ID: 1019794563

View in Genome Browser
Species Human (GRCh38)
Location 7:3040281-3040303
Sequence CCTGCAAAGCAGATAGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019794556_1019794563 12 Left 1019794556 7:3040246-3040268 CCAACCCAAAAGACGGAATGCTG 0: 1
1: 0
2: 1
3: 3
4: 87
Right 1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1019794552_1019794563 30 Left 1019794552 7:3040228-3040250 CCCATGCCTTCATGGGCTCCAAC 0: 1
1: 0
2: 1
3: 13
4: 172
Right 1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1019794554_1019794563 24 Left 1019794554 7:3040234-3040256 CCTTCATGGGCTCCAACCCAAAA 0: 1
1: 0
2: 1
3: 6
4: 143
Right 1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1019794559_1019794563 7 Left 1019794559 7:3040251-3040273 CCAAAAGACGGAATGCTGCTGGA 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1019794553_1019794563 29 Left 1019794553 7:3040229-3040251 CCATGCCTTCATGGGCTCCAACC 0: 1
1: 0
2: 1
3: 21
4: 359
Right 1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 175
1019794557_1019794563 8 Left 1019794557 7:3040250-3040272 CCCAAAAGACGGAATGCTGCTGG 0: 1
1: 0
2: 1
3: 6
4: 93
Right 1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019794563 Original CRISPR CCTGCAAAGCAGATAGTGCA GGG Intronic
900189606 1:1347834-1347856 CAGGCAAAGCAGAGAGGGCAGGG - Intronic
900974618 1:6009225-6009247 TCTGGAAAGCAGATACTCCAAGG - Intronic
901025626 1:6277372-6277394 CCTTCAAAGCTGATAGTGGGGGG - Intronic
901151494 1:7106208-7106230 CCTGCAAAGTAGGTAATGCCTGG + Intronic
901646898 1:10721707-10721729 CCTGCAAACCAGGAAGTGGACGG + Intronic
902300091 1:15495437-15495459 CCTGCAGAGCAGAAAGACCATGG - Exonic
902301249 1:15504422-15504444 TCTACAAAGCAGACAGAGCAGGG + Intronic
903839029 1:26225310-26225332 CCTGCAAAGCAGTTCCTGCCGGG + Intergenic
904240872 1:29144297-29144319 CCTGTGAACCAGATAGTGCTTGG - Intergenic
905852057 1:41281841-41281863 CCTGCATTGCAGCTAGTTCAGGG + Intergenic
908188970 1:61680956-61680978 CCTTCAAAGCAGTTAATCCATGG - Intergenic
908513776 1:64871850-64871872 CGTGGAAAGCAGATTGTGCTGGG - Intronic
911783386 1:101912260-101912282 TGTGCAAAGCTGAAAGTGCAAGG + Intronic
914825403 1:151135544-151135566 CCTGCAAAGCAGGGAGGGGATGG - Intronic
915138304 1:153749565-153749587 ACTGCACAGCAGACAGGGCAGGG - Intronic
922121483 1:222673791-222673813 CCTGCAAACTAGGTAGGGCACGG + Intronic
1066312719 10:34213285-34213307 CCAGCAAAGCAGATTGTTAAAGG - Intronic
1067277145 10:44845970-44845992 CCTGGTAAGCAGACAGTGCCAGG - Intergenic
1067297113 10:44980969-44980991 CCTTTTTAGCAGATAGTGCAAGG + Intronic
1071606728 10:86998822-86998844 CCTGCGAGGCAGAGGGTGCAGGG + Intergenic
1073605699 10:104893698-104893720 CATGCAGAGCAGATACGGCAAGG - Intronic
1075736101 10:124665464-124665486 CCTGCAAAGGAGCCAGTGCTAGG + Intronic
1076482417 10:130793187-130793209 CCTGCACTGCAGACTGTGCAGGG - Intergenic
1076513037 10:131025685-131025707 CCCTCAAAGCAGAGAGGGCACGG + Intergenic
1076726431 10:132416269-132416291 CCTGCAGAGCCGAGGGTGCACGG - Intronic
1077935927 11:6785525-6785547 CCTGCAGAAGGGATAGTGCATGG - Exonic
1078361165 11:10668964-10668986 GCTGCAAAGCACAGAGTGCTGGG - Intronic
1079347450 11:19665364-19665386 GCTGAGAAGCAGATGGTGCATGG + Intronic
1080929460 11:36793470-36793492 CTTGCAAATCATAAAGTGCAAGG + Intergenic
1083930880 11:65844210-65844232 ACTGGAAATCAGATAGTGCAAGG - Intronic
1087891887 11:103544954-103544976 CATGAAGTGCAGATAGTGCATGG - Intergenic
1087898206 11:103611141-103611163 CCTGCAATGCAGGTAAAGCAAGG - Intergenic
1090351975 11:126113587-126113609 CCAGCAACCCAGAGAGTGCAGGG - Intergenic
1090491046 11:127161265-127161287 CCTGCAAACCAGAGAGTTAAGGG - Intergenic
1096080101 12:48827467-48827489 CCGGTAAAGGAAATAGTGCAAGG - Intronic
1097024713 12:56046293-56046315 ACTGCAGAGCAGATGGTGAAGGG + Intergenic
1098153354 12:67571556-67571578 TCTGCAAAGGAGATAGGGCAGGG + Intergenic
1098877392 12:75880652-75880674 CCTAAAAAGCAGACAGTTCATGG + Intergenic
1099854478 12:88146141-88146163 CCTGCAAAGTAGAGGTTGCAGGG - Intronic
1100206948 12:92360523-92360545 CCTGCAGAGCAGCTAGAGAAAGG + Intergenic
1105070972 12:133234452-133234474 TCTGCAAAGCAGGTGATGCACGG + Exonic
1105662959 13:22519627-22519649 TCTGTTAAGCAGATAGTGTAAGG - Intergenic
1106219105 13:27730177-27730199 CCTACACACCAGATAGTTCAAGG - Intergenic
1107185437 13:37513744-37513766 CCTGCCATGCAGAAAGTGTAAGG - Intergenic
1108505806 13:51111298-51111320 CCTGGAAGGCAGATGGTGCGAGG - Intergenic
1109890745 13:68609769-68609791 CCTGCAAAGGAGACAGTCAATGG - Intergenic
1110518823 13:76449852-76449874 ACTGCAAAGGATATAGTGAAAGG - Intergenic
1110946533 13:81427569-81427591 CCTACAAAGCAAATGATGCAGGG + Intergenic
1113433105 13:110267221-110267243 CCTGGACACCAGATAGTGCGAGG - Intronic
1113472853 13:110559102-110559124 CCTGCAAGGCAGGCAGTGGATGG - Intronic
1117673444 14:58131599-58131621 CCTCCAAAGCAGGAAGTGCAGGG + Exonic
1124973927 15:34516091-34516113 ACTGCAAAGCTGATAGTGCCTGG - Intergenic
1126254291 15:46607116-46607138 CCTGCAAGGCAAATATCGCAAGG + Intergenic
1126321001 15:47423223-47423245 TGTGCAAAGCAGGTAGTGCTTGG - Intronic
1127215943 15:56823143-56823165 CCTGGAAGGGAGATAGTACATGG - Intronic
1127526205 15:59794186-59794208 CCTGCAAAGTAGATGGTGACAGG + Intergenic
1127762527 15:62152764-62152786 CCTGCAACCCAGGTTGTGCAAGG - Intergenic
1130240825 15:82188603-82188625 CCTGGAAAGTAGATAGAGTAGGG - Intronic
1130388589 15:83434778-83434800 CCTGCAAAGGAGAAAATTCAGGG + Intergenic
1132827730 16:1913471-1913493 CCTGCCAGCCAGGTAGTGCAGGG + Intronic
1132863391 16:2082333-2082355 CCTGCAGAGGAGAGAGGGCAGGG - Intronic
1134249328 16:12563421-12563443 CCTGCAAAGGACATACCGCAAGG - Intronic
1135555712 16:23434887-23434909 CGTGAAAACCAGATACTGCAAGG + Intronic
1135693333 16:24563700-24563722 CCTGCAAACTAGATAATGGAAGG + Intronic
1135809725 16:25576310-25576332 CTTGCAATGCAGGTCGTGCAGGG + Intergenic
1137942028 16:52697643-52697665 CATGCAAAGCACTTAGTGCAGGG - Intergenic
1138181626 16:54944509-54944531 CCTGCAAAGAAGAAAGAACAGGG - Intergenic
1140297327 16:73721599-73721621 GCTGAAGAGCAGATGGTGCATGG - Intergenic
1140506556 16:75477291-75477313 CCTGCAAAGCAAGCAGGGCAAGG - Exonic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1144004563 17:11088556-11088578 CCTGCAGAGCAGGTAATGGATGG + Intergenic
1144521161 17:15953100-15953122 CCTGCAGAGCTGGGAGTGCAGGG + Intronic
1145390159 17:22449397-22449419 CTTGAAAAGCAGGTAGTGGAGGG + Intergenic
1145987586 17:29057595-29057617 CTTCCAAAGCAATTAGTGCAAGG - Intergenic
1146055147 17:29577247-29577269 CCTGCAAGGCAGAAAGGGCCAGG + Exonic
1152309284 17:79539544-79539566 CCAGGAAAACACATAGTGCATGG + Intergenic
1152407287 17:80104920-80104942 CCTGCAAAGCAGGGGCTGCAGGG + Intergenic
1152689189 17:81710239-81710261 GCTCCAAAGCAGAAAGAGCAGGG - Intergenic
1156364899 18:36416716-36416738 CCTGCAAAGCATATGGAGGAAGG - Intronic
1164404042 19:27926108-27926130 CCTGCATAGCAGAGAGTTCTTGG + Intergenic
1164456270 19:28409919-28409941 TCAGCAAAGCTGAAAGTGCAAGG - Intergenic
1165094851 19:33404586-33404608 CCAGCAAAGCAGAAAGACCATGG + Intronic
1167767464 19:51493016-51493038 CCTGCACAGCAGATGCTCCATGG + Intronic
925994506 2:9280898-9280920 CCTGCAAATCAGAGAGTTCTGGG + Intronic
927346990 2:22056507-22056529 CCTGCAGAGCAGATAATGGCTGG + Intergenic
930238915 2:48915804-48915826 ACTGTAAAGCAGATGGGGCAGGG - Intergenic
932449442 2:71800235-71800257 CCTGCAGAGCCCATACTGCAGGG + Intergenic
933633269 2:84680522-84680544 CCTGCCAAGCAGAGAGGGCTGGG + Intronic
936099663 2:109564425-109564447 CCTGTAAAGCTCATAGTGCCTGG + Exonic
937064889 2:119010480-119010502 CCTGCAAGGTAGATACTACAAGG + Intergenic
943013543 2:182481772-182481794 CCTGCAGAGCAGATGGCACATGG + Intronic
943618525 2:190120830-190120852 CATGCAAAGCAGAGATTGCTTGG + Intronic
944861973 2:203823776-203823798 CATGCAAAGCACTTAGTGCATGG - Intergenic
945201399 2:207285317-207285339 CTTACAAAGCAATTAGTGCAGGG - Intergenic
945346067 2:208718222-208718244 TCTCCAAAGCATAAAGTGCAAGG - Intronic
946305340 2:218853859-218853881 GCTGCAAAGGAGATAGAGGAGGG - Intergenic
948463768 2:238142626-238142648 CCTGAAAGGCACATGGTGCAAGG + Intronic
1173877463 20:46383337-46383359 TCTGCATAGCAAAGAGTGCATGG + Intronic
1176181963 20:63753686-63753708 CCTGCACAGCAGCAAGTACATGG - Intronic
1178548009 21:33510022-33510044 CCTGAAAATAAGATAATGCAAGG + Intronic
1178722112 21:35019196-35019218 CCTGCAAGGCAGGAAGTGCCAGG - Intronic
1180183049 21:46126530-46126552 CCTGCCAAACAGGTAATGCAGGG + Exonic
1181558459 22:23685604-23685626 ACTGCTAAGCAGATACTTCAGGG + Intergenic
1182480509 22:30605892-30605914 ATTGCAATGCAGATTGTGCATGG + Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1183786516 22:40032068-40032090 CCTGCACAGCAGCTTCTGCAAGG + Exonic
1184817205 22:46881357-46881379 CCTGCAGAACAGATAGTAGAAGG + Intronic
949651013 3:6159490-6159512 GCTGAAAAGCAGATCGTGAAGGG - Intergenic
950354519 3:12395045-12395067 CCTTCAAAGCTGTGAGTGCATGG - Intronic
950392227 3:12705653-12705675 CCTGCAAAGGAGACAGAGAAGGG + Intergenic
951988350 3:28646610-28646632 CCGGAAAAGCTGAGAGTGCAAGG - Intergenic
952353894 3:32567128-32567150 CCTGCAAGGGAGAGAGTGCCAGG - Intronic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
953551028 3:43903137-43903159 CCTGCAAAGCAAAAGGGGCATGG + Intergenic
953575651 3:44111255-44111277 CCTGCAAAGCAGGGGGTGTAAGG - Intergenic
954453624 3:50585269-50585291 CCTGCAACCCAGAGAGTACAGGG - Intergenic
959827497 3:110816001-110816023 CCTGCAAAACAGAAAATGTAGGG + Intergenic
966871519 3:184292909-184292931 GCAGGAAAGCAGATAGAGCAGGG + Exonic
967758950 3:193202506-193202528 CTTGTAAAACAAATAGTGCAGGG + Intergenic
970289391 4:14554893-14554915 CCTGTAAAGCAGAAAGGGGAGGG + Intergenic
971255157 4:25007831-25007853 CCTGCAAAGGAGGAAGTGCATGG + Intronic
973196599 4:47450246-47450268 CTTGTAAAGGAGATACTGCATGG + Intergenic
974125076 4:57686111-57686133 CCAGATAAGCAGATAGTGCAGGG - Intergenic
976077394 4:81315116-81315138 CCTGCAAAACAGATAGATTAGGG - Intergenic
979952536 4:126911670-126911692 CCTTCCAAACAGAAAGTGCAAGG + Intergenic
980738748 4:136923655-136923677 TCCACAAAGAAGATAGTGCAAGG + Intergenic
982138437 4:152295015-152295037 ACAGCAAAGCAGATAGGGGAGGG - Intergenic
982857746 4:160406709-160406731 CCTGCAAAGGAGAAAGTGTAGGG + Intergenic
982899596 4:160981351-160981373 CCTGGAAAGCAATTAGTGCTGGG - Intergenic
984137794 4:175962538-175962560 GCTGCAGAGCAGAGAGTACAGGG - Intronic
985323486 4:188740596-188740618 CCAGGAAAGCTGATGGTGCAAGG + Intergenic
985691118 5:1313158-1313180 CTTGCAGAGCTGATTGTGCAGGG - Intergenic
986104843 5:4649937-4649959 TCTGCATGGCAGATGGTGCAGGG - Intergenic
986274836 5:6264646-6264668 TCTGCAAGGCAGGAAGTGCAGGG + Intergenic
990346840 5:54880045-54880067 TCTGCAAAGCAGGAAGTCCAGGG - Intergenic
991342059 5:65622437-65622459 CCTGTAAAGCACAAAGTGCCTGG - Intronic
991642018 5:68764394-68764416 CCTGCACAGAAGATAGTACAGGG + Intergenic
992257142 5:74932550-74932572 CCTGCACAGCTGAAAGTGGAGGG - Intergenic
999065415 5:148680340-148680362 CCTGCAAAGGAGAAAGTTGAAGG - Intergenic
999116807 5:149171549-149171571 CCTGGAGAGCAGATAGGGTATGG - Intronic
1000617606 5:163446084-163446106 CCTGTAAAGTAGACACTGCAAGG + Intronic
1001421774 5:171593036-171593058 CCTGCCAAGCACACATTGCAAGG - Intergenic
1001894411 5:175365967-175365989 GCTGCACAGCAGAAAGTGAATGG + Intergenic
1002598353 5:180338946-180338968 TCTGCAAATCAGGGAGTGCATGG - Intronic
1002835061 6:858995-859017 ACTGCAAAGCAAATAGTCCATGG + Intergenic
1005354959 6:24973519-24973541 CCTGGAAGGCAGAGATTGCAGGG + Intronic
1007917532 6:45575100-45575122 CCTGAACAGCAGGTTGTGCAAGG - Intronic
1009318504 6:62255486-62255508 CCTGCTCTGCAGCTAGTGCATGG - Intronic
1011650876 6:89505082-89505104 CCTGCAGAGAAGAAAGGGCAAGG - Intronic
1011857737 6:91715846-91715868 TCTGTAAAGCAGATATTGTACGG - Intergenic
1012003124 6:93679611-93679633 CCTGCAATGTACATATTGCAGGG + Intergenic
1017312369 6:152988771-152988793 CCAGGAAAGCTGATGGTGCAAGG - Exonic
1019794563 7:3040281-3040303 CCTGCAAAGCAGATAGTGCAGGG + Intronic
1020830545 7:13089504-13089526 CCTGCCAGGCAGAAAGTGAAGGG + Intergenic
1021568478 7:22038717-22038739 CCTGAAAAGCAGAAGCTGCAGGG - Intergenic
1022037137 7:26545201-26545223 CCTCCAACCCAGATAGGGCAAGG + Intergenic
1022205285 7:28158037-28158059 CCTGCAGGGCACATTGTGCAGGG - Intronic
1024853708 7:53752098-53752120 ACTCCAAAACAGATAATGCAAGG - Intergenic
1025754308 7:64321345-64321367 CCTTCAAAGCAAAAGGTGCATGG - Intronic
1028188094 7:87813045-87813067 CATGCAAAGAAGATATTGTAAGG + Intronic
1028516566 7:91683873-91683895 CCTGCATGACAGATAGTGAAAGG + Intergenic
1031199381 7:118660368-118660390 TCTGGAATGCAGACAGTGCAAGG + Intergenic
1032582112 7:133113004-133113026 CCAGCAGAGTAGATAGTGAATGG - Intergenic
1032871647 7:135992049-135992071 CCTGCCCAGCAGACATTGCAAGG - Intergenic
1033452796 7:141476748-141476770 GCTGCAAAGCAGAAAGTGTGCGG - Exonic
1035938363 8:3868117-3868139 TCTGCCAAGCAGAAAGTGCTAGG - Intronic
1037842009 8:22251464-22251486 ACTGCAAAGGAAAGAGTGCAGGG - Exonic
1038128955 8:24707591-24707613 CCTGCAAAGGAGGTATTCCATGG - Intergenic
1038833820 8:31095791-31095813 CCTGGAAATCAGGTAGCGCAAGG + Intronic
1039561291 8:38514298-38514320 CCTGCTGAACAGATGGTGCAGGG + Intronic
1039736370 8:40337080-40337102 ACTGCAGAGCAAACAGTGCAGGG + Intergenic
1040481711 8:47832969-47832991 CCTGCAAAGCAGGGAGTCCAGGG + Intronic
1040523433 8:48197587-48197609 TGTGCAAAGCAGAGAGAGCAAGG + Intergenic
1041307457 8:56477223-56477245 CCTGTAAAGCTCATAGTGCCTGG + Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1045109834 8:98929824-98929846 CTTGAAAAGCAGAAAGTGCTTGG + Intronic
1049033774 8:140058626-140058648 CCTGCAAGACAGACAGTGGAAGG + Intronic
1057157879 9:92860077-92860099 CCTCCAGAGCTGATATTGCATGG + Intronic
1057821227 9:98332596-98332618 CCTCCAAAGCACACAGTGCAGGG + Intronic
1059116496 9:111604402-111604424 ACTGGAAAGCTGAAAGTGCAGGG - Intergenic
1059235903 9:112760542-112760564 CCTTCAATGCAGAGAGTGCTTGG + Intronic
1059370032 9:113822763-113822785 CCTGAAAACCAGAGAGTGAATGG - Intergenic
1061174664 9:128986864-128986886 CCTGCACAGCAGGTAATGAAGGG + Exonic
1061509565 9:131052338-131052360 CCTGCACAGCAGACCCTGCAGGG - Intronic
1061678811 9:132232561-132232583 CCTGCACTGCACAGAGTGCAGGG - Intronic
1185937844 X:4279178-4279200 TCTGCAGAGCAGATGGTCCATGG + Intergenic
1194767164 X:97855092-97855114 CCTGTAAATCAGATAGAGAAGGG + Intergenic
1197133778 X:123037000-123037022 CCTGCCAAGCAGAAAATGCAGGG - Intergenic
1198741138 X:139844413-139844435 CCTGCATTGCAGGTATTGCAGGG - Intronic
1201392289 Y:13512154-13512176 CCTGCAGAGAAGTTAGTGCTTGG - Intergenic