ID: 1019803642

View in Genome Browser
Species Human (GRCh38)
Location 7:3106541-3106563
Sequence CATTCTAAGCAGAAAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019803642_1019803647 -3 Left 1019803642 7:3106541-3106563 CCCTCCCTTTTCTGCTTAGAATG No data
Right 1019803647 7:3106561-3106583 ATGAGAACACAGTGGCACAGTGG No data
1019803642_1019803648 1 Left 1019803642 7:3106541-3106563 CCCTCCCTTTTCTGCTTAGAATG No data
Right 1019803648 7:3106565-3106587 GAACACAGTGGCACAGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019803642 Original CRISPR CATTCTAAGCAGAAAAGGGA GGG (reversed) Intergenic
No off target data available for this crispr