ID: 1019800840

View in Genome Browser
Species Human (GRCh38)
Location 7:3087270-3087292
Sequence ATGCTGTCATTGTCCTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019800839_1019800840 -2 Left 1019800839 7:3087249-3087271 CCTGTGGAATTCTCTCGGGTGAT No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data
1019800837_1019800840 0 Left 1019800837 7:3087247-3087269 CCCCTGTGGAATTCTCTCGGGTG No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data
1019800834_1019800840 4 Left 1019800834 7:3087243-3087265 CCTTCCCCTGTGGAATTCTCTCG No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data
1019800829_1019800840 15 Left 1019800829 7:3087232-3087254 CCAGCCCCACACCTTCCCCTGTG No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data
1019800838_1019800840 -1 Left 1019800838 7:3087248-3087270 CCCTGTGGAATTCTCTCGGGTGA No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data
1019800831_1019800840 11 Left 1019800831 7:3087236-3087258 CCCCACACCTTCCCCTGTGGAAT No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data
1019800832_1019800840 10 Left 1019800832 7:3087237-3087259 CCCACACCTTCCCCTGTGGAATT No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data
1019800828_1019800840 16 Left 1019800828 7:3087231-3087253 CCCAGCCCCACACCTTCCCCTGT No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data
1019800833_1019800840 9 Left 1019800833 7:3087238-3087260 CCACACCTTCCCCTGTGGAATTC No data
Right 1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019800840 Original CRISPR ATGCTGTCATTGTCCTACCC TGG Intergenic
No off target data available for this crispr