ID: 1019789398

View in Genome Browser
Species Human (GRCh38)
Location 7:3001072-3001094
Sequence AATTAATCACGGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019789398 Original CRISPR AATTAATCACGGCTGGAGCT GGG (reversed) Intronic
902178691 1:14670917-14670939 TAGTAATCACGGCTGGAGGGTGG + Intronic
902794654 1:18793303-18793325 ATTTAATCAAGGCTGGAGACAGG + Intergenic
910649142 1:89545973-89545995 AATTGATCATTGTTGGAGCTGGG + Intronic
915000304 1:152583441-152583463 AATTATTCACTTCTGAAGCTAGG + Intronic
915466182 1:156099406-156099428 AATTAATAAACGGTGGAGCTGGG - Intronic
920216174 1:204362873-204362895 AGTTACTCAGGGATGGAGCTGGG - Intronic
921183469 1:212650558-212650580 AATTAGTCACAGCTGGTGCCAGG - Intergenic
922892036 1:229068904-229068926 AATTCAGCAGTGCTGGAGCTGGG - Intergenic
922955977 1:229600647-229600669 AATTAAGTATGGCTGGAGTTAGG - Intronic
924515131 1:244759776-244759798 AATTAACCAGGACTGGAGGTGGG + Intergenic
1067893884 10:50159405-50159427 AATTGATCACAGCTGGTGCCAGG + Intergenic
1067954961 10:50780859-50780881 AATTGATCACAGCTGGTGCCAGG - Intronic
1068501847 10:57849193-57849215 AATAAAGCACTGCTGGAGATAGG - Intergenic
1068851440 10:61746470-61746492 AATCTATCATGGCTGGTGCTTGG + Intronic
1072092082 10:92138388-92138410 AATGAATCCTGGCTGGGGCTAGG - Intronic
1073078671 10:100842234-100842256 AATTGATAACCGTTGGAGCTGGG + Intergenic
1081614256 11:44581147-44581169 AATTAATCTAGGCTGGGCCTTGG + Intronic
1083438242 11:62657995-62658017 GATTAATGATGGTTGGAGCTGGG + Intronic
1093764062 12:22942527-22942549 AGTTGAGCAGGGCTGGAGCTAGG + Intergenic
1093764086 12:22942665-22942687 GATCAAGCAGGGCTGGAGCTCGG + Intergenic
1096463781 12:51837186-51837208 GCTTATTCACGGCTGGAGCTGGG - Intergenic
1098815045 12:75149114-75149136 AATTAATCAAGGCTGAATTTTGG + Intronic
1100026123 12:90130240-90130262 AATTTATCAGGGCTGGGCCTAGG - Intergenic
1104097108 12:125567896-125567918 TATTACTCAGCGCTGGAGCTGGG + Intronic
1107938133 13:45362122-45362144 AAGAAATCAGGGCTGGAGGTGGG - Intergenic
1111824444 13:93250523-93250545 AAGTGATCAAGGCTGGAGGTGGG - Intronic
1112790307 13:102995510-102995532 TTTTAGCCACGGCTGGAGCTGGG + Intergenic
1112835838 13:103513110-103513132 AAATCAGCACGTCTGGAGCTTGG + Intergenic
1113205467 13:107911082-107911104 AATTACTCACTCGTGGAGCTCGG + Intergenic
1115633942 14:35272697-35272719 AATTGATAATGGCTGAAGCTAGG + Intronic
1116657826 14:47674211-47674233 AATCAAAGACTGCTGGAGCTCGG + Intronic
1202872360 14_GL000225v1_random:176880-176902 AATTAAACACGTCTGAGGCTGGG - Intergenic
1124620534 15:31271527-31271549 ACTTAGCCACGGCTGGAGCATGG + Intergenic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135353565 16:21750757-21750779 AATTCATCACTCCTGGAACTTGG + Intronic
1135452053 16:22566884-22566906 AATTCATCACTCCTGGAACTTGG + Intergenic
1135842038 16:25885654-25885676 TATTAATCACAGCTGGTGCTTGG - Intronic
1137947560 16:52749506-52749528 AGTTAATCACCACTGGAACTAGG + Intergenic
1139931155 16:70527685-70527707 AATGAATCTCAGCTGGAGTTTGG + Intronic
1140552202 16:75878778-75878800 AATTAATCTGGGTTGGAGCTAGG - Intergenic
1141260446 16:82448840-82448862 CAGTAAGCACGGCTGGAGCAGGG - Intergenic
1143492305 17:7291629-7291651 AATCAATCAGAGCTGGGGCTGGG - Intronic
1146764728 17:35509062-35509084 AATTAAGTATGGCTGGAGTTAGG + Intronic
1148523983 17:48311896-48311918 TATTTATCATGGCTGGTGCTTGG - Intronic
1155481401 18:26291882-26291904 AATTAATCATTGTTGAAGCTGGG + Intronic
1157225694 18:45861878-45861900 AATTAATTACTGATGTAGCTGGG + Intronic
1165431228 19:35774622-35774644 AAAAAATCAAGGCTGGAGATTGG + Intronic
1167119411 19:47507713-47507735 CCTTAATCACGGCTGGCGCATGG + Intronic
925553035 2:5096657-5096679 AATTGCTCACATCTGGAGCTAGG - Intergenic
927577110 2:24209007-24209029 GCTTAAGCACGGCTGGAGATGGG + Intronic
929378512 2:41320669-41320691 AATTAAACATAGCTGAAGCTTGG + Intergenic
931269456 2:60688736-60688758 AATTAATCCAGTCTGCAGCTGGG + Intergenic
935223234 2:101032798-101032820 CATTAATCCCGGCTTGTGCTGGG + Intronic
935698768 2:105792330-105792352 AATTGATAACTGCTGAAGCTGGG - Intronic
936835601 2:116706014-116706036 AATTATTCAAGGCTTGAGTTAGG - Intergenic
937657437 2:124392592-124392614 AATTATTCAGAGCAGGAGCTAGG - Intronic
937780803 2:125834908-125834930 AATTAATCTCTGCTAGATCTGGG + Intergenic
939958163 2:148543843-148543865 GACTAATCAGGGCTGGAGGTGGG + Intergenic
940528504 2:154847818-154847840 TATTAATTACTGGTGGAGCTGGG + Intronic
941539721 2:166767109-166767131 AATTGCTCACTCCTGGAGCTCGG + Intergenic
944382704 2:199130093-199130115 AATTAAGCACGGCGGAAGCAAGG + Intergenic
946223259 2:218247216-218247238 AGTGGATCACGGCTGGAGCTTGG - Intronic
946398688 2:219456961-219456983 AATTAATCACTTCTGGGGCTAGG + Intronic
947228617 2:227863453-227863475 AATTAGTCACAGTTGGAGGTAGG + Intergenic
1173196670 20:40919695-40919717 TATTAATCACAGCTGTGGCTGGG + Intergenic
1177433590 21:21021691-21021713 AATTAAGTATGGCTTGAGCTTGG - Intronic
1183814035 22:40283925-40283947 AATTATTCACGACTGGTCCTTGG - Intronic
949327503 3:2882988-2883010 AATTCATGACTGCTGGAGATAGG + Intronic
949706669 3:6826357-6826379 ACTTAATAACCACTGGAGCTGGG - Intronic
949802609 3:7920254-7920276 AATTAATGCCGATTGGAGCTGGG + Intergenic
950061325 3:10073878-10073900 AGTTAATAAATGCTGGAGCTGGG + Intronic
950302382 3:11892097-11892119 AGTTAATAAATGCTGGAGCTGGG + Intergenic
958928050 3:100180051-100180073 TTTTAGTCACAGCTGGAGCTGGG + Intergenic
959358088 3:105357336-105357358 AATGAATAAAGGCTGGAGCAGGG + Intergenic
969126347 4:4951171-4951193 AATTAGTAAGGGCTGGCGCTGGG - Intergenic
974166987 4:58215972-58215994 AATTAGTCACAGCTGGTGCCAGG - Intergenic
980699256 4:136402367-136402389 AATTAACTAAGGCTAGAGCTAGG - Intergenic
983713094 4:170744008-170744030 AATTGGTCACAGCTGGAGCGAGG - Intergenic
984084527 4:175292454-175292476 AATTAGTCACAGCTGGACCAGGG - Intergenic
984176364 4:176423097-176423119 AATTAATAACAACTGGAGATTGG + Intergenic
986977163 5:13408360-13408382 AATTGATCACAGCTGGTGCCAGG - Intergenic
991164870 5:63554022-63554044 AATTAATCACAGCTGGCACCAGG + Intergenic
991987645 5:72306875-72306897 AATTGATAATTGCTGGAGCTGGG + Intronic
995818956 5:116205050-116205072 AATAAAGAGCGGCTGGAGCTTGG - Intronic
996436925 5:123444182-123444204 CATTACTCATGGCTGGATCTGGG + Intergenic
997789313 5:136743039-136743061 TTTTAGTCACAGCTGGAGCTGGG - Intergenic
998305250 5:141069756-141069778 AAGTAATCATGGCTGAAGCAGGG + Intergenic
999446214 5:151641779-151641801 AATCGATCACTGCTGAAGCTAGG + Intergenic
1014215334 6:118747360-118747382 AATAACTCAAGGCTGGAGCCAGG + Intergenic
1018229094 6:161658615-161658637 AATTTATCAGAGGTGGAGCTTGG + Intronic
1019789398 7:3001072-3001094 AATTAATCACGGCTGGAGCTGGG - Intronic
1026046123 7:66906253-66906275 AATTTATTAAGGCAGGAGCTGGG - Intergenic
1028316567 7:89409559-89409581 AATTATTCACACCTTGAGCTGGG - Intergenic
1030285916 7:107826634-107826656 GAGTAATCACACCTGGAGCTGGG + Intergenic
1030740166 7:113100141-113100163 AGTTAAGCAGGGTTGGAGCTGGG + Intergenic
1032631860 7:133661902-133661924 AATTAAGAAAGGCTGGAGCTAGG + Intronic
1044261724 8:90132564-90132586 AATTTGTCACGGCTGGAGTTAGG - Intergenic
1044347785 8:91126201-91126223 GATTGATCAGGGCTGGAGTTGGG + Intronic
1044359037 8:91259838-91259860 AATTAATCTAGGGTGGAGATTGG - Intronic
1050108201 9:2187314-2187336 TATCAGTCACGGCTGGAACTAGG - Intronic
1050204844 9:3185824-3185846 AATTGATCACAGCTGGCGCCAGG + Intergenic
1050639687 9:7654230-7654252 AGTTAATCACTGCTAGAGCACGG - Intergenic
1056370836 9:85952706-85952728 GATTAATCAGGGCTGGTACTAGG + Intronic
1059269488 9:113062889-113062911 AAGAAATCACCGCTGGAACTGGG + Intergenic
1059270620 9:113068336-113068358 AAGAAATCACCGCTGGAACTGGG + Intergenic
1059271755 9:113073783-113073805 AAGAAATCACCGCTGGAACTGGG + Intergenic
1059272889 9:113079230-113079252 AAGAAATCACCGCTGGAACTGGG + Intergenic
1059274024 9:113084672-113084694 AAGAAATCACCGCTGGAACTGGG + Intergenic
1059275157 9:113090116-113090138 AAGAAATCACCGCTGGAACTGGG + Intergenic
1203732094 Un_GL000216v2:99663-99685 AATTAAACACGTCTGAGGCTGGG + Intergenic
1186346224 X:8695959-8695981 AATTAATCTCGGCTTCATCTTGG - Intronic
1189239229 X:39512845-39512867 TATTAATCAGGGCTGGGACTAGG - Intergenic
1190946227 X:55096500-55096522 AATTACTGAGGGCTGGAGGTAGG - Intronic
1193066621 X:77267307-77267329 AATTGGTCACAGCTGGAGCCAGG + Intergenic
1201561895 Y:15326513-15326535 TTTTAATCATGGCTGGAGATGGG + Intergenic