ID: 1019803768

View in Genome Browser
Species Human (GRCh38)
Location 7:3107549-3107571
Sequence CCTGTGAAGAGGGAACAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019803762_1019803768 29 Left 1019803762 7:3107497-3107519 CCTTTGGTTACAAATGACCAGTC No data
Right 1019803768 7:3107549-3107571 CCTGTGAAGAGGGAACAGTGTGG No data
1019803764_1019803768 12 Left 1019803764 7:3107514-3107536 CCAGTCACATAGCTGGTCTAACA No data
Right 1019803768 7:3107549-3107571 CCTGTGAAGAGGGAACAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019803768 Original CRISPR CCTGTGAAGAGGGAACAGTG TGG Intergenic
No off target data available for this crispr