ID: 1019803436

View in Genome Browser
Species Human (GRCh38)
Location 7:3105254-3105276
Sequence CTGGGGCCAGAGAAGGGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019803436_1019803445 -6 Left 1019803436 7:3105254-3105276 CCAAGCCCCTTCTCTGGCCCCAG No data
Right 1019803445 7:3105271-3105293 CCCCAGGGGTCTGTGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019803436 Original CRISPR CTGGGGCCAGAGAAGGGGCT TGG (reversed) Intergenic
No off target data available for this crispr