ID: 1019803771

View in Genome Browser
Species Human (GRCh38)
Location 7:3107586-3107608
Sequence CATTCTAAGCAGAAAAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019803771_1019803775 -7 Left 1019803771 7:3107586-3107608 CCCTCCCTTTTCTGCTTAGAATG No data
Right 1019803775 7:3107602-3107624 TAGAATGAGAACCCAGTGACTGG No data
1019803771_1019803777 -5 Left 1019803771 7:3107586-3107608 CCCTCCCTTTTCTGCTTAGAATG No data
Right 1019803777 7:3107604-3107626 GAATGAGAACCCAGTGACTGGGG No data
1019803771_1019803776 -6 Left 1019803771 7:3107586-3107608 CCCTCCCTTTTCTGCTTAGAATG No data
Right 1019803776 7:3107603-3107625 AGAATGAGAACCCAGTGACTGGG No data
1019803771_1019803780 23 Left 1019803771 7:3107586-3107608 CCCTCCCTTTTCTGCTTAGAATG No data
Right 1019803780 7:3107632-3107654 GCCATCACTCTGTGATCTTGAGG No data
1019803771_1019803782 24 Left 1019803771 7:3107586-3107608 CCCTCCCTTTTCTGCTTAGAATG No data
Right 1019803782 7:3107633-3107655 CCATCACTCTGTGATCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019803771 Original CRISPR CATTCTAAGCAGAAAAGGGA GGG (reversed) Intergenic
No off target data available for this crispr