this crispr