ID: 1019795589

View in Genome Browser
Species Human (GRCh38)
Location 7:3045809-3045831
Sequence CTGTGGGTCTTGGTGTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019795589_1019795600 23 Left 1019795589 7:3045809-3045831 CCTTCTAACACCAAGACCCACAG No data
Right 1019795600 7:3045855-3045877 GATACATCTCACTGCCTACCTGG No data
1019795589_1019795596 1 Left 1019795589 7:3045809-3045831 CCTTCTAACACCAAGACCCACAG No data
Right 1019795596 7:3045833-3045855 CTTCTAGGCCTTGGTCCCTAAGG No data
1019795589_1019795592 -8 Left 1019795589 7:3045809-3045831 CCTTCTAACACCAAGACCCACAG No data
Right 1019795592 7:3045824-3045846 ACCCACAGCCTTCTAGGCCTTGG No data
1019795589_1019795601 24 Left 1019795589 7:3045809-3045831 CCTTCTAACACCAAGACCCACAG No data
Right 1019795601 7:3045856-3045878 ATACATCTCACTGCCTACCTGGG No data
1019795589_1019795602 29 Left 1019795589 7:3045809-3045831 CCTTCTAACACCAAGACCCACAG No data
Right 1019795602 7:3045861-3045883 TCTCACTGCCTACCTGGGACTGG No data
1019795589_1019795603 30 Left 1019795589 7:3045809-3045831 CCTTCTAACACCAAGACCCACAG No data
Right 1019795603 7:3045862-3045884 CTCACTGCCTACCTGGGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019795589 Original CRISPR CTGTGGGTCTTGGTGTTAGA AGG (reversed) Intergenic
No off target data available for this crispr