ID: 1019794953

View in Genome Browser
Species Human (GRCh38)
Location 7:3042808-3042830
Sequence CGGGGCTGCCCACACAAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019794953_1019794957 12 Left 1019794953 7:3042808-3042830 CCAAGTTTGTGTGGGCAGCCCCG No data
Right 1019794957 7:3042843-3042865 GAGACCACTGTCCATGAACCTGG 0: 1
1: 0
2: 3
3: 24
4: 193
1019794953_1019794958 13 Left 1019794953 7:3042808-3042830 CCAAGTTTGTGTGGGCAGCCCCG No data
Right 1019794958 7:3042844-3042866 AGACCACTGTCCATGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019794953 Original CRISPR CGGGGCTGCCCACACAAACT TGG (reversed) Intronic