ID: 1019804910

View in Genome Browser
Species Human (GRCh38)
Location 7:3116730-3116752
Sequence GCTGCAGGCCACTGCAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019804910_1019804918 2 Left 1019804910 7:3116730-3116752 CCCATTCTGCAGTGGCCTGCAGC No data
Right 1019804918 7:3116755-3116777 CACCTGGGGCACTGGCCTGCAGG No data
1019804910_1019804916 -6 Left 1019804910 7:3116730-3116752 CCCATTCTGCAGTGGCCTGCAGC No data
Right 1019804916 7:3116747-3116769 TGCAGCCTCACCTGGGGCACTGG No data
1019804910_1019804920 7 Left 1019804910 7:3116730-3116752 CCCATTCTGCAGTGGCCTGCAGC No data
Right 1019804920 7:3116760-3116782 GGGGCACTGGCCTGCAGGTCTGG No data
1019804910_1019804921 8 Left 1019804910 7:3116730-3116752 CCCATTCTGCAGTGGCCTGCAGC No data
Right 1019804921 7:3116761-3116783 GGGCACTGGCCTGCAGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019804910 Original CRISPR GCTGCAGGCCACTGCAGAAT GGG (reversed) Intergenic
No off target data available for this crispr