ID: 1019809317

View in Genome Browser
Species Human (GRCh38)
Location 7:3152898-3152920
Sequence GGGGCTAAGCGATTTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1174
Summary {0: 1, 1: 1, 2: 20, 3: 165, 4: 987}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019809310_1019809317 22 Left 1019809310 7:3152853-3152875 CCAGTGATATGGGACCGATCATT 0: 1
1: 0
2: 0
3: 3
4: 61
Right 1019809317 7:3152898-3152920 GGGGCTAAGCGATTTGCCCAAGG 0: 1
1: 1
2: 20
3: 165
4: 987
1019809316_1019809317 -6 Left 1019809316 7:3152881-3152903 CCATCTTATGGCTCAGAGGGGCT 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1019809317 7:3152898-3152920 GGGGCTAAGCGATTTGCCCAAGG 0: 1
1: 1
2: 20
3: 165
4: 987
1019809311_1019809317 8 Left 1019809311 7:3152867-3152889 CCGATCATTTCTCTCCATCTTAT 0: 1
1: 0
2: 0
3: 46
4: 492
Right 1019809317 7:3152898-3152920 GGGGCTAAGCGATTTGCCCAAGG 0: 1
1: 1
2: 20
3: 165
4: 987

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019809317 Original CRISPR GGGGCTAAGCGATTTGCCCA AGG Intronic
900805144 1:4762768-4762790 GAGGTTAAGGGATTTTCCCAAGG - Intronic
901197419 1:7447894-7447916 GAAGCAAAGCTATTTGCCCAAGG + Intronic
901502107 1:9658836-9658858 TGGGTTAAGTGACTTGCCCAAGG - Intronic
901745354 1:11369342-11369364 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
901824132 1:11849578-11849600 GAGGCTATGCCACTTGCCCAAGG + Intergenic
901873250 1:12151007-12151029 GTGGCTAAGCCAGTTCCCCAGGG + Intergenic
902203361 1:14850498-14850520 GAGGTTAAGCAACTTGCCCACGG + Intronic
902266706 1:15272155-15272177 GAGGTTAAGCGACTTGCCCAAGG - Intronic
902356836 1:15908912-15908934 GGTGTTAAGTGATTTGTCCACGG + Intronic
902518519 1:17002672-17002694 GAGGTTAAGTGACTTGCCCAGGG - Intronic
902604632 1:17561985-17562007 GAGGCAAAGCGACTTGTCCAAGG - Intronic
902668479 1:17955530-17955552 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
902721529 1:18307506-18307528 GAGGTTAAGTGACTTGCCCAAGG + Intronic
902830095 1:19006969-19006991 GAGGCAAAGCAATTTCCCCAAGG + Intergenic
902838794 1:19062610-19062632 GAGGCTGAGCAATTTGCCCAGGG + Intergenic
903035179 1:20488224-20488246 GAGGATAAGTGACTTGCCCAAGG + Intergenic
903134999 1:21303394-21303416 GGGATTAAGTGATTTGCCCAAGG - Intronic
903229305 1:21912195-21912217 GAGGTCAAGTGATTTGCCCAGGG - Intronic
903284197 1:22266989-22267011 GAGGCCAAGTGACTTGCCCAAGG + Intergenic
903327404 1:22577340-22577362 GAGGCAAAGCAACTTGCCCAAGG + Intronic
903368020 1:22816805-22816827 GTGGCTGAGTGATTTGCCTAAGG + Intronic
903474735 1:23611813-23611835 GAGGCTAAGCAACCTGCCCAAGG + Intronic
903647455 1:24903838-24903860 GAGGTTAAGTGACTTGCCCAAGG - Intronic
903740262 1:25554584-25554606 GAGGCTAAGGGACTTACCCAAGG - Intronic
903773751 1:25780086-25780108 GAGGCTAAGTAATTTGCCCAAGG - Intronic
903881522 1:26513350-26513372 GAGGCCAAGTGATTTGGCCAAGG - Intergenic
903954612 1:27016577-27016599 GAGGTTAAGTGATATGCCCAAGG + Intergenic
904023669 1:27488865-27488887 GGAGTTAAGTAATTTGCCCAAGG - Intronic
904041122 1:27585863-27585885 GAGGCTAAGTAACTTGCCCAGGG - Intronic
904235374 1:29113034-29113056 GCGGAAAAGTGATTTGCCCAAGG - Intronic
904373319 1:30064640-30064662 GAGGATAAGCGACTTGTCCAAGG - Intergenic
904383697 1:30128135-30128157 GGGGTGAAGCGACCTGCCCAAGG + Intergenic
904444403 1:30556396-30556418 GAGGCTGAGTGATCTGCCCAAGG + Intergenic
904472381 1:30743959-30743981 GAGGTTAAGAGACTTGCCCAAGG - Intronic
904478037 1:30777124-30777146 GAGGTTAAGCAATTTGCCCAAGG + Intergenic
904694743 1:32322847-32322869 GAAGTTAAGTGATTTGCCCAAGG - Intronic
904786272 1:32985392-32985414 GAGGAGAAGTGATTTGCCCAAGG + Intergenic
904852758 1:33471596-33471618 GAAGCTAAGTAATTTGCCCAAGG + Intergenic
904944172 1:34187247-34187269 GAGGTTAAGCAAGTTGCCCAAGG + Intronic
905026161 1:34851313-34851335 AGGGCTAAGTGACTTGCCCAAGG + Intronic
905092980 1:35444500-35444522 GGGGTTAAGTAACTTGCCCAAGG + Intronic
905314720 1:37074888-37074910 GAGGTTAAGCGACTTGTCCAGGG - Intergenic
905317499 1:37092805-37092827 AGGGACAAGTGATTTGCCCAAGG - Intergenic
905358233 1:37399883-37399905 GAGGCTAAGAGACTTGACCAAGG + Intergenic
905588449 1:39141039-39141061 AGGGCATAGTGATTTGCCCAGGG + Intronic
905798299 1:40827753-40827775 GGGGTCAGGTGATTTGCCCAAGG - Intronic
905871767 1:41408406-41408428 GAGGTTAAGTGATGTGCCCAAGG + Intergenic
905918592 1:41703470-41703492 GAGGTTAAGTAATTTGCCCAAGG - Intronic
905975804 1:42172806-42172828 GAGGTGAAGTGATTTGCCCAAGG - Intergenic
906103599 1:43278625-43278647 GAGGCTAAGTAACTTGCCCAAGG + Intergenic
906971759 1:50522333-50522355 GAGGTTAAGCAATTTGCCCAAGG - Intronic
907069525 1:51521091-51521113 GAGGCTAAGTGATTTGCCCAGGG + Intergenic
907092093 1:51734691-51734713 GCAGCTAAACGACTTGCCCATGG + Intronic
907338056 1:53713481-53713503 GGGGCTCACCGTTTTGCCCAGGG - Intronic
907399231 1:54214326-54214348 GAGGCTAAGGAACTTGCCCAAGG + Intronic
907458563 1:54591823-54591845 GAGGTTAAGTCATTTGCCCAAGG - Intronic
907511893 1:54967590-54967612 GGGGTTAAGTGACATGCCCAAGG - Intergenic
907574051 1:55509921-55509943 GGGGCTCATAAATTTGCCCAAGG + Intergenic
907809046 1:57850365-57850387 GATGCAAAGCAATTTGCCCAAGG + Intronic
907813476 1:57895330-57895352 GAGGCTAAGTAATTTGCCCAAGG + Intronic
907830430 1:58059809-58059831 GAGGCTAAGCAATTTCTCCAGGG + Intronic
907830650 1:58061225-58061247 GGGGTTAAGCGACTTGCTCAGGG - Intronic
907832362 1:58077243-58077265 AAGGCTAAGTGATTTGTCCAAGG + Intronic
907870998 1:58442679-58442701 GAGGATAAGTGACTTGCCCAAGG - Intronic
908117419 1:60953643-60953665 GTGGGTAAGTGACTTGCCCAAGG - Intronic
908257544 1:62315364-62315386 GAGGTTAAGTGACTTGCCCAGGG - Intronic
908312789 1:62902213-62902235 GAAGCTAAGTGACTTGCCCAAGG + Intergenic
908393082 1:63700873-63700895 GAGGTTAAGTGACTTGCCCAGGG + Intergenic
908393161 1:63701797-63701819 GAGGTTAAGTGACTTGCCCAGGG + Intergenic
908397985 1:63743773-63743795 GGGGCTAAGTAACCTGCCCAAGG + Intergenic
908463151 1:64366030-64366052 AAGGCAAAGTGATTTGCCCAAGG + Intergenic
908563777 1:65333510-65333532 GGGGTTAAGTGAGTTGCCCAAGG + Intronic
908630112 1:66094882-66094904 GGGGTTAAGTAATTTTCCCAAGG + Intronic
908731568 1:67231503-67231525 GGGGTTAAGCAATTTGCCCAGGG + Intronic
908825464 1:68128846-68128868 GAGGCTAAGTAACTTGCCCAAGG + Intronic
909560896 1:77008362-77008384 GAGGTTAAGTCATTTGCCCAAGG - Intronic
909561296 1:77011989-77012011 GAAGCTAAATGATTTGCCCAAGG + Intronic
909944641 1:81649744-81649766 GGGGTTAAGTAATTTGCCCAAGG + Intronic
910030614 1:82717605-82717627 GAGCTTAAGAGATTTGCCCAAGG + Intergenic
910442116 1:87263591-87263613 GGGGCTATGCCATTGTCCCAGGG + Intergenic
911263822 1:95719692-95719714 GAGGTTAAGTGATTTGGCCAAGG - Intergenic
912483162 1:110000798-110000820 GGGGCTAAGTGACTTGCTTAAGG - Intronic
912529373 1:110309236-110309258 AGGGCTCAGCAATTTGCTCAAGG + Intergenic
912587425 1:110779656-110779678 GAGGGTAAGAGATTTGCCCATGG + Intergenic
912659940 1:111518590-111518612 GAGGCTAAGCGATTTTCCCAAGG + Intronic
913363894 1:118014117-118014139 GAGGTTAAGTAATTTGCCCAAGG - Intronic
914435604 1:147656629-147656651 GAGGCTCAGTGACTTGCCCAGGG - Intronic
914982664 1:152428880-152428902 GGGGTTAAGTGACTTGCTCAAGG + Intergenic
915083660 1:153369623-153369645 GAGGCAAAGTGATTTGGCCAAGG + Intergenic
915272947 1:154768100-154768122 GAGGGTAAGTGACTTGCCCAGGG - Intronic
915458572 1:156055670-156055692 GAGGTTAAGCGACTTACCCAAGG - Intronic
915563627 1:156701773-156701795 GTGGTTAAGCCATTTGCTCAGGG - Intronic
916314857 1:163437928-163437950 GGGGTTAAGAGACTTGCTCAAGG - Intergenic
916370581 1:164089971-164089993 GGAGCTAAGCTACTTGCCCATGG + Intergenic
916577916 1:166083430-166083452 GAGGCTTAGTGATTTGTCCAAGG - Intronic
916745688 1:167683309-167683331 AAGGCTAAGCCATTTGCCCCAGG + Intronic
916980209 1:170127912-170127934 GGGATTAAGCAATTTGTCCAAGG - Intergenic
917065609 1:171090017-171090039 AAGGTTAAGTGATTTGCCCAAGG + Intergenic
917088403 1:171327516-171327538 GAGGTTAAGCCATTTGCCCAGGG + Intronic
917127821 1:171706054-171706076 AGGGCTAAGTGATTTGTTCAAGG - Intronic
917818931 1:178740866-178740888 GAGTTTAAGCGATTTGCCCAAGG - Intronic
917818950 1:178741304-178741326 GAGGCTAACCAACTTGCCCAAGG + Intronic
917973759 1:180225591-180225613 GAGGTTAAGTGGTTTGCCCAAGG - Intergenic
918056275 1:181024316-181024338 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
918321184 1:183366257-183366279 GAGGTGAAGTGATTTGCCCAAGG - Intronic
919911303 1:202112683-202112705 CAGGTTAAGTGATTTGCCCATGG + Intergenic
919920234 1:202162964-202162986 GAGACTCAGCAATTTGCCCAAGG - Intergenic
919937735 1:202265661-202265683 GGGACTGAGTGATTTGTCCAAGG - Intronic
920264518 1:204711875-204711897 GAGGTTAAGCAAATTGCCCAAGG - Intergenic
920288260 1:204897471-204897493 TGGGCTGAGAAATTTGCCCAAGG + Intronic
920369001 1:205465560-205465582 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
920490655 1:206412051-206412073 GGGGTTAAATGATTTGCCCAAGG + Intronic
920694253 1:208169791-208169813 GAAGATAAGTGATTTGCCCAAGG - Intronic
920833392 1:209485482-209485504 GGGGAGCAGAGATTTGCCCAAGG - Intergenic
921097117 1:211896101-211896123 GGGGCTAAGTGACTTGTCCAAGG - Intergenic
921156189 1:212440730-212440752 GAAGCTAAGCAACTTGCCCAAGG - Intronic
922053762 1:222020717-222020739 GGGGTTAAGTGATTTGCTCAGGG + Intergenic
922176309 1:223200599-223200621 GGGGACAAACGGTTTGCCCACGG - Intergenic
922316589 1:224447931-224447953 GGGGCTACATAATTTGCCCAGGG + Intronic
922421920 1:225466013-225466035 GGGGCTCAGAGATGTCCCCATGG - Intergenic
922554001 1:226519309-226519331 GGGGCTGAGTGAGTTGCTCAAGG + Intergenic
922775131 1:228211052-228211074 GGGAGTAAGGGCTTTGCCCAGGG + Intronic
922908841 1:229198367-229198389 GGGGAGAAGCAACTTGCCCAAGG + Intergenic
923657454 1:235930410-235930432 TGGGCTACGTAATTTGCCCAAGG + Intergenic
923823958 1:237478310-237478332 GGAGCTAAGCGACTTGGTCAAGG - Intronic
924021270 1:239786465-239786487 GAGGGTAAGTCATTTGCCCAGGG + Intronic
924424657 1:243940334-243940356 GAGGTTAAAGGATTTGCCCAAGG + Intergenic
924704252 1:246486629-246486651 GAGATTAAGTGATTTGCCCAAGG + Intronic
1063513402 10:6669746-6669768 GAGGCTAAGTGGTTTGTCCAAGG - Intergenic
1064373155 10:14771999-14772021 GAGGGTAAGACATTTGCCCAAGG - Intronic
1064512204 10:16107744-16107766 GTGGCTAAGCAACTTGTCCAAGG - Intergenic
1065173977 10:23059664-23059686 GGAGCAAAGTGATTTGCCCCAGG + Intergenic
1067320868 10:45219618-45219640 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1067513351 10:46913770-46913792 GAGGTTAAGTAATTTGCCCAAGG + Intronic
1067532933 10:47087581-47087603 GCGGCTCAGCGATTTCCTCAAGG + Intergenic
1067648901 10:48138072-48138094 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
1068012204 10:51466002-51466024 GAAGTTAAGCAATTTGCCCAAGG + Intronic
1068064602 10:52113011-52113033 GAGGTTAAGCAATTTCCCCAAGG - Intronic
1068963441 10:62888001-62888023 GAGGTTAAGCAATTTGACCAAGG - Intronic
1069580696 10:69564272-69564294 GAGGCTAAGTAACTTGCCCAAGG + Intergenic
1069814521 10:71185243-71185265 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1069825451 10:71252695-71252717 GAGGTGAAGTGATTTGCCCAAGG + Intronic
1069856113 10:71442156-71442178 GAAGCTAAGCAAATTGCCCAAGG + Intronic
1069899457 10:71698914-71698936 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1069981080 10:72252997-72253019 GGTGGGAAGTGATTTGCCCAGGG - Intergenic
1070530149 10:77329811-77329833 GAGGTGAAGCAATTTGCCCAAGG - Intronic
1070531621 10:77342144-77342166 GGGGCTAAGTGATATGTTCAAGG + Intronic
1070733530 10:78847880-78847902 GGGCTTAAGTAATTTGCCCAAGG + Intergenic
1070751365 10:78965797-78965819 GAGGGTAAGTGGTTTGCCCAGGG - Intergenic
1070790166 10:79184395-79184417 GGGGTTAAGTGACCTGCCCAAGG - Intronic
1070830748 10:79416754-79416776 GAGGCTAAGTGACTTGCCGAGGG - Intronic
1070834151 10:79437493-79437515 GAGGCTGAGCGATTTGCCCAAGG + Intronic
1070841781 10:79492430-79492452 GGGTTTAAGGGACTTGCCCATGG - Intergenic
1070913617 10:80138682-80138704 GAGGCTGAGTGATTTCCCCAAGG - Intronic
1071236908 10:83659510-83659532 GAGGCTATGTAATTTGCCCAAGG - Intergenic
1071262871 10:83936794-83936816 GAGCTTAAGTGATTTGCCCAAGG + Intergenic
1071286557 10:84153857-84153879 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
1071696779 10:87883944-87883966 GAGGCTAAGTGACTTGCCCATGG + Intronic
1072135792 10:92544469-92544491 GTGGTTAAGTGACTTGCCCAAGG + Intronic
1072241219 10:93496956-93496978 GAGGCCAAGTGACTTGCCCAAGG + Intronic
1072273398 10:93799588-93799610 GGGGCTAAGCAACTGGCCTATGG - Intergenic
1072303313 10:94083488-94083510 GAAGATAAGCCATTTGCCCAGGG + Intronic
1072345365 10:94499736-94499758 GAGGTTAAGTGATTTGCCCAAGG + Intronic
1072457589 10:95590291-95590313 GGGGTAGAGTGATTTGCCCAAGG + Intergenic
1072519773 10:96221103-96221125 GGGGCTAAGAAACTTACCCAAGG - Intronic
1072529280 10:96303445-96303467 TTGGCTAAACAATTTGCCCAAGG - Intergenic
1072847140 10:98844096-98844118 GAGGGTAAGTGACTTGCCCAAGG - Intronic
1072847188 10:98844645-98844667 GAGGCTAAGCGACTTTCCTAAGG - Intronic
1073038414 10:100580610-100580632 GGGGGTAAGTGATGTACCCAAGG - Intergenic
1073058440 10:100717366-100717388 GAGGCTAAGTTGTTTGCCCAAGG - Intergenic
1073310689 10:102538846-102538868 GAGGCTAAGTGATTTGCCAAGGG + Intronic
1074570148 10:114616939-114616961 GAGGTTAAGGGACTTGCCCAAGG + Intronic
1074785451 10:116835216-116835238 AGGGCTAAGCACCTTGCCCAAGG - Intergenic
1074821767 10:117185102-117185124 GAGGCTAAGCAATTTGCCCAAGG + Intergenic
1075138427 10:119808472-119808494 GTGGTTAAGTGACTTGCCCAAGG - Intronic
1075662065 10:124204630-124204652 GGGGATAAGAGACTTGCACATGG - Intergenic
1076015122 10:127021577-127021599 GAGGCTAAGTGACTTGTCCAAGG + Intronic
1076423943 10:130354129-130354151 AGGGCTAAGTGACTTGCCCATGG + Intergenic
1076931667 10:133535981-133536003 GAGGCTAGGCGACTTGCTCAAGG + Intronic
1077497493 11:2893208-2893230 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1077709130 11:4518182-4518204 TAGGTTAAGCAATTTGCCCAGGG - Intergenic
1078103267 11:8342718-8342740 GAGGCTCAGTGACTTGCCCAAGG + Intergenic
1078107348 11:8366553-8366575 GGAGATAAGCCACTTGCCCAAGG - Intergenic
1078225286 11:9385569-9385591 GAGGTTAAGCGACTGGCCCAAGG - Intronic
1078480366 11:11670256-11670278 GAGGCAAAGTGATTTGCCCAAGG - Intergenic
1078770171 11:14342338-14342360 GGGAAGAAGGGATTTGCCCAAGG - Intronic
1078845038 11:15112949-15112971 GAGGTTAAGTGATTTGTCCAAGG + Intronic
1078893142 11:15575597-15575619 GTGGCTAAGTAATTTACCCAAGG + Intergenic
1079124254 11:17707806-17707828 GAGGGTAAGCCACTTGCCCAGGG - Intergenic
1079414773 11:20223541-20223563 GGGGCTAAATGTTTTGACCAAGG - Intergenic
1080054142 11:27887688-27887710 TGGGCTAAGAAATTAGCCCAAGG - Intergenic
1080055436 11:27901938-27901960 GAGGTTAAGAAATTTGCCCAAGG + Intergenic
1080060081 11:27947906-27947928 GAGGATAAGACATTTGCCCAAGG - Intergenic
1080193826 11:29583773-29583795 CTGGATAAGGGATTTGCCCAGGG - Intergenic
1080294523 11:30710829-30710851 GGAGTTAAGCAACTTGCCCAAGG - Intergenic
1080369776 11:31621951-31621973 GAGGCTAAATAATTTGCCCAAGG - Intronic
1080391339 11:31849882-31849904 GAGGCTAAGTGATTTGCTCAAGG + Intronic
1080566320 11:33512824-33512846 GGAGAAAAGCAATTTGCCCAAGG + Intergenic
1080644791 11:34180681-34180703 GAGGCTAAGCGCCTTGCTCAAGG + Intronic
1080666530 11:34341241-34341263 GGGGCTAAGTGACTTGCCTGAGG + Intronic
1080684662 11:34505104-34505126 GAGGCTAAGTGACTTGCCCTGGG - Intronic
1080747052 11:35117434-35117456 GAGGTTAAGCTATTTGCCTAAGG + Intergenic
1081206885 11:40285916-40285938 GAGGCTAAGTGATTTGTCTAAGG - Intronic
1081234584 11:40632029-40632051 GAGGCTAAGTGACTTGGCCAAGG + Intronic
1081261456 11:40966410-40966432 GGGGCTAAGTGAGCTGACCAAGG + Intronic
1081577324 11:44327255-44327277 GGGGCCGAGCAACTTGCCCAAGG - Intergenic
1081649186 11:44812233-44812255 GAGGCTAAGTCATTTGCCCCAGG - Intronic
1081652419 11:44833242-44833264 GAGGTTAAGCTACTTGCCCAAGG - Intronic
1081663846 11:44904891-44904913 AGGGTTAAGGGATTTGTCCAAGG - Intronic
1081691053 11:45078931-45078953 GAGGCTAAGTAATTTGCCCCAGG + Intergenic
1081699417 11:45143689-45143711 GAGGTTAAGAGACTTGCCCAAGG - Intronic
1081748132 11:45487458-45487480 GAGGCTAAGTGATTTACCCAGGG + Intergenic
1081838258 11:46175589-46175611 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
1081936295 11:46906112-46906134 GGGGCTACGTGACTTGCACAAGG - Intronic
1081981042 11:47267468-47267490 GGGGTTAAGACATTTGCTCAAGG + Intronic
1082784735 11:57310684-57310706 GTGGTTAAGTGATTTGCTCAAGG - Intronic
1083114635 11:60448423-60448445 GGGGGTAAGTAATTTGCTCAAGG + Intronic
1083174392 11:60940255-60940277 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1083198964 11:61108047-61108069 GAGGCTGAGTGACTTGCCCAAGG - Intronic
1083615551 11:64024415-64024437 GAGGCTGAGTGACTTGCCCAAGG + Intronic
1083640091 11:64140756-64140778 GAGGTTAAGTGATTTGCCCAAGG + Intronic
1084323745 11:68387508-68387530 GAGGCTCAGGGACTTGCCCAGGG + Intronic
1084419098 11:69051462-69051484 GAGGTTAAGGGACTTGCCCAGGG + Intronic
1084456205 11:69269564-69269586 GAGGTTAAGTGACTTGCCCAAGG - Intergenic
1084607675 11:70181942-70181964 GAGGTTAGGTGATTTGCCCAAGG + Intronic
1085255421 11:75169872-75169894 GAGGCTAAGAGACTTGCCCAAGG - Intronic
1085300669 11:75456477-75456499 GAGGTTAAGTGATTTGCCTAAGG - Intronic
1085379271 11:76098387-76098409 GGGGGTAAGAGACTTGCCCAAGG + Intronic
1085479391 11:76808827-76808849 GAGGTTAAGTAATTTGCCCAAGG + Intergenic
1085649628 11:78255974-78255996 GAGGCTAAGTGATTTGCTCCAGG - Intronic
1085945870 11:81272108-81272130 GGCATTAAGCGATTTGACCAAGG + Intergenic
1086189163 11:84057833-84057855 GAGGTTAAGCAATTTGCTCAAGG + Intronic
1086455571 11:86955872-86955894 GGGGTTGAGCAATTTGCTCAAGG - Intergenic
1086551615 11:88059077-88059099 GAGGTTAAGTGATTTTCCCAAGG - Intergenic
1086956596 11:92940226-92940248 GATGTTAAGTGATTTGCCCAAGG + Intergenic
1088120538 11:106363762-106363784 GGAGCTATGTGATTTGCCCGAGG - Intergenic
1088250503 11:107857792-107857814 AAGGCTAAGCAATTTGCCCAAGG - Intronic
1088386814 11:109267629-109267651 AGGGTTAAGTGGTTTGCCCAGGG - Intergenic
1088688881 11:112307786-112307808 GAGGTTAAGTGACTTGCCCAAGG - Intergenic
1088712050 11:112517329-112517351 GAGGTTAAGTGACTTGCCCAAGG - Intergenic
1088828645 11:113516715-113516737 AAGGCTTAGCGATTTGGCCAAGG + Intergenic
1088891138 11:114045228-114045250 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1088975684 11:114814390-114814412 AAGGCTAAGTGATTTGCCTAAGG - Intergenic
1088980700 11:114860561-114860583 GAGGCTAAGTGACTTGTCCAAGG - Intergenic
1089015880 11:115164901-115164923 GGGAAGAAGCGATTTGCCCAAGG + Intergenic
1089230437 11:116969921-116969943 GGGGTAAAGTGATTTTCCCAAGG - Intronic
1089255011 11:117189539-117189561 GGGGTTATGTGATTTGCCCTGGG - Intronic
1089272813 11:117313979-117314001 GAGGTTATGCAATTTGCCCAAGG + Intronic
1089319390 11:117614654-117614676 GTGGTTAAACGACTTGCCCAAGG + Intronic
1089625746 11:119749552-119749574 GAGGCTAAGCCACCTGCCCAAGG - Intergenic
1089655130 11:119941685-119941707 GGGGCTGAGTCATTTCCCCAGGG + Intergenic
1089679792 11:120112945-120112967 GAGGCTAGGCAACTTGCCCAAGG + Intronic
1089942889 11:122438027-122438049 GGGGTTGAGTAATTTGCCCAAGG + Intergenic
1090167695 11:124568756-124568778 GACACTAAGTGATTTGCCCAAGG - Intergenic
1090409234 11:126496382-126496404 GAGGCTAAGTGATTTGGACAAGG + Intronic
1090415739 11:126539096-126539118 GGGACTAAGCAATTTGCCCAGGG - Intronic
1090484664 11:127102288-127102310 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
1090686128 11:129122034-129122056 GAGGCTAAGCTACTTGCCCAAGG + Intronic
1091224409 11:133949046-133949068 GGTGCTCAGCGCTTAGCCCAGGG - Intronic
1091389275 12:116190-116212 GAGTTTAAGCGACTTGCCCAAGG + Intronic
1091629115 12:2145900-2145922 AGGGTTAAGTGACTTGCCCAAGG - Intronic
1091644659 12:2264506-2264528 AGGGTTAAGTGATTTGCCCTAGG - Intronic
1091692746 12:2608336-2608358 GAGGTTAAACGCTTTGCCCAAGG + Intronic
1091779070 12:3202531-3202553 GGGACCAAGTGATTTGCCCAAGG - Intronic
1091855974 12:3740472-3740494 GGGGTTAAGTGGCTTGCCCAAGG - Intronic
1092002562 12:5044267-5044289 TGGGCTCAGCGATGGGCCCAAGG + Exonic
1092029716 12:5274191-5274213 AGGGGGAAGCGACTTGCCCAGGG + Intergenic
1092478519 12:8839417-8839439 GAGGCTAAGTGATTTTTCCAAGG + Intronic
1092624149 12:10307440-10307462 AGAGCTAAGTAATTTGCCCAAGG - Intergenic
1092844327 12:12569981-12570003 GAGGTTAAACGACTTGCCCAAGG + Intergenic
1093051331 12:14508240-14508262 GGGGATAAGCAATTTGTTCAAGG - Intronic
1093153616 12:15653695-15653717 GAGGATAAGTAATTTGCCCAAGG - Intronic
1094224508 12:28030071-28030093 TGGGCTAAGTGATTTGCTGAAGG - Intergenic
1094504335 12:31048789-31048811 GAGGCTAAGCCATTTGTCCAAGG + Intergenic
1094698677 12:32846951-32846973 GGGGTTAAGTAAATTGCCCAAGG - Intronic
1095675504 12:44912912-44912934 GAGGTTAAGTAATTTGCCCAAGG - Intronic
1096189259 12:49604610-49604632 GAGGCTAAGCGACTTGTCCAAGG - Intronic
1096439968 12:51632936-51632958 GAGGTAAAGCAATTTGCCCAAGG - Intronic
1096459119 12:51812330-51812352 GAGGTTAAGTGACTTGCCCAAGG - Exonic
1096481322 12:51942995-51943017 GGGATTAAGTAATTTGCCCAAGG - Intergenic
1096670367 12:53194977-53194999 GAGGCTAAGTGACTTGTCCAAGG - Exonic
1096762016 12:53849657-53849679 GGGGTTAAGCAATTTGCCCAAGG - Intergenic
1096807158 12:54147806-54147828 GTGGCTGAGTGACTTGCCCAAGG - Intergenic
1098131654 12:67357599-67357621 GAGGTTAAGCAATTTGCTCACGG - Intergenic
1098816376 12:75170269-75170291 GGGAGTAAGTGATTTGCTCAGGG + Intronic
1100351165 12:93784396-93784418 GAGGTTAAGTGAGTTGCCCAAGG + Intronic
1101157939 12:101945217-101945239 GGGGTTAAATGACTTGCCCAGGG + Intronic
1101266921 12:103098270-103098292 GGAGCTAACCAATCTGCCCATGG - Intergenic
1101477900 12:105067981-105068003 GAGGCTAAGCGACTTGCCTGTGG + Intronic
1101531920 12:105581096-105581118 GAGGTTAAGTGACTTGCCCAGGG - Intergenic
1101642439 12:106597281-106597303 GAGGTTAAGTAATTTGCCCAGGG + Intronic
1101752699 12:107595724-107595746 GAGGCTAAGAAACTTGCCCAAGG - Intronic
1101800706 12:108019630-108019652 GAGGTTAAGTGATTTGCTCAGGG - Intergenic
1101836679 12:108300664-108300686 AGGGCTAAGTAATGTGCCCAGGG - Intronic
1101840490 12:108324359-108324381 GAGGTTAAGCGACTTGCCCAAGG - Intronic
1101956669 12:109218009-109218031 GAGGTTAAGCCACTTGCCCAAGG + Intronic
1102011165 12:109619430-109619452 GAAGTTAAGTGATTTGCCCAAGG + Intergenic
1102048829 12:109847636-109847658 GTGGCAAAGAGACTTGCCCAGGG - Intergenic
1102081088 12:110098595-110098617 GAGGTTAAGACATTTGCCCAAGG - Intergenic
1102153794 12:110707974-110707996 GAGATTAAGGGATTTGCCCAAGG + Intergenic
1102239153 12:111313033-111313055 GAGGCTAAGTAACTTGCCCAAGG - Intronic
1102303804 12:111790112-111790134 GGGGATAAGTGACTTGCCCAAGG - Intronic
1102502271 12:113360547-113360569 GAGGTGAAGGGATTTGCCCAAGG - Intronic
1102589658 12:113947659-113947681 GAGGCTTAGTGATTTGCTCAAGG - Intronic
1102627149 12:114244357-114244379 GAGGGTAAGTGACTTGCCCAAGG + Intergenic
1102639026 12:114349919-114349941 GAGGTTAAGAGACTTGCCCAAGG + Intergenic
1102710206 12:114919290-114919312 GAGGCTAAGTGACTTGCCCAAGG - Intergenic
1102765883 12:115432737-115432759 GTGGCTCAGTGACTTGCCCAAGG - Intergenic
1102982798 12:117255773-117255795 GGGGTTAAGCGACTTGCTCAAGG + Intronic
1103005135 12:117414867-117414889 GAGCTTAAGCGTTTTGCCCAAGG + Intronic
1103049253 12:117765421-117765443 GAGGTTAAGTAATTTGCCCAAGG - Intronic
1103101967 12:118184834-118184856 GAGGTTAAGTAATTTGCCCAAGG - Intronic
1103160950 12:118728844-118728866 GAGGGTAAGTAATTTGCCCAAGG - Intergenic
1103191511 12:119005915-119005937 GAGGTTAAGAGCTTTGCCCAAGG - Intronic
1103436406 12:120930206-120930228 GAGGTTAAGGGACTTGCCCAGGG + Intergenic
1103448452 12:121010424-121010446 GAGGCAAAGTCATTTGCCCAGGG - Intronic
1103468778 12:121163175-121163197 GAGGTTAAGCCATTTTCCCAAGG - Intronic
1103581611 12:121919600-121919622 GGGGTAAAGTGACTTGCCCAAGG + Intronic
1103761756 12:123255189-123255211 GAGGCTAAGTGACCTGCCCAAGG + Intronic
1103809575 12:123602526-123602548 GAGGTTAAGCCATTTGCCCGAGG - Intronic
1103901656 12:124306608-124306630 GTGGCTAAGTCATTTGCCCAAGG - Intronic
1105534033 13:21247603-21247625 GAGGCTAAGAAACTTGCCCAGGG + Intergenic
1106085903 13:26541366-26541388 GAGGCTAAGCAACTTACCCAAGG - Intergenic
1106147802 13:27066317-27066339 GAGGTTAAGTGACTTGCCCAAGG + Exonic
1107684288 13:42881172-42881194 GGAGATAAGAGATTTGTCCAAGG + Intergenic
1107975963 13:45688875-45688897 GGGGTAAAGTGATTTGCCTAGGG + Intergenic
1108375135 13:49807245-49807267 GAGGTTAAACAATTTGCCCAGGG + Intergenic
1108596889 13:51956913-51956935 GAGGCTAAGCAACTGGCCCAAGG - Intronic
1108710386 13:53027478-53027500 GGGGCTAAGTGACATGCTCAAGG + Intergenic
1108730587 13:53231084-53231106 GAGGTTAAGTGATTTGTCCAAGG + Intergenic
1110461281 13:75748378-75748400 GGGGTTACGTGACTTGCCCAAGG - Intronic
1110957554 13:81574852-81574874 AGTGCTAGGCGACTTGCCCAAGG - Intergenic
1111245986 13:85541796-85541818 GAGGTTAAGCAATTTGCCCAAGG + Intergenic
1111660566 13:91204954-91204976 GAGGTTAAGTGACTTGCCCAAGG - Intergenic
1111973603 13:94942458-94942480 GGGGCTAAGCAACTTGCCAAAGG + Intergenic
1112473264 13:99708549-99708571 GAAGCTAAGTAATTTGCCCAAGG - Intronic
1112558234 13:100488869-100488891 GGGGGTAAGGGAGTGGCCCATGG - Intronic
1112674970 13:101690716-101690738 GGGGCTAAATGATTTGCCCAAGG - Intronic
1113507847 13:110829499-110829521 GAGGTTCAGAGATTTGCCCAAGG + Intergenic
1114829597 14:26124565-26124587 GAGGCTAAGTAACTTGCCCAAGG - Intergenic
1115165614 14:30445728-30445750 GAGGTTAAGCCATTTGTCCAGGG + Intergenic
1115379413 14:32718161-32718183 GAAGCTAAGTGACTTGCCCAAGG - Intronic
1115490799 14:33956175-33956197 GAGGCTAAGGAACTTGCCCAAGG + Intronic
1115851433 14:37592839-37592861 GGCGCTTAGCCATTTGCCCCGGG - Intronic
1116699308 14:48218554-48218576 GAGGTTAAGTGATTTGCCCAGGG - Intergenic
1116999703 14:51360003-51360025 GAGGCTGAGTGATTTTCCCAGGG - Intergenic
1118301292 14:64618802-64618824 GAGGTTAAGTGACTTGCCCATGG + Intergenic
1118760423 14:68877647-68877669 CAGGCTAAGTGATTTGCCCAGGG + Intronic
1118818104 14:69326829-69326851 GAGCTTCAGCGATTTGCCCAGGG + Intronic
1118935181 14:70281698-70281720 GAGGTTAAGTGATTTGTCCAAGG + Intergenic
1118945790 14:70385877-70385899 GTGCCCAAGCCATTTGCCCAAGG - Intronic
1119058456 14:71448416-71448438 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1119196511 14:72720756-72720778 GGGGTTAAGCAATTTGTTCAAGG - Intronic
1119371747 14:74151834-74151856 CAGGTTAAGTGATTTGCCCAAGG - Intronic
1119398552 14:74347217-74347239 GGGGTTAAACAATTTGCCCAAGG + Intronic
1119429787 14:74558915-74558937 GGAGCTAAGTGACTTGCTCAAGG - Intronic
1119469357 14:74884453-74884475 GAGGTTAAGCGACTAGCCCAAGG - Intronic
1119557002 14:75560967-75560989 GAGGCTAAATGGTTTGCCCAAGG + Intergenic
1119866237 14:77977501-77977523 GAGGTTAAGTGACTTGCCCAAGG - Intergenic
1120475921 14:84986930-84986952 GGGGCTAAGCAATTTGTTCAAGG + Intergenic
1121000996 14:90451968-90451990 GAGGTTAAGGGATTTGCCTAAGG - Intergenic
1121055819 14:90851531-90851553 GAGGCTGAGTGATTTGCTCAGGG + Exonic
1121093388 14:91198858-91198880 GAGGTTAAGCAATTTGCCCAAGG + Intronic
1121110397 14:91308789-91308811 AAGGTTAAGCAATTTGCCCAAGG + Intronic
1121310236 14:92931853-92931875 GAGGTTAAGTAATTTGCCCAAGG + Intronic
1121504555 14:94466854-94466876 AGGGGTAAGTGAATTGCCCAAGG - Intronic
1121546395 14:94766844-94766866 GGGGTTAAGTAACTTGCCCAAGG + Intergenic
1121715442 14:96070674-96070696 AGGGTTAAGCGATTTGCCTAAGG - Intronic
1121840763 14:97132002-97132024 GAGGCCAAGCCATTTACCCAAGG + Intergenic
1121848948 14:97201607-97201629 GAGGTGAAGGGATTTGCCCAAGG - Intergenic
1122158290 14:99764330-99764352 GAGGCTAAGCGATTTGCCCAAGG + Intronic
1122295654 14:100704304-100704326 GGGGTTAAGGACTTTGCCCAAGG - Intergenic
1122547555 14:102532535-102532557 GAGGTGAAGGGATTTGCCCAAGG - Intergenic
1125739911 15:41955276-41955298 GAGGCCAAGCGGCTTGCCCAAGG + Intronic
1126318762 15:47399210-47399232 GAGGTTAAGTGATTTGCTCAAGG + Intronic
1126356630 15:47802857-47802879 GAGGTTAAGTGACTTGCCCAAGG - Intergenic
1126429047 15:48561063-48561085 AGGGTTGAGTGATTTGCCCAAGG + Intronic
1126628924 15:50713984-50714006 GAAGCTAAGCAACTTGCCCAAGG + Intronic
1127256885 15:57300215-57300237 GAGGCTAAGTGACTTGCCCAGGG - Intergenic
1127551600 15:60044097-60044119 GGGGCTAAATGGTTTGCCCAAGG - Intronic
1127805804 15:62519080-62519102 GTGGTTAAGCAACTTGCCCAGGG + Intronic
1127958002 15:63869910-63869932 GAGGTTAAGTGATGTGCCCAGGG - Intergenic
1128312150 15:66637478-66637500 GAGGCTGAGCAACTTGCCCAGGG - Intronic
1128395897 15:67225205-67225227 GGAGCCAAGTAATTTGCCCAAGG - Intronic
1128564569 15:68692160-68692182 GAGGTTAAGCTACTTGCCCAAGG - Intronic
1128699274 15:69792403-69792425 GAGGCTTAGGGATTTGTCCAAGG + Intergenic
1128881368 15:71246113-71246135 GGTGTTAAGTGACTTGCCCAAGG - Intronic
1129113962 15:73354608-73354630 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1129293993 15:74589605-74589627 GAGGCTAAGTGCTTTGCCAAAGG + Intronic
1129470764 15:75752182-75752204 GAGGCTAAATGACTTGCCCAGGG - Intergenic
1129694129 15:77731002-77731024 GGGGCAGAGTGACTTGCCCAAGG - Intronic
1130046107 15:80446155-80446177 GAGGCTAAGTAATTTGCTCAAGG + Intronic
1130084282 15:80764283-80764305 GCTGTTAAGAGATTTGCCCAAGG - Intergenic
1130103333 15:80910685-80910707 GAGGTTAAGCTACTTGCCCAAGG - Intronic
1130113379 15:80985227-80985249 TGGGCTAAGTAACTTGCCCAAGG - Intronic
1130335401 15:82953079-82953101 GAGGGTAAGTGATTTGCCCAAGG + Intronic
1130615403 15:85402038-85402060 TGGGCTAAGCAACTTGCCCAAGG - Intronic
1130968401 15:88714188-88714210 GAGGCTCAGAGACTTGCCCAAGG - Intergenic
1130986616 15:88848764-88848786 GAGGTTAAGTGACTTGCCCAGGG - Intronic
1131119212 15:89812754-89812776 AAGGTTAAGTGATTTGCCCAAGG + Intronic
1131250879 15:90829276-90829298 GAGGCGAAGTGACTTGCCCAAGG - Intergenic
1131435437 15:92418093-92418115 AAGGTTAAGTGATTTGCCCAGGG - Intronic
1131537578 15:93250391-93250413 GGGGCAAAGTGACTTGCCTAGGG + Intergenic
1131549077 15:93341226-93341248 GAGGTTCAGCAATTTGCCCAGGG + Intergenic
1132301213 15:100776910-100776932 GAGGCTAGGTCATTTGCCCAAGG + Intergenic
1133258683 16:4534520-4534542 GTGTCTAAGTGACTTGCCCATGG - Intronic
1133465868 16:6026400-6026422 GGCGTTAAGCAATTTGTCCAAGG + Intronic
1133603424 16:7362937-7362959 GAGGCTAAGTGACTTGTCCAAGG - Intronic
1133693421 16:8237633-8237655 AGGGGTAAGCGATTTGCTCAAGG - Intergenic
1133752667 16:8736768-8736790 GAAGCAAAGCCATTTGCCCAAGG + Intronic
1133755925 16:8762457-8762479 GAGGTTAAGTGAGTTGCCCAAGG + Intronic
1133757822 16:8775962-8775984 GAGGCTAAGTGATTTGTCTAAGG - Intronic
1133893718 16:9905642-9905664 GGGGCAGAGCGATGTGCCTATGG + Intronic
1133905897 16:10021924-10021946 GAGGTGAAGCGACTTGCCCAAGG - Intronic
1133931642 16:10237569-10237591 GAAGGCAAGCGATTTGCCCAAGG + Intergenic
1134199767 16:12188314-12188336 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1134233263 16:12445887-12445909 GAGGCTAAGCCACTTCCCCAAGG + Intronic
1134313200 16:13094827-13094849 GAGGTTAAGTGAATTGCCCAAGG - Intronic
1134532272 16:14992764-14992786 GAGGTTAAGCGACTTGCCTATGG - Intronic
1134640858 16:15828143-15828165 GAGGTTAAGGGACTTGCCCAGGG - Intronic
1134834985 16:17353916-17353938 GAGGCTAAGTAACTTGCCCAGGG - Intronic
1135170866 16:20182147-20182169 GAGGTTAAGTGACTTGCCCAGGG + Intergenic
1135282433 16:21164192-21164214 GAGCCTAAGTGACTTGCCCAAGG - Intronic
1135330103 16:21553739-21553761 GAGGCTAAGCTACTTGCCCAGGG - Intergenic
1135401810 16:22171195-22171217 GGGCTTAAGTGATTTGCTCAGGG - Intronic
1135522546 16:23188642-23188664 GAGGCTAAGACATTTGTCCAAGG + Intronic
1135534242 16:23280572-23280594 GAGGTTAAGCAATTTTCCCAAGG + Intronic
1135534384 16:23281835-23281857 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1136067398 16:27768267-27768289 GGGACTAAGTGATTTGCCCGAGG - Intronic
1136068151 16:27772317-27772339 GAGGCTCAGTAATTTGCCCAAGG + Intronic
1136448286 16:30337287-30337309 GAGGCTAAACGATTCACCCAAGG - Intergenic
1136475294 16:30509277-30509299 GAGGCTAAGGGACTTTCCCAAGG - Intronic
1136555927 16:31007913-31007935 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1136589501 16:31209122-31209144 CAGGTTAAGCGACTTGCCCAAGG + Intergenic
1137350496 16:47710081-47710103 GGGTTTAAGCATTTTGCCCAAGG + Intergenic
1137571621 16:49569931-49569953 GGGCGTAAGCAACTTGCCCAGGG + Intronic
1137589140 16:49682731-49682753 GAGGCTAGGGAATTTGCCCAAGG - Intronic
1137703795 16:50519451-50519473 GGGGCTCAAGGACTTGCCCAAGG - Intergenic
1137717028 16:50604220-50604242 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1137727949 16:50669738-50669760 GGGGTTAAGTGACTTGCCCAGGG - Intronic
1137840721 16:51638481-51638503 GGGGGTAAGCAATTTGTCTAAGG - Intergenic
1138101287 16:54254134-54254156 GAGGCTACGTGACTTGCCCAAGG - Intronic
1138293490 16:55867739-55867761 CAGGTTAAGTGATTTGCCCAAGG - Intronic
1138339776 16:56281100-56281122 GAGGCTAAGTGACTTGCCCAGGG + Intronic
1138481067 16:57303774-57303796 TGGGCTGAGTGACTTGCCCAAGG + Intergenic
1138525776 16:57606309-57606331 GTGGTTAAGTAATTTGCCCAAGG + Intergenic
1138542746 16:57698340-57698362 GAGGCTGAGTGACTTGCCCAAGG - Intronic
1138680673 16:58681662-58681684 GGGGCGAAGTGACTTGCCCAGGG - Intronic
1138726292 16:59143035-59143057 GAGGCTAAGTGACTTGCTCATGG - Intergenic
1138967575 16:62103730-62103752 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1139276698 16:65734493-65734515 GAGGGCAAGCAATTTGCCCAAGG + Intergenic
1139672169 16:68499343-68499365 GAGGTTAAGCAACTTGCCCAGGG - Intergenic
1139711436 16:68779431-68779453 AGTGGTAAGGGATTTGCCCAAGG - Intronic
1139863748 16:70047920-70047942 GAGGTTAAGCGACTTGCCTATGG + Intergenic
1139926379 16:70489768-70489790 AGGGCTAAGGGACTTGTCCAAGG + Intronic
1140055919 16:71525694-71525716 GTAGGTAAGTGATTTGCCCAAGG + Intronic
1140132078 16:72171716-72171738 GAGGCTAAGTGACTTACCCAGGG + Intronic
1140484142 16:75280708-75280730 AGGGCCAAGCCATGTGCCCAAGG + Intergenic
1140880379 16:79192834-79192856 GAGGCTAAGTGACTTTCCCAAGG - Intronic
1141181341 16:81754984-81755006 GAGGGTAAGCAATTTGCCTAAGG - Intronic
1141248623 16:82334143-82334165 GAAGTTAAGCAATTTGCCCAAGG - Intergenic
1141249655 16:82343572-82343594 GAGGCTAAGTGACTTGCCCAGGG - Intergenic
1141283152 16:82647117-82647139 GAGGTTAAGCAACTTGCCCATGG - Intronic
1141340525 16:83199839-83199861 GGGGTGAAAAGATTTGCCCAAGG + Intronic
1141431519 16:83972644-83972666 GAGGTTAAGCAATTTGCCCCAGG + Intronic
1141485828 16:84339708-84339730 GTGGCTAAGCTCTTTGTCCAGGG - Intergenic
1141521748 16:84584874-84584896 GAGGGTAAGCCATGTGCCCAAGG + Intronic
1141523205 16:84595013-84595035 GGGGCAAAGGGTGTTGCCCAAGG - Intronic
1141564962 16:84895195-84895217 GAGGTTAAACGACTTGCCCAAGG + Intronic
1141585356 16:85029909-85029931 GAGGCTGAGTGACTTGCCCAGGG + Intronic
1141617264 16:85217081-85217103 GGGGCTGAGTCAGTTGCCCAAGG - Intergenic
1141768370 16:86073500-86073522 GAGGTTAAGTGATTTGCCCAAGG - Intergenic
1141887591 16:86903241-86903263 GAGGTCAAGCAATTTGCCCAAGG - Intergenic
1141948171 16:87324360-87324382 GAGGCTGAGTAATTTGCCCAGGG - Intronic
1142043136 16:87908253-87908275 GAGGCTAAGCTACTTGCCCAGGG - Intronic
1142591406 17:1007722-1007744 GGGGTTAAGTGACTTGCCCAAGG + Intronic
1142750784 17:1986326-1986348 GAGGTTAAGTGACTTGCCCAAGG + Intronic
1142824741 17:2502068-2502090 GAGGTTAAGTGATTTGTCCAAGG + Intronic
1143717723 17:8786667-8786689 TGGGGTAAGTGACTTGCCCAGGG + Intergenic
1143866893 17:9930371-9930393 GGAGCTAAGTGACTTGCTCAAGG + Intronic
1143886601 17:10069576-10069598 GACGCAAAGCGACTTGCCCAAGG + Intronic
1144212247 17:13025542-13025564 GTGGCTAAGACATTTGCCCAAGG - Intergenic
1144447923 17:15348318-15348340 GAGGTTAAGTGATATGCCCAAGG + Intergenic
1144517759 17:15930693-15930715 TGGGCTAAGCTAAGTGCCCATGG - Intergenic
1144832394 17:18139071-18139093 CTGGCTAAGCAATTTGCTCAAGG - Intronic
1144832802 17:18140889-18140911 GAGGCCAAGCCACTTGCCCAAGG - Intronic
1145064780 17:19754919-19754941 GAGGCTAAGTGATTTGCATAAGG + Intergenic
1145887031 17:28389182-28389204 GGGGTTAAGTAACTTGCCCAAGG - Intronic
1145907851 17:28526063-28526085 GAGGCCAAGTGACTTGCCCAGGG + Intronic
1146637290 17:34515793-34515815 GAGGCAAAGTGACTTGCCCAAGG - Intergenic
1146911462 17:36651037-36651059 GAGGTTGAGCGACTTGCCCAAGG - Intergenic
1146914555 17:36670141-36670163 GAGGGGAAGCGATTTGGCCAGGG + Intergenic
1146946520 17:36877416-36877438 GAGGCAAAGTGATTTCCCCAAGG + Intergenic
1146967984 17:37049116-37049138 GGGGCTAAGTAATTTACCTAAGG + Intronic
1147114574 17:38289397-38289419 TGGGCAAAGCAATTTGCCAAAGG + Intergenic
1147183062 17:38698965-38698987 GAGGGTAACCGCTTTGCCCAAGG + Intergenic
1147215123 17:38894450-38894472 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1147217854 17:38911396-38911418 GAGGCTAAGGGACCTGCCCAAGG - Intronic
1147364969 17:39953313-39953335 GGGGCAGAGCGGATTGCCCAGGG + Intergenic
1148076691 17:44941100-44941122 AGGGTTAAGCAATTTGCCCAAGG + Intronic
1148186790 17:45650193-45650215 GTGGCTAAGTAACTTGCCCAAGG - Intergenic
1148415037 17:47499807-47499829 TGGGCAAAGCGATTTGCCAAAGG - Intergenic
1148488865 17:48010432-48010454 AGAGCTAAGTAATTTGCCCATGG + Intergenic
1148630841 17:49107355-49107377 GAGGTTAAGGGACTTGCCCATGG + Intergenic
1148799355 17:50213561-50213583 GAGGTTAAGTAATTTGCCCAAGG + Intergenic
1148857495 17:50586693-50586715 GAGGCAAAGGGAATTGCCCAAGG + Intronic
1148902900 17:50891908-50891930 GAGGCAAAGTTATTTGCCCAAGG + Intergenic
1148965114 17:51428424-51428446 GGGGCTGAGCAGTTTGCCCAAGG - Intergenic
1149004637 17:51792932-51792954 GGGTGTAAGCAACTTGCCCAAGG + Intronic
1149559858 17:57600927-57600949 GAGGTTAAGCAGTTTGCCCAAGG + Intronic
1150228896 17:63539161-63539183 GAGGCAAAGTGACTTGCCCAAGG - Intronic
1150335411 17:64327042-64327064 GAGGCCAAGAAATTTGCCCATGG + Intronic
1151700867 17:75741974-75741996 AGGGTTAAGTGACTTGCCCAAGG + Intronic
1152383304 17:79953521-79953543 GAGGTTAAGTAATTTGCCCAAGG + Intronic
1152583388 17:81178797-81178819 GGGGCTGAGGGACCTGCCCAAGG - Intergenic
1152791533 17:82282868-82282890 GGGGATACACGATTTGCCCAGGG - Intergenic
1152852148 17:82643466-82643488 GAGGCTGAGAAATTTGCCCAAGG + Intronic
1155024829 18:21931554-21931576 GGGGTTAGGCAACTTGCCCAAGG - Intergenic
1155456518 18:26021246-26021268 GAGGTTAAGCAACTTGCCCAAGG - Intronic
1155566338 18:27138784-27138806 GAGGCAAAGAAATTTGCCCAGGG + Intronic
1155614948 18:27711298-27711320 GGGGCAAAATGACTTGCCCAAGG + Intergenic
1156539475 18:37895320-37895342 GGGGTTAAGTGATTTGCCCAAGG - Intergenic
1156550463 18:38010999-38011021 GAGGTTAAGCGATTTGCCCAAGG + Intergenic
1157298221 18:46461191-46461213 GGGGCCAAGGGACTTGCTCAAGG - Exonic
1157365676 18:47062000-47062022 GAGGTTAAGTAATTTGCCCAGGG - Intronic
1157558401 18:48628653-48628675 GGGATGAAGCGATTTGCCCAAGG + Intronic
1157600259 18:48889286-48889308 GAGGGGAAGTGATTTGCCCAAGG - Intergenic
1157699560 18:49752441-49752463 GAGGTTAAGTGACTTGCCCAGGG + Intergenic
1157895868 18:51466439-51466461 GAGGCTAAGCCATCTGGCCAAGG + Intergenic
1158299456 18:56035214-56035236 GGGGCCAAGAGAGTTTCCCAGGG - Intergenic
1158317490 18:56227627-56227649 AGGGCTAAGTGACTTGCTCAAGG + Intergenic
1158421788 18:57301342-57301364 GAGGCTAGGCGATGTGCCTAAGG - Intergenic
1158563221 18:58532825-58532847 GAGGCTAAGGCATTTGCCCAGGG + Intronic
1160172239 18:76564724-76564746 GAGGCCAAGGGATATGCCCAAGG - Intergenic
1161108069 19:2454530-2454552 GAGGGTAAGCGACTAGCCCAAGG + Intronic
1161225259 19:3141759-3141781 GAGGCAGAGCGACTTGCCCAAGG + Intronic
1161682103 19:5685219-5685241 GAGGTTAGGCGACTTGCCCAAGG - Intronic
1162151121 19:8646393-8646415 GAGGTTAAGCAATTTGTCCAAGG + Intergenic
1162322910 19:9980271-9980293 GTGGTTAAGTGACTTGCCCAAGG + Intronic
1163655288 19:18542309-18542331 GGGGCAAAGGCATTTGCCCAAGG + Intronic
1163793799 19:19323852-19323874 GAGGTAAAGTGATTTGCCCAAGG + Intronic
1164674021 19:30090021-30090043 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1164703204 19:30300916-30300938 GAAGCTAAGAGATTTGACCAAGG - Intronic
1165406818 19:35636108-35636130 CAGGCTAAGTGACTTGCCCAAGG - Intronic
1165416701 19:35698614-35698636 GGGGTTAAGCAATTTGCCAAAGG + Intergenic
1165829404 19:38723105-38723127 GAGGCCAAGAGGTTTGCCCAGGG + Intronic
1165838045 19:38771189-38771211 GGGGATGAGTGATTTCCCCAGGG - Intronic
1165841520 19:38791508-38791530 GGGGATGAGTGATTTCCCCAGGG + Intronic
1165893149 19:39126629-39126651 GAGGTTAAGTGATTTGCACAAGG + Intronic
1166195797 19:41204922-41204944 GGGGGGAAGTGATTTGCCCAAGG - Intronic
1166359440 19:42246868-42246890 GCTGCTAAGTGACTTGCCCAGGG - Intronic
1166767992 19:45263806-45263828 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1166790256 19:45395185-45395207 GAGGTTAAGTGACTTGCCCAAGG + Intronic
1167065578 19:47183318-47183340 AGGGCTAAGTCATTTGTCCAGGG + Intronic
1167537804 19:50066097-50066119 GAGGCTAAGTGACTTGCCCAAGG + Intergenic
1167574436 19:50311230-50311252 GAGGCTGAGTGACTTGCCCAAGG + Intergenic
1167601404 19:50457082-50457104 GAGGCTCAGAGACTTGCCCAAGG - Intronic
1167649322 19:50720765-50720787 GAGGCTAAGTAACTTGCCCAAGG + Intergenic
1167753582 19:51395608-51395630 GAGGCTAAGCAAATTACCCAAGG - Intergenic
1167797779 19:51721098-51721120 GAGGTTCAGCAATTTGCCCAAGG + Intronic
1168280129 19:55301375-55301397 GAGGCTCAGCAATTTGCCAAAGG - Intronic
924982638 2:236552-236574 GCAGCTCAGTGATTTGCCCAAGG - Intronic
925109246 2:1319580-1319602 GGGCCCAAGCGACGTGCCCAGGG - Intronic
926027323 2:9556179-9556201 GGGGCCCAGCGACCTGCCCAGGG + Intergenic
926160614 2:10486833-10486855 GAGGCCAAGTGACTTGCCCAGGG - Intergenic
926212004 2:10878305-10878327 GAGGCAAAGCAAGTTGCCCAAGG + Intergenic
926813546 2:16778212-16778234 AGGGCTCAGGGACTTGCCCAAGG + Intergenic
929599088 2:43194009-43194031 GAGGCTACGTGAGTTGCCCAAGG + Intergenic
929704912 2:44200215-44200237 GTGACTAAGAAATTTGCCCAAGG + Intronic
930137128 2:47913706-47913728 GAGGTTAAGGAATTTGCCCAAGG - Intergenic
931197466 2:60066282-60066304 GAGGTTAAGTAATTTGCCCAAGG + Intergenic
931697164 2:64879966-64879988 GAGGTTAAGTAATTTGCCCAAGG + Intergenic
931711594 2:64992588-64992610 GAGATTAAGCGATTTGCTCAAGG + Intronic
932005949 2:67927144-67927166 GAGGTTTAACGATTTGCCCAAGG - Intergenic
932113040 2:69018670-69018692 TGGGTTAAGTGACTTGCCCAAGG + Intronic
932113480 2:69023122-69023144 GAGGCTAAATAATTTGCCCAAGG - Intronic
932568882 2:72926615-72926637 GAGGTTAAGTGACTTGCCCAGGG - Intronic
934476572 2:94597535-94597557 GAGACTAAGCCTTTTGCCCAAGG + Intronic
934565427 2:95337692-95337714 GAGGCTAAGTTACTTGCCCAAGG + Intronic
934576334 2:95403734-95403756 GAGGTTAAGAGATTTGCCCAAGG - Intronic
934638517 2:96011563-96011585 GCGGTTAAGGGATTTGCCCAAGG - Intergenic
934795138 2:97093848-97093870 GCGGTTAAGGGATTTGCCCAAGG + Intronic
934970564 2:98760483-98760505 GGAGTTAAGCAATTTGCCCAAGG + Intergenic
935293390 2:101628167-101628189 GGGGCTGAGTGAGTTGCGCAAGG + Intergenic
935985384 2:108667357-108667379 GAGGTTAAGCAACTTGCCCAAGG + Intronic
936012142 2:108931578-108931600 GAGGTTAAGTGATTTGCCCCAGG + Intronic
936284616 2:111172730-111172752 GTGGTTAAGCCACTTGCCCAGGG + Intergenic
936487316 2:112937343-112937365 GAGGCTGAGCAAATTGCCCAAGG + Intergenic
936562303 2:113551503-113551525 GAGGCTAGGCGACTTCCCCACGG - Intergenic
937227607 2:120378756-120378778 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
937228215 2:120381908-120381930 GAGGCCAAGCAACTTGCCCAAGG - Intergenic
937671006 2:124537149-124537171 GGTACTAAGTAATTTGCCCAAGG + Intronic
938201384 2:129375625-129375647 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
939431368 2:142113125-142113147 GAGGCTAAGTGACTTGCCCAAGG + Intronic
939609457 2:144292028-144292050 GGAGCTAAATGACTTGCCCAAGG - Intronic
939933720 2:148262614-148262636 GGGGTTAAGTAATTTGTCCAAGG + Intronic
940719683 2:157268580-157268602 GGGCCTAACTGACTTGCCCATGG + Intronic
940864769 2:158807121-158807143 AGCGCTATGTGATTTGCCCACGG - Intronic
941034313 2:160551090-160551112 GGGGTTAAGTGACTTGCCCAAGG - Intergenic
941469936 2:165872030-165872052 TGGACTAAATGATTTGCCCAGGG - Intronic
941964298 2:171285615-171285637 GGGGCTAAATGATTTGCCCAAGG + Intergenic
942444544 2:176069303-176069325 GTGGTTAAGCAAGTTGCCCAAGG - Intergenic
942521696 2:176810799-176810821 GAGGCAAAGTGACTTGCCCAAGG + Intergenic
942543327 2:177037281-177037303 GAGGCTAAGCAACTTGCCCAAGG + Intergenic
942608257 2:177714489-177714511 GAGGCTAAGTCATATGCCCAGGG + Intronic
942760724 2:179394419-179394441 GGGGTTAAGTGGCTTGCCCAAGG + Intergenic
942782123 2:179656365-179656387 GAGGGTAAGTGATTTGCCAAGGG + Intronic
942833885 2:180269013-180269035 GAGGCTAAGTAACTTGCCCAAGG - Intergenic
942959675 2:181815012-181815034 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
943772026 2:191728276-191728298 AAGGTTAAGCAATTTGCCCAAGG - Intergenic
944680993 2:202076654-202076676 GTAGATAAGTGATTTGCCCAAGG + Intronic
944687059 2:202126805-202126827 GAGGTTAAGTGACTTGCCCAAGG + Intronic
945049990 2:205814544-205814566 GAGGCTAAGTAATTTGCCCTTGG - Intergenic
945216021 2:207434936-207434958 AGGACTAAGCGACTGGCCCAAGG + Intergenic
945440751 2:209876213-209876235 GGGGCTAGGAGGTTTGCCCAAGG - Intronic
945518879 2:210798384-210798406 GGGGTTAAGTGATTTGCCTCAGG - Intergenic
945979797 2:216300128-216300150 GAGGCTAAGGGAATTGCCCAAGG - Intronic
946024416 2:216663377-216663399 TGGGCTAAGCAACTTGCCCAAGG - Intronic
946625444 2:221607657-221607679 GAGGCCAAGTAATTTGCCCAAGG + Intergenic
947745495 2:232505261-232505283 GAGGCTAAGTGACTTGTCCAAGG - Intergenic
947897292 2:233687509-233687531 GGGGTTGAGTGACTTGCCCAAGG + Intronic
948118103 2:235508864-235508886 GCATCAAAGCGATTTGCCCAGGG + Intronic
1168810290 20:700410-700432 GGGGCTTAGCCATTAGCTCAAGG + Intergenic
1168820222 20:768006-768028 GAGGCAAAGCCACTTGCCCAGGG - Intronic
1168833479 20:860529-860551 GAAGTTAAGTGATTTGCCCAAGG - Intergenic
1168855263 20:1003361-1003383 GAGGCCAAGTGACTTGCCCAAGG + Intergenic
1168982912 20:2023219-2023241 GAGGTTAAGTGATTTGTCCAAGG + Intergenic
1169014852 20:2283178-2283200 GGGGTTAAGTAACTTGCCCAAGG - Intergenic
1169221133 20:3823725-3823747 GAGACTAAGTGATCTGCCCAGGG - Intronic
1169277934 20:4246058-4246080 GGGGTTAAGGGATTTGCCCACGG + Intronic
1170267331 20:14481756-14481778 GAGGTTAAGTTATTTGCCCAAGG - Intronic
1170505973 20:17026247-17026269 GAGGTTAAGCCATTTGGCCAAGG - Intergenic
1170594608 20:17795554-17795576 GAGGTTAAGCGATTTGCCCAAGG + Intergenic
1170603072 20:17856370-17856392 GGGGCCGGGAGATTTGCCCAAGG + Intergenic
1171436630 20:25129883-25129905 GGGGCCAAGTTAGTTGCCCAAGG - Intergenic
1171498208 20:25572565-25572587 GAGGCTAAGCAATTTGCCCAAGG + Intronic
1172357955 20:34292717-34292739 GAGGTGAAGTGATTTGCCCAAGG - Intronic
1172430489 20:34887170-34887192 GAAGCTAAGTGATTTGCCTAAGG + Intronic
1172494225 20:35367189-35367211 GGGGAGAAGTGATTTGTCCAAGG - Intronic
1172494605 20:35370922-35370944 GGGGCTAAGTGACTCACCCAGGG - Intronic
1172495895 20:35383900-35383922 GGGGTAAAGTGACTTGCCCAAGG - Intronic
1172596166 20:36152757-36152779 GTGGCAAAGTGACTTGCCCAAGG + Intronic
1172624010 20:36337141-36337163 GAGGTTAAGTGACTTGCCCAAGG + Intronic
1172692613 20:36800576-36800598 GAGGCAAAGTGATTTGCCCAAGG - Intronic
1172796039 20:37538428-37538450 GAGGTTAAGTGATTTGCTCAAGG + Intergenic
1172865559 20:38094460-38094482 AGGGCTGAGTGACTTGCCCAAGG - Intronic
1172928388 20:38562322-38562344 GGGGTTAAGAAACTTGCCCAAGG + Intronic
1172950080 20:38717559-38717581 GAGGTTAAGTGACTTGCCCATGG - Intergenic
1173027220 20:39319577-39319599 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1173127516 20:40353539-40353561 GAGGAGAAGTGATTTGCCCAAGG + Intergenic
1173297909 20:41775564-41775586 GGGCTTAAGTGACTTGCCCAAGG - Intergenic
1173414225 20:42841294-42841316 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1173434266 20:43018092-43018114 GAGGTTGAGGGATTTGCCCACGG + Intronic
1173528751 20:43752364-43752386 GGGTCTAAGTAATTTTCCCAAGG + Intergenic
1173556278 20:43968322-43968344 GCAGTTAAGCAATTTGCCCAAGG + Intronic
1173577244 20:44120558-44120580 CAGGTTAAGCAATTTGCCCAAGG + Intronic
1173583428 20:44163637-44163659 GAGGTTAAGCAATTTGACCAAGG + Intronic
1173626494 20:44476481-44476503 TAGGTTAAGCGATTCGCCCAAGG - Intronic
1173659242 20:44721852-44721874 GAGGCTAAGCAACTTGCCCAAGG + Intronic
1173772002 20:45668023-45668045 GGAGCTAAGCAACTTGCCCAAGG + Intronic
1173871402 20:46344250-46344272 GAGGCCAAGTGACTTGCCCAAGG - Intergenic
1173902236 20:46599291-46599313 GGAGCCAAGCGATCTGCTCAAGG - Intronic
1173907169 20:46637757-46637779 GAGGCTAAGTAACTTGCCCAAGG + Intronic
1173993848 20:47323014-47323036 GAGGCTAAGAAACTTGCCCAAGG - Intronic
1174085484 20:48004907-48004929 GGGGATAAGAGAGCTGCCCAGGG + Intergenic
1174106548 20:48166257-48166279 GAGGCCAAGCAACTTGCCCAAGG - Intergenic
1174207970 20:48854919-48854941 GGAGGTAATCAATTTGCCCAGGG - Intergenic
1174224806 20:48989091-48989113 GGGGGTAAGTCACTTGCCCAGGG - Intronic
1174396496 20:50250175-50250197 GAGGTTAAGAGACTTGCCCAAGG + Intergenic
1174412478 20:50344886-50344908 GAGGCTAAGTGATTTGCCCAAGG - Intergenic
1174483397 20:50846313-50846335 AAGGCTAAGAGACTTGCCCATGG - Intronic
1174621761 20:51880364-51880386 GAGGTTAAGTGACTTGCCCATGG + Intergenic
1175011498 20:55742241-55742263 GGGGTTAAGGGAATTGACCAAGG - Intergenic
1175159405 20:56996711-56996733 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1175219033 20:57406450-57406472 GGGGCCAGGTGAGTTGCCCAAGG - Intronic
1175248719 20:57596559-57596581 GAGGTTAAGCTACTTGCCCAAGG - Intergenic
1175319293 20:58074092-58074114 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1176266925 20:64214505-64214527 GAGGCTCAGAGAGTTGCCCAAGG + Intronic
1178381361 21:32112318-32112340 GAGGCTAATCAATTTGTCCAAGG - Intergenic
1178678107 21:34647876-34647898 GAAGGTAAGCAATTTGCCCAAGG - Intergenic
1178699173 21:34819025-34819047 GAGGTTAAGAGACTTGCCCAGGG - Intronic
1179594740 21:42435102-42435124 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1180015372 21:45078945-45078967 GTGGTTAAGTGATTTACCCAAGG + Intronic
1180788101 22:18558147-18558169 GGGGTTAAGCAACTTGCCCAGGG + Intergenic
1181233637 22:21437171-21437193 GGGGTTAAGCAACTTGCCCAGGG - Intronic
1181245013 22:21497672-21497694 GGGGTTAAGCAACTTGCCCAGGG + Intergenic
1181529460 22:23508648-23508670 GAGGTTAAGTGAGTTGCCCAAGG - Intergenic
1181764099 22:25078953-25078975 AGGGCTAAGAGATTTGCTCGAGG - Intronic
1181913975 22:26264357-26264379 GAGGTTAAGTGATTTGCCAAAGG - Intronic
1181936913 22:26445609-26445631 GAGGCTAAGGGACTTGCCCAAGG - Intronic
1181940186 22:26469948-26469970 GAGGCTAAGCAACTTGCCCAAGG + Intronic
1181974421 22:26718692-26718714 GTGGTTAAGTGATTTGCTCAAGG - Intergenic
1181983197 22:26781246-26781268 GAGGTTAAGCAACTTGCCCATGG + Intergenic
1182070641 22:27461414-27461436 GAGGTTAAGTGACTTGCCCAGGG + Intergenic
1182167418 22:28190323-28190345 GAGGTTAAGTGACTTGCCCAAGG + Intronic
1182202248 22:28585687-28585709 GGGGCTAGTTGATTTGTCCAAGG + Intronic
1182288973 22:29264609-29264631 GAGGTTAAGTGATTTGACCAGGG - Intronic
1182655064 22:31883647-31883669 GAGGCGAAGTAATTTGCCCAAGG + Intronic
1182686968 22:32128499-32128521 GAGGCGAAGGGATTTGTCCAAGG + Intergenic
1182851513 22:33478609-33478631 GGGGCTAATTGACTTGGCCAAGG - Intronic
1183075476 22:35423969-35423991 GAGGCTAAGCCACTTGCTCAAGG - Intronic
1183082089 22:35463151-35463173 GGGGCTCAGGGACTAGCCCACGG + Intergenic
1183248890 22:36714298-36714320 GAGGGTAAGCAACTTGCCCAAGG + Intergenic
1183383390 22:37501688-37501710 GAGGTTAAGCAACTTGCCCAGGG - Intronic
1183393222 22:37557573-37557595 TGGGCCAAGTGCTTTGCCCACGG + Intergenic
1183669069 22:39261613-39261635 GGGGCTGAGCAGCTTGCCCATGG + Intergenic
1183850623 22:40584257-40584279 GGTTGTAAGCAATTTGCCCAAGG + Intronic
1183935281 22:41258336-41258358 GAGGCGAAGTGACTTGCCCAGGG + Intronic
1184340996 22:43885788-43885810 GAAGTTAAGCGACTTGCCCAAGG - Intronic
1184476945 22:44727119-44727141 GATGATAAGTGATTTGCCCAAGG + Intronic
1184575762 22:45364526-45364548 AGAGCTAAGCAACTTGCCCAAGG + Intronic
1184750362 22:46482528-46482550 GAGGTTAAGTGACTTGCCCAAGG + Intronic
949796917 3:7861356-7861378 GGGTCTAAGTTATTTTCCCAGGG - Intergenic
949956968 3:9277011-9277033 GAGGTTAAGTGACTTGCCCAAGG - Intronic
950080224 3:10216647-10216669 GAGGTTAAGGGACTTGCCCAAGG - Intronic
950133171 3:10561514-10561536 GAGGTGAAGTGATTTGCCCAAGG + Intronic
950182986 3:10928019-10928041 GGGAGTAAGCAATTTACCCAAGG - Intronic
950271557 3:11620195-11620217 GTGGCTCAGCAACTTGCCCAAGG + Intronic
950432402 3:12958383-12958405 GAGGCCAAGTCATTTGCCCAGGG - Intronic
950554237 3:13685649-13685671 GAAGCTAAGTGACTTGCCCAAGG - Intergenic
950580582 3:13859339-13859361 GAGGTTAAGTGACTTGCCCAAGG - Intronic
950628925 3:14268319-14268341 GAGGCAAAGAGACTTGCCCAAGG - Intergenic
950673844 3:14542844-14542866 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
950874527 3:16258580-16258602 GGGCCCAAGCAATTTGCTCAAGG + Exonic
951107945 3:18767839-18767861 AGGGCTAAGTGACTTGCACAAGG + Intergenic
951460586 3:22947148-22947170 GAGGCTAGGTGACTTGCCCAAGG - Intergenic
951703571 3:25521701-25521723 GAGGTTAAGTGACTTGCCCATGG - Intronic
951853785 3:27171571-27171593 GAGGCTAACTGATTTGCTCAAGG + Intronic
952597820 3:35040412-35040434 GGGGTTAAGTGATTTGCCTATGG + Intergenic
953388959 3:42523487-42523509 GAGGTTAAGTCATTTGCCCATGG - Intronic
953691736 3:45125421-45125443 GAAGCTAAGGAATTTGCCCAAGG - Intronic
953791080 3:45948822-45948844 GAGGCTAAGAGATTCGCCCAAGG - Intronic
954575354 3:51672730-51672752 GAGGTTAAGAGACTTGCCCAAGG - Intronic
954726734 3:52618386-52618408 GGGGGTAAAAGACTTGCCCAAGG + Intronic
955217929 3:56999997-57000019 GGGGTTAAGTCATTTGCCCAAGG - Intronic
955358754 3:58254176-58254198 GAGGCTAAGTAACTTGCCCAAGG - Intronic
955398633 3:58575240-58575262 GAGGTTAAGCTACTTGCCCAAGG - Intronic
955408552 3:58641347-58641369 GAGGTTAAGCAACTTGCCCAAGG - Intronic
955928501 3:64031713-64031735 GAGGTTAAGCAATTTGACCAAGG + Intergenic
956574659 3:70738866-70738888 GGGATTAAGTAATTTGCCCAGGG - Intergenic
956752617 3:72355379-72355401 AAGGCTAAGCCACTTGCCCAAGG + Intergenic
958737398 3:98024974-98024996 GAGGTTAAGAGATTTGCCCAAGG - Intronic
958889559 3:99768490-99768512 TGGGGTAAGTGATTTGACCAAGG + Intronic
958924852 3:100146464-100146486 GAGGTAAAGCCATTTGCCCAAGG - Intronic
958986156 3:100781894-100781916 GAGATTAAGCAATTTGCCCAAGG + Intronic
959084634 3:101838332-101838354 GAGATTAAGAGATTTGCCCAAGG + Intronic
959098022 3:101977052-101977074 GGGGTTAAGTGATTTGCCCAAGG + Intergenic
959156173 3:102668496-102668518 GAGGTTAAGTGAGTTGCCCAAGG - Intergenic
959541339 3:107542697-107542719 GAGGCTCAGCAACTTGCCCAAGG + Intronic
960198192 3:114797023-114797045 GGAGTTAAGCAATTTGCCCCAGG - Intronic
960325557 3:116291412-116291434 GAGGTTAAGCGTCTTGCCCAAGG - Intronic
960624110 3:119663501-119663523 GAGGCTAAGGAACTTGCCCAAGG + Intronic
960702923 3:120454562-120454584 GGGGTTAAGTAACTTGCCCAAGG - Intergenic
961007527 3:123414921-123414943 GGGGCTAAGTAACCTGCCCAAGG + Intronic
961032760 3:123620834-123620856 GTGGTTAAGTGACTTGCCCAAGG - Intronic
961379373 3:126487241-126487263 GAGGCTGAGCAGTTTGCCCAGGG - Intronic
961409233 3:126706332-126706354 GGAGTTAAGGAATTTGCCCAAGG + Intronic
961519773 3:127460342-127460364 GAGGCAAAGCAACTTGCCCATGG + Intergenic
961620221 3:128217969-128217991 GGGGTTAAGGGGTTTGCTCAAGG + Intronic
961699062 3:128727264-128727286 GAGGCTAAGCCATTTGGCCAAGG + Intronic
962145748 3:132837809-132837831 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
962204413 3:133423295-133423317 GAGGTTAAGCGATTTGCCTTGGG - Intronic
962235788 3:133706049-133706071 GGGACTGAGTGACTTGCCCAGGG + Intergenic
962347469 3:134628788-134628810 GGGGTTAGGCCACTTGCCCAAGG + Intronic
962354078 3:134678689-134678711 GAGGCTAAGCAACTTACCCAAGG + Intronic
962853434 3:139324840-139324862 AGGGCTAAGGGATGGGCCCAGGG + Intronic
962930669 3:140032782-140032804 GAGACCAAGGGATTTGCCCAAGG - Intronic
962941333 3:140127249-140127271 GAGGTTAAGCAATTTGCCCCGGG - Intronic
963850544 3:150206524-150206546 GAAGCTAAGCCATTTGCCCAAGG + Intergenic
963869227 3:150396501-150396523 TGGGCTGAGTGATTTGCTCAAGG + Intergenic
963933563 3:151029037-151029059 GGGGTGCAGTGATTTGCCCAAGG + Intergenic
963940171 3:151089448-151089470 GAGGCTATGCAACTTGCCCAAGG - Intronic
964022540 3:152031151-152031173 GAGGTTAAGCAATATGCCCAAGG - Intergenic
964820655 3:160765186-160765208 GAGGTTAAGTAATTTGCCCATGG + Intronic
964879610 3:161408968-161408990 GGGGCCAAAAGACTTGCCCAAGG + Intergenic
965616552 3:170599391-170599413 AAGGTTAAGTGATTTGCCCAAGG - Intronic
966328189 3:178780716-178780738 GAGGTTAAGTAATTTGCCCAAGG - Intronic
966416775 3:179697340-179697362 GGAGGTAAGCGATCTGTCCAAGG - Intronic
966586221 3:181628559-181628581 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
966870268 3:184285769-184285791 GAGGCTAGGTGATCTGCCCAAGG - Intronic
966940516 3:184743402-184743424 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
967007384 3:185397352-185397374 GAGGTTAAGTGACTTGCCCAAGG + Intronic
967298531 3:187989574-187989596 GGGGCGGAGCGATTTGTCCCAGG - Intergenic
967377269 3:188818708-188818730 GAGGTTAAGCAATTTGCCCAAGG - Intronic
968719900 4:2194149-2194171 GAGGTTAAGCAATTTGGCCAGGG + Intronic
968794084 4:2690381-2690403 GAGGCCAAGCAACTTGCCCAAGG - Intronic
968960920 4:3743242-3743264 GAGGCTGATTGATTTGCCCACGG - Intergenic
969373861 4:6750390-6750412 GGGGCTAGGGAACTTGCCCAAGG + Intergenic
969499170 4:7542798-7542820 GGGGCTGAGTAATTTGCTCAGGG + Intronic
969583451 4:8078690-8078712 GAGGTTAAGTGAGTTGCCCAGGG - Intronic
970437690 4:16051341-16051363 GTGGCTAAGCCACCTGCCCAAGG - Intronic
970489073 4:16553856-16553878 GGGATTAAGTGATTTGCCTAAGG + Intronic
970678538 4:18480568-18480590 GGGGAGAAGAGATTTGCTCAAGG - Intergenic
971073310 4:23119776-23119798 GGGGTTAAGTGACTTGGCCAAGG + Intergenic
971465628 4:26956871-26956893 GAGGCTAAGTAATTTGCCCAAGG - Intronic
972294899 4:37728285-37728307 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
972308868 4:37860480-37860502 GAGGCCAAGCCACTTGCCCAAGG + Intronic
972423177 4:38909186-38909208 GGGGCTAAGTAACTTGCCCAAGG - Intronic
972450244 4:39190472-39190494 GGGGTTAAGCAATTTGTCCAAGG - Intronic
972552957 4:40149934-40149956 AGAGCTAAGTAATTTGCCCAAGG + Intronic
972665426 4:41160556-41160578 GTCGCTGAGGGATTTGCCCAAGG - Intronic
972734274 4:41825464-41825486 GAGGTTAAGTGATTTGCCCAGGG + Intergenic
973205504 4:47555501-47555523 GAGGCTAAGTAATTTACCCAGGG + Intronic
973325364 4:48855193-48855215 GAAGCTTAGTGATTTGCCCAAGG + Intronic
973710914 4:53629592-53629614 GTGGCAAAGCCATTTGGCCATGG + Intronic
974083632 4:57237198-57237220 GAGGCTAAGTGACTTGCCCAGGG + Intergenic
974097125 4:57375604-57375626 GAGGCTAGGCAATTTACCCAAGG - Intergenic
974820013 4:67054654-67054676 GTGGCCAAGAAATTTGCCCAAGG + Intergenic
974823707 4:67100297-67100319 GGTGTTAAGCAACTTGCCCAAGG - Intergenic
975472470 4:74785811-74785833 GGGATTAAGCAACTTGCCCAAGG - Intronic
975608048 4:76175545-76175567 GTGGTTAAGTAATTTGCCCAAGG + Intronic
975847131 4:78536505-78536527 GGGGCTAAGTGATTTGCTGAAGG - Intronic
975950570 4:79765149-79765171 GAGGCTAAGTGACCTGCCCAGGG - Intergenic
976020139 4:80613101-80613123 GGAGCTATGCAATTTCCCCAAGG + Intronic
976701572 4:87974994-87975016 TAGGCTGGGCGATTTGCCCAAGG + Intergenic
976812853 4:89115543-89115565 GGGGTTAAGTAATTTGCCGATGG - Intergenic
978162827 4:105569713-105569735 GAGGTTAAGCAGTTTGCCCAAGG - Intronic
978367251 4:107995259-107995281 GGAGTTAAGTGATTTGCCCAAGG - Intronic
978459463 4:108935031-108935053 GAGGTTAAGTGACTTGCCCAAGG + Intronic
978757425 4:112318441-112318463 AAGGCTAAGTGATTAGCCCAGGG + Intronic
979193301 4:117890081-117890103 GGGGCTAAGTGAACTGTCCAGGG + Intergenic
980076848 4:128303032-128303054 GAGGGTAAGTGATTTGCCTAAGG + Intergenic
981185048 4:141791501-141791523 GAGGTTAAGCAATTTGCCTAGGG + Intergenic
981549562 4:145929920-145929942 GAAGATAAGCAATTTGCCCAAGG + Intronic
981693633 4:147536862-147536884 GAGATTAAGCAATTTGCCCAAGG - Intronic
981887988 4:149700701-149700723 GAGGCTAAGTGACTTTCCCAAGG - Intergenic
982172626 4:152676464-152676486 GAGGCTAAGTGACTTGCCCAAGG - Intronic
982231049 4:153208619-153208641 GAGGGTAAGTGACTTGCCCAAGG - Intronic
982273732 4:153618627-153618649 GAGGCTAAGTAACTTGCCCAAGG + Intronic
982770394 4:159391695-159391717 TGGGGTAAGCAATTTGCCAAGGG + Intergenic
983012907 4:162570851-162570873 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
983690871 4:170467312-170467334 GGGTCTGAGGGATTTGGCCATGG + Intergenic
985497286 5:216564-216586 GAGCTTAAGTGATTTGCCCACGG + Intronic
985738294 5:1598392-1598414 GAGCTTAAGTGATTTGCCCACGG - Intergenic
986069636 5:4269481-4269503 GGGGTTAAATAATTTGCCCAAGG + Intergenic
986178572 5:5372763-5372785 GAGGCTGAGCCAGTTGCCCAAGG - Intergenic
986672347 5:10153563-10153585 GAGGGTAATCAATTTGCCCAAGG - Intergenic
988167319 5:27610781-27610803 GAGGGTAAGCAATTTGTCCAAGG + Intergenic
988533947 5:32049577-32049599 GGGGTTAAGTATTTTGCCCAAGG + Intronic
988821569 5:34891310-34891332 GAGGTTAAGTCATTTGCCCAAGG - Intronic
989018805 5:36974498-36974520 GAGGTTAAGAAATTTGCCCAAGG - Intronic
989127871 5:38074469-38074491 GGGGCCAAGCCATATGGCCAGGG - Intergenic
989151323 5:38302406-38302428 GAGGCTCAGAGACTTGCCCAAGG - Intronic
989659545 5:43785438-43785460 GGGGTTAAGTGATATGGCCAAGG + Intergenic
989791220 5:45403891-45403913 GAACCTAAGCGACTTGCCCAGGG + Intronic
990045474 5:51425204-51425226 GGGGGTAAGTGACTTGCCCAAGG - Intergenic
990325490 5:54671371-54671393 GAGGTTAAGTGATTTCCCCAAGG + Intergenic
990347788 5:54886242-54886264 GAGGCTAAGGGACTTGCCCTGGG - Intergenic
990361305 5:55022833-55022855 GAGGCTAAGTAATTTGCCCAAGG - Intergenic
990648656 5:57873216-57873238 GTGACTAAGTGATTTGCCCAAGG - Intergenic
990653531 5:57929230-57929252 CAGGTTAAGCAATTTGCCCAAGG + Intergenic
991085859 5:62647940-62647962 GAGGTTAAGTGATTTGCCCAAGG + Intergenic
991110902 5:62897979-62898001 GAGGATAAGCAAATTGCCCAAGG - Intergenic
991925449 5:71701001-71701023 GAGGCTAAGTAATTTGCCCAAGG - Intergenic
992250250 5:74868930-74868952 GAAACTAAGCAATTTGCCCATGG + Intergenic
992322775 5:75630038-75630060 GAGTCTTTGCGATTTGCCCAAGG + Intronic
992562208 5:77963984-77964006 GAGGATAAGCGACTTGCCCAAGG - Intergenic
992625782 5:78634720-78634742 GAGGCAAAATGATTTGCCCAAGG + Intronic
992762881 5:79966911-79966933 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
993295896 5:86139545-86139567 CTGGCTAAGCAATTTGACCAAGG - Intergenic
993488408 5:88515290-88515312 ATGGTTAAGCAATTTGCCCAAGG + Intergenic
994046274 5:95313844-95313866 AGGGTTAAGTGACTTGCCCATGG - Intergenic
994707107 5:103220293-103220315 GAGGGTAAGCGATTTGCCCAGGG - Intergenic
995106494 5:108381887-108381909 GGGGCTACATGCTTTGCCCAGGG + Exonic
995793798 5:115921627-115921649 GGGGCTAAGCTTTTTGCACTTGG - Intergenic
996019950 5:118579866-118579888 GAGGATAAGTGATTTGCACAAGG - Intergenic
996187950 5:120502651-120502673 GGGATTAAAAGATTTGCCCAAGG - Intronic
996347649 5:122504339-122504361 GAGGCTAAGTAATATGCCCAAGG + Intergenic
997199142 5:131999226-131999248 GGGGCAAAGTGACCTGCCCAAGG - Intronic
997359581 5:133286185-133286207 GAGGTTAAGAAATTTGCCCAAGG - Intronic
997549832 5:134742327-134742349 GAGGTTAAACCATTTGCCCAAGG + Intronic
997609786 5:135207701-135207723 GAGGCGAAGGGACTTGCCCAAGG - Intronic
997846856 5:137294405-137294427 GAAGCTAAGTGATCTGCCCAAGG + Intronic
997935417 5:138106223-138106245 GTGGCTAAGAGATGTGCCCAAGG - Intergenic
998311993 5:141142499-141142521 GAGGTAAAGCAATTTGCCCAAGG + Intronic
998416159 5:141947578-141947600 GAGGTTAAGCCATTTTCCCAAGG - Intronic
998526412 5:142847080-142847102 GAGGCACAGTGATTTGCCCAAGG - Intronic
999098284 5:149000979-149001001 GAGGTTAAGTGACTTGCCCAAGG + Intronic
999099516 5:149011537-149011559 GAGGCTGAGTAATTTGCCCAAGG - Intronic
999150053 5:149420881-149420903 GAGCCTGTGCGATTTGCCCAGGG - Intergenic
999221268 5:149980093-149980115 AGGGCTAAGCAACTTGCCCAAGG - Intronic
999245713 5:150153498-150153520 GAGGCTAAGTGACTTTCCCAGGG - Intronic
999340450 5:150765536-150765558 AGGCCTAAGAGATTTGCGCAGGG + Intergenic
999702441 5:154240245-154240267 GAAGTTAAGAGATTTGCCCAAGG - Intronic
999802710 5:155052698-155052720 GAGGCAAAGTGACTTGCCCAAGG - Intergenic
1000047144 5:157531125-157531147 GGAGCAAAGAGATTTGCCCAAGG + Intronic
1000126975 5:158255033-158255055 GAGGTTAAGCAACTTGCCCAAGG + Intergenic
1000132916 5:158317385-158317407 GGGGTTAAGTGATTTGCTCAAGG + Intergenic
1000135600 5:158347297-158347319 AGGGTTTAGCCATTTGCCCAAGG - Intergenic
1000247808 5:159463433-159463455 GGGACTAAGTGACTTGCACAAGG + Intergenic
1000250818 5:159493354-159493376 GGGGTTAAGGGATTTGCTCAAGG - Intergenic
1000255357 5:159533119-159533141 GTGACAAAGCAATTTGCCCAAGG + Intergenic
1000988216 5:167883933-167883955 GGGTCTAAGAGATGTACCCAGGG - Intronic
1001035752 5:168295165-168295187 GAGGTCAAGTGATTTGCCCAAGG - Intronic
1001088831 5:168722022-168722044 GGGGCTCAGTGATTTGCTCAAGG + Intronic
1001184214 5:169552232-169552254 GAAGCTAAGCAATTTGACCAAGG - Intergenic
1001213928 5:169837701-169837723 GAGGAAAAGCAATTTGCCCAAGG + Intronic
1001375757 5:171256230-171256252 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1001414727 5:171537128-171537150 GGGGTTAAGCCAAATGCCCAAGG - Intergenic
1001483453 5:172103922-172103944 GAGGTTAAGCCATTTGCCCAGGG + Intronic
1001518646 5:172374954-172374976 GAGGCTAAGTAATTTGCTCAAGG + Intronic
1001524378 5:172418353-172418375 GGGGTTAAGGGGTGTGCCCAAGG + Intronic
1001568485 5:172715318-172715340 GGGGCGTGGTGATTTGCCCAAGG - Intergenic
1001607573 5:172973300-172973322 GAGGTTAAGCAGTTTGCCCAAGG - Intergenic
1001751528 5:174135095-174135117 GGGGCTGAGCACCTTGCCCATGG + Intronic
1002979399 6:2121080-2121102 GGGGTTGAGTGACTTGCCCAGGG + Intronic
1003377086 6:5589236-5589258 GAGGCTAAGAAATTTGCCCAGGG - Intronic
1003422082 6:5967712-5967734 AAGGTTAAGTGATTTGCCCAAGG - Intergenic
1003728419 6:8792449-8792471 GAGGTTAAGGGATTTTCCCAAGG + Intergenic
1003832905 6:10034395-10034417 GAGGTTAAGTAATTTGCCCAAGG - Intronic
1003849712 6:10209243-10209265 GGGGTTAAATAATTTGCCCAAGG + Intronic
1003854114 6:10254656-10254678 GGGGTTAAGTAATTTGCCCATGG + Intergenic
1004153213 6:13141172-13141194 GGGGATAAAGGATTTGGCCATGG - Intronic
1004165387 6:13252158-13252180 TGGTCTAAGCGATCTGCCCTGGG - Intronic
1004539703 6:16538236-16538258 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1004548194 6:16619935-16619957 GAGGATAAGCAACTTGCCCAAGG - Intronic
1004566878 6:16806520-16806542 GGGGCTAATCAACCTGCCCAAGG + Intergenic
1004759919 6:18655314-18655336 GGGGTTAAGCAATATTCCCATGG - Intergenic
1004970077 6:20899933-20899955 GGATCTAAGCGATCTGACCAAGG + Intronic
1005099692 6:22157430-22157452 GCGGTTAAGAGATTTGCCCAAGG + Intergenic
1005247812 6:23908921-23908943 GGGCAGAAGTGATTTGCCCAAGG + Intergenic
1005356259 6:24986255-24986277 GTGGCTAAGTAACTTGCCCAAGG + Intronic
1005892242 6:30149474-30149496 GAGGCTAAGTAATTTGCCCAAGG - Intergenic
1006168636 6:32080611-32080633 GAGGTTAAGCAATTTGCACAAGG + Intronic
1006378282 6:33683780-33683802 GAGGCTAAGGGGTTTGCCCAAGG + Intronic
1006454929 6:34126226-34126248 GAAGCTAAGCAACTTGCCCAAGG - Intronic
1006615056 6:35320541-35320563 GAGGTTAAGTGACTTGCCCAGGG - Intronic
1006643313 6:35499388-35499410 GAGGTTAAGCAACTTGCCCACGG - Intronic
1006717236 6:36128369-36128391 GAGGCTAAGTAATTTGCCCAAGG - Intronic
1006908322 6:37547766-37547788 GAGGCTAAGCGACTTACCCAAGG + Intergenic
1006945269 6:37780319-37780341 GAGGCTGAGTGATTTGCCCGAGG + Intergenic
1007038622 6:38701182-38701204 GGTGTTGAGTGATTTGCCCAGGG - Intronic
1007235480 6:40388288-40388310 GGGGTTAAGTAACTTGCCCAAGG - Intergenic
1007324434 6:41049260-41049282 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1007332051 6:41119676-41119698 GAGGCTAAGTGATTTGCTCTAGG - Intergenic
1007415963 6:41691361-41691383 GAGGGGAAGAGATTTGCCCAAGG + Intronic
1007416240 6:41692929-41692951 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1007462348 6:42027699-42027721 GAGGCTAAGAGATCTGTCCAGGG - Intronic
1007482058 6:42156767-42156789 GAGGCTCAGCCACTTGCCCAAGG + Intronic
1007683604 6:43651253-43651275 GAGGTTAAGTGATGTGCCCAAGG + Intronic
1007843510 6:44735721-44735743 GGGGCAAAGGGGTTTTCCCAAGG + Intergenic
1008918347 6:56815051-56815073 GAGGATAAGCGACTTGCCCACGG - Intronic
1009044014 6:58216102-58216124 GAGGTTAGGCAATTTGCCCAAGG - Intergenic
1009219844 6:60970375-60970397 GAGGTTAGGCAATTTGCCCAAGG - Intergenic
1009469606 6:64016374-64016396 GGGGTTAAGTAATTTGCTCAAGG + Intronic
1011108737 6:83812782-83812804 GAGGTTAAGCAATTTGCCCAAGG + Intergenic
1011599051 6:89043034-89043056 GAGGTTAAACGATTTGCCCAAGG - Intergenic
1012177630 6:96108371-96108393 GAGGTTAAGCAATTTGTCCAAGG - Intronic
1012651339 6:101757595-101757617 GGGGATGAGCGATTCGCCTAAGG + Intronic
1013011517 6:106125024-106125046 GGGGACAAGCGACCTGCCCATGG + Intergenic
1013415751 6:109922876-109922898 GGGGTGAAGGGATTTACCCAAGG - Intergenic
1014020028 6:116576144-116576166 GAGGCTAAGTGATTTGTCCAAGG - Intronic
1015107263 6:129551486-129551508 GAGGCAAAGCAATTTACCCAAGG - Intergenic
1015627293 6:135192754-135192776 GATGGTAAGCGCTTTGCCCAGGG + Intronic
1016645947 6:146408365-146408387 GAAGTTAAGCAATTTGCCCAAGG - Intronic
1016806478 6:148217245-148217267 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1017268568 6:152479539-152479561 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1017956675 6:159184070-159184092 AGAGTTAAGTGATTTGCCCAAGG - Intronic
1018002620 6:159593110-159593132 GAGGTTAAGAGACTTGCCCAAGG - Intergenic
1019552025 7:1607936-1607958 GGAGCTCAACGATTTGCTCAAGG + Intergenic
1019809317 7:3152898-3152920 GGGGCTAAGCGATTTGCCCAAGG + Intronic
1019924675 7:4184328-4184350 GGGGTTAAGTGACTTGCCCGTGG - Intronic
1020527334 7:9278807-9278829 AAGGCTAAGTTATTTGCCCAGGG + Intergenic
1022151764 7:27615339-27615361 GAGGATAAGTGACTTGCCCAGGG - Intronic
1022342140 7:29478643-29478665 GAGGTAAAGCAATTTGCCCAAGG - Intronic
1022406362 7:30093903-30093925 GGGGTTAAAGGATTTGTCCAAGG - Intronic
1022734042 7:33059668-33059690 GAGGTTAAGTAATTTGCCCAAGG + Intronic
1022760744 7:33347095-33347117 GATGCTAAGTAATTTGCCCAAGG - Intronic
1022802927 7:33792857-33792879 GGGGAAAAGCCATTTGCTCATGG + Intergenic
1022861283 7:34369610-34369632 GAGTTTAAGCGAATTGCCCAAGG + Intergenic
1023032613 7:36104021-36104043 GAGGTTAAGCTACTTGCCCATGG - Intergenic
1023679030 7:42664621-42664643 GGGGTTCAGCAAATTGCCCAAGG - Intergenic
1025698784 7:63796695-63796717 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1025830486 7:65044720-65044742 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1026501786 7:70948896-70948918 AGGGTTAAATGATTTGCCCAAGG + Intergenic
1027150789 7:75732149-75732171 GAGGCTAAGTGACTTGTCCAAGG - Intronic
1027245786 7:76366354-76366376 GAGGCAAAGTGATTTGCCCAAGG - Intergenic
1027459093 7:78429897-78429919 GAGGTTAAGTAATTTGCCCAAGG + Intronic
1028956019 7:96691435-96691457 AAGGCTAAGTGAGTTGCCCAAGG + Intronic
1029063528 7:97824577-97824599 GTGGCCAAGTGATTTACCCAAGG + Intergenic
1029105295 7:98170147-98170169 GAGGGTAAGAAATTTGCCCAAGG - Intronic
1029167150 7:98600467-98600489 GGGGCTCAGCCATCTGCCCCTGG + Intergenic
1030070641 7:105694707-105694729 GAGGCTATGTGATTTGGCCAGGG + Intronic
1030197879 7:106869987-106870009 GAGGCTAAGTAATGTGCCCAAGG + Intronic
1030875365 7:114807048-114807070 GAGGCTAAGTGCTGTGCCCAAGG + Intergenic
1031140532 7:117937940-117937962 GAGGTTATGTGATTTGCCCAAGG - Intergenic
1031423508 7:121578139-121578161 GTGGCTAAGTGATTTGCTTATGG - Intergenic
1031594691 7:123636094-123636116 GACATTAAGCGATTTGCCCAAGG + Intronic
1031681802 7:124683935-124683957 GATGCTAAGCGACTGGCCCAAGG + Intergenic
1032005816 7:128301295-128301317 GGGTCTGAGTGATTTGTCCAGGG + Exonic
1032349368 7:131146086-131146108 GGGATTAAGCAATTTGCCCAAGG + Intronic
1032383075 7:131503965-131503987 GAGGGTAAGTGACTTGCCCAAGG - Intronic
1032409112 7:131680840-131680862 GGGGCTAAGTAACTTGCCCTAGG + Intergenic
1032481347 7:132249638-132249660 GGGGCTGAGCAGCTTGCCCAAGG + Intronic
1032482352 7:132257044-132257066 GGGGTTAAGCGACTTGCTCAAGG + Intronic
1032579610 7:133092109-133092131 GAGGCTGAGTGAGTTGCCCAAGG + Intergenic
1032709070 7:134446929-134446951 GCAGTTAAGCGACTTGCCCAGGG + Intronic
1033031987 7:137835915-137835937 GTAGCTAAGCGACTTTCCCAAGG - Intronic
1033304134 7:140212027-140212049 GAGGTTAAGCGACTTGCCAAAGG - Intergenic
1033314670 7:140287597-140287619 GTGGTTAAGCAATTTGCCCAAGG - Intergenic
1033387257 7:140890086-140890108 GGGGTTAAGTAATTTGCCTAAGG - Intronic
1034844158 7:154429132-154429154 GAGGTTAAGAGACTTGCCCAAGG - Intronic
1034946369 7:155264753-155264775 AAGGTTAAGTGATTTGCCCAAGG - Intergenic
1035030911 7:155859006-155859028 GTGGCTAAGTGATTGCCCCAAGG - Intergenic
1035580426 8:736807-736829 GGGGCTGAGAGACTTGCCCAGGG + Intronic
1036202337 8:6779883-6779905 GGGGCTAAGGGATGTGCACACGG + Intergenic
1036456043 8:8908891-8908913 GTGGCTATGCAACTTGCCCATGG - Intergenic
1036657967 8:10690174-10690196 GAGGCTGAGGGATTTGCTCAGGG - Intronic
1037289643 8:17336970-17336992 GAGGTTAAGTAATTTGCCCAGGG - Intronic
1037821387 8:22136722-22136744 GAGGGCAAGTGATTTGCCCAAGG - Intergenic
1038353571 8:26805597-26805619 GAGGCTAAGTAACTTGCCCAAGG + Intronic
1038666949 8:29546036-29546058 GAGCCTAAGCAACTTGCCCAAGG + Intergenic
1039410894 8:37354260-37354282 GGGGTTAAGCGACTTGACCCGGG - Intergenic
1040366582 8:46723587-46723609 GTGGCCAAGTGATTTACCCAAGG - Intergenic
1040423676 8:47263113-47263135 GAGGCTAAGTAATTTGCCTAAGG + Intronic
1041548469 8:59074072-59074094 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1042013271 8:64274958-64274980 GAGGTTAAGTGATTTGCCAAAGG - Intergenic
1042551228 8:69995619-69995641 GGGGTTAAGGGACTTGCCCAAGG - Intergenic
1042634734 8:70861276-70861298 GAGGGTAAGCAATTTTCCCAAGG - Intergenic
1042733543 8:71963131-71963153 GAGGCTAAGTAATTTGCTCATGG - Intronic
1042828570 8:73003029-73003051 GTGTCTAATCGATTTGCTCAAGG + Intergenic
1043166960 8:76915264-76915286 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1043381172 8:79703757-79703779 GAGGCTAAGTGATTTGCCTAAGG - Intergenic
1043821133 8:84866303-84866325 GGGGTTAAAGGATTTCCCCAAGG - Intronic
1044520244 8:93190718-93190740 GAGGCTAAGTAACTTGCCCAAGG - Intergenic
1044872789 8:96636614-96636636 GAGGTTAAGTGATTTGCCCGTGG + Intergenic
1045174558 8:99707790-99707812 GAGGTTAAGCGGTTTGCCCAGGG + Intronic
1045522722 8:102917201-102917223 GTGTTTAAGTGATTTGCCCAAGG - Intronic
1045523624 8:102924823-102924845 GAGGATAAGCGACTTGCTCAAGG - Intronic
1046768382 8:118094828-118094850 GAGGTTGAGCAATTTGCCCAAGG - Intronic
1046973938 8:120252573-120252595 GAAGTTAAGCAATTTGCCCAAGG - Intronic
1047020194 8:120767623-120767645 GAGGCTAAGTGATTTGCCCAAGG - Intronic
1047177667 8:122556820-122556842 GAGGATAAGGGATTTGTCCAAGG - Intergenic
1047368894 8:124238571-124238593 GGAGCTAAGCAATTTTCCAAAGG - Intergenic
1047516028 8:125555589-125555611 GAGGTTAAGTCATTTGCCCAGGG - Intergenic
1047695617 8:127400921-127400943 GAGGTTAAGCAATTTGACCAGGG - Intergenic
1047743458 8:127826192-127826214 GAGGCCAAGCAATTTGCCCAAGG - Intergenic
1047961524 8:130015439-130015461 GAGGGTAAGCGACTTGCCCAAGG + Intronic
1048162527 8:132034233-132034255 GAGGTGAAGTGATTTGCCCAGGG - Intronic
1048235672 8:132687686-132687708 AGGGATAAGTGACTTGCCCAAGG + Intronic
1048276562 8:133070513-133070535 GAGGCTAAGTGACTTGCTCAGGG + Intronic
1048283423 8:133122574-133122596 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1048290684 8:133179119-133179141 GGGGTTAAGTAACTTGCCCAAGG - Intergenic
1048932024 8:139322762-139322784 GAGGTTAAGTGATTTGCCCAAGG - Intergenic
1048963148 8:139596617-139596639 GGGTATAAGAAATTTGCCCAGGG + Intergenic
1048978579 8:139690228-139690250 GAGACTAAGCAACTTGCCCAGGG - Intronic
1049138030 8:140923438-140923460 GAGGCCAAGCAACTTGCCCAAGG + Intronic
1049890379 9:63829-63851 GAGGCTAGGCGACTTCCCCACGG + Intergenic
1050183143 9:2942093-2942115 GGGGCTTAGAGAATTGGCCATGG + Intergenic
1050741175 9:8822733-8822755 GAGATTAAGCAATTTGCCCAAGG + Intronic
1051187461 9:14475219-14475241 CGTGCTAAGTGACTTGCCCATGG + Intergenic
1051220006 9:14838020-14838042 GGGGTTAAATGATTTGCCCCAGG + Intronic
1051225759 9:14897424-14897446 GAGGCTAAGTGATTTGTCAAAGG + Intronic
1051613235 9:18981803-18981825 GGGGCTCAGCAACTTGCCCAAGG + Intronic
1052853460 9:33392363-33392385 GAGACTAAGCCTTTTGCCCAAGG - Intronic
1053050891 9:34959405-34959427 GAGGTTTAGCAATTTGCCCAAGG + Intronic
1053261126 9:36665904-36665926 GGAGTGAAGTGATTTGCCCAAGG + Intronic
1053681484 9:40488543-40488565 GAGACTAAGCCTTTTGCCCAAGG - Intergenic
1053731842 9:41065012-41065034 GAGGCTAGGCGACTTCCCCACGG + Intergenic
1053931477 9:43116873-43116895 GAGACTAAGCCTTTTGCCCAAGG - Intergenic
1054282229 9:63136391-63136413 GAGACTAAGCCTTTTGCCCAAGG + Intergenic
1054294575 9:63324060-63324082 GAGACTAAGCCTTTTGCCCAAGG - Intergenic
1054392596 9:64628547-64628569 GAGACTAAGCCTTTTGCCCAAGG - Intergenic
1054427244 9:65133756-65133778 GAGACTAAGCCTTTTGCCCAAGG - Intergenic
1054503132 9:65887784-65887806 GAGACTAAGCCTTTTGCCCAAGG + Intronic
1054696616 9:68366706-68366728 GAGGCTAGGCGACTTCCCCATGG - Intronic
1054801362 9:69352601-69352623 GAGGTTAAGTGATTTGCCCAAGG + Intronic
1054831565 9:69630869-69630891 GAGACTAAGTGATTTGCCCTGGG - Intronic
1054867979 9:70022591-70022613 GAGCTTAAGCGATTTGCTCAAGG + Intergenic
1055056182 9:72026504-72026526 GGGGTTAAATAATTTGCCCAAGG + Intergenic
1055417762 9:76102255-76102277 GGGGTTAAGTAACTTGCCCAAGG - Intronic
1055426366 9:76200897-76200919 GAGGCTAATTGATTTGCCCAAGG + Intronic
1055655339 9:78445322-78445344 AAGATTAAGCGATTTGCCCAAGG + Intergenic
1055670363 9:78599158-78599180 GAGGCTAAGTGACTTTCCCAAGG + Intergenic
1056012912 9:82351370-82351392 GTGGTTAAGTGACTTGCCCAAGG - Intergenic
1056066730 9:82943273-82943295 GAGGTTAAGCAATTTGTCCAAGG + Intergenic
1056067781 9:82954879-82954901 GAGGGTAAGTGATGTGCCCAGGG - Intergenic
1056170488 9:83980299-83980321 AGGGCGAAGCGATTGGCCCGAGG + Intronic
1056501421 9:87213641-87213663 GAGGCTAAGTAATTTGACCATGG - Intergenic
1056959922 9:91114105-91114127 GGGGCCATGCAATATGCCCAAGG + Intergenic
1057046801 9:91892384-91892406 CGGGGTAAGGGACTTGCCCAAGG - Intronic
1057885426 9:98826126-98826148 GAGGCTAAGTAACTTGCCCAAGG - Intronic
1058033672 9:100227024-100227046 GGAGTTAAGCAATTTGCTCAAGG - Intronic
1058062384 9:100511392-100511414 GAGGCTTAGTGATTTGTCCAAGG - Intronic
1058466542 9:105234646-105234668 GAGGCTGAGGGACTTGCCCAAGG + Intergenic
1058581127 9:106458864-106458886 GAGGCTAAGTAATTTGCCCTGGG - Intergenic
1058729587 9:107836991-107837013 GGAGCCAAGAGATTTTCCCAAGG - Intergenic
1058894042 9:109384404-109384426 GGGATTAAGTGACTTGCCCAAGG + Intronic
1058966052 9:110039464-110039486 GAGGCTGAGCGATTTTCCTAAGG + Intronic
1059342147 9:113603327-113603349 GAGGTTAAGCGACTTGCCGAAGG - Intergenic
1059385620 9:113962014-113962036 GGGGCTAAGTGACTTATCCAAGG - Intronic
1059417941 9:114173592-114173614 GAGGTTAAGTGATTTGCCAAAGG - Intronic
1059429082 9:114239444-114239466 GAGGCTAAGGAACTTGCCCAGGG + Intronic
1059523740 9:114969016-114969038 GGGACAAAGGGATTTACCCAAGG - Intergenic
1059711536 9:116872212-116872234 GGGTTTAAGAGACTTGCCCAAGG - Intronic
1059718586 9:116936469-116936491 TAGGTTAAGCAATTTGCCCAAGG + Intronic
1059781242 9:117530349-117530371 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1059969330 9:119648853-119648875 AGGGTTAAGTGAGTTGCCCAAGG + Intergenic
1060001496 9:119962892-119962914 GAGGCTAAGCAACTTGCCCAAGG - Intergenic
1060112327 9:120915021-120915043 GAGGGGAAGGGATTTGCCCAAGG + Intronic
1060114202 9:120928168-120928190 GAGGCTAAGCGACTTGTTCAAGG + Exonic
1060171632 9:121466265-121466287 GTGGCTGAGCAACTTGCCCAAGG + Intergenic
1060252377 9:121996566-121996588 GGGGCAAGGAGACTTGCCCAAGG + Intronic
1060284610 9:122238090-122238112 GAGACAAAGCGATTTGGCCAGGG - Exonic
1060493794 9:124103268-124103290 GTGGCCAAGAAATTTGCCCAGGG + Intergenic
1060587144 9:124793594-124793616 GGGGGCAAGTGACTTGCCCAAGG - Intronic
1060865501 9:126992142-126992164 GAGGCTAAGTGACTTGACCATGG - Intronic
1061101241 9:128494145-128494167 AGAGCTAAGTCATTTGCCCAAGG - Intronic
1061254699 9:129447875-129447897 GAGGTTAAGTGAGTTGCCCAAGG + Intergenic
1061295878 9:129676495-129676517 GAGGCTAAGTGACTTGCCCAAGG + Intronic
1061326676 9:129868591-129868613 GGGGCTCAGTGATGTGCCCAGGG + Intronic
1061541220 9:131278616-131278638 GAGGCTAGGGGATTTGCCCAAGG + Intergenic
1061608628 9:131730800-131730822 GAGATTAAGCAATTTGCCCACGG + Intronic
1061659739 9:132121227-132121249 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1061682125 9:132248058-132248080 GGGGGTGAGGGATGTGCCCAGGG - Intergenic
1061855184 9:133438075-133438097 AGGGCTCAGTGACTTGCCCAAGG - Intronic
1061874732 9:133537973-133537995 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1062081185 9:134624407-134624429 GGGGATAAGTAAATTGCCCAAGG + Intergenic
1186525833 X:10247472-10247494 GAGGTTAAACGATTTGCCCAGGG - Intergenic
1187197828 X:17105069-17105091 GGGGCTAAGCAAGTTACCCAAGG + Intronic
1187304267 X:18081098-18081120 GAGGTTAAGTGACTTGCCCAAGG + Intergenic
1187586443 X:20667771-20667793 GAGGCTAAGCAATTTTCCCCAGG - Intergenic
1187593040 X:20739890-20739912 GAGGTTAAGTGACTTGCCCAAGG - Intergenic
1187969364 X:24644626-24644648 GAGGGTAAGTGACTTGCCCAAGG - Intronic
1188507193 X:30895366-30895388 GAGGTTAAGAGAATTGCCCAAGG + Intronic
1188584476 X:31756562-31756584 GAGGTTAAGTGACTTGCCCAAGG - Intronic
1188629476 X:32334985-32335007 GAGGTTAAGAGATTTGTCCAAGG - Intronic
1189326845 X:40117754-40117776 GAGGGTGAGCGACTTGCCCAAGG - Intronic
1189362922 X:40367031-40367053 GGAGCTAAGTGACTTGCTCAAGG - Intergenic
1189369851 X:40419018-40419040 GAGATTAAGCAATTTGCCCAAGG + Intergenic
1189647011 X:43144094-43144116 GGGGCTAGGCAATTTGCCCAAGG + Intergenic
1189753716 X:44249500-44249522 GAGGTTAAGTGATTTGCCCAAGG + Intronic
1190262429 X:48805774-48805796 AAGGCTCAGCGACTTGCCCAAGG - Intronic
1190436611 X:50431869-50431891 GAGGTTAAGTGATTTGCCCAAGG - Intronic
1190832906 X:54075278-54075300 GAGGCTAAGTAACTTGCCCAAGG + Intronic
1191035055 X:56016162-56016184 GAGGCTAAATGATTTGCCCAAGG - Intergenic
1192171689 X:68859605-68859627 GAGGCTAAGTGACTTGCCCAAGG + Intergenic
1192185701 X:68945467-68945489 GAGGTTAAGCAACTTGCCCAGGG + Intergenic
1192291787 X:69804973-69804995 GAGGTTAAGGGACTTGCCCAAGG + Intronic
1192497812 X:71627944-71627966 GAGGCTAAGTCACTTGCCCAAGG + Intergenic
1193240334 X:79161638-79161660 GGGGGTAAACAATTAGCCCATGG + Intergenic
1193683063 X:84545635-84545657 GAGGTTAAGTAATTTGCCCAAGG + Intergenic
1194134044 X:90116693-90116715 GAGGTTAAGTGACTTGCCCAAGG - Intergenic
1194405439 X:93491121-93491143 GAGGTCAAGCGATTTGTCCATGG - Intergenic
1194457865 X:94126783-94126805 GAGGTTAAGTGATTTGCCCAAGG + Intergenic
1195401288 X:104464196-104464218 GGGGTTAAGTGACTTGCCTAAGG - Intergenic
1195861665 X:109389572-109389594 GAGATTAAGTGATTTGCCCATGG - Intronic
1195924717 X:110013970-110013992 GAGGTTAAGTAATTTGCCCACGG - Intronic
1196007063 X:110848194-110848216 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
1196709485 X:118747854-118747876 GGGGCTAAGAAATTTGCCCAAGG - Intronic
1196969726 X:121095668-121095690 GAGTTTAAACGATTTGCCCAAGG - Intergenic
1196989754 X:121315317-121315339 GGGGCTAGGTTAATTGCCCAAGG - Intergenic
1197102012 X:122667411-122667433 GATGCTAAGTGATTTGTCCAAGG - Intergenic
1197145360 X:123166330-123166352 GAGACTAAGTGATTTACCCAGGG - Intergenic
1197558066 X:127981978-127982000 AGTGCTAGGCGACTTGCCCAAGG - Intergenic
1197634598 X:128900981-128901003 GAGTTTAAGTGATTTGCCCAAGG + Intergenic
1197656939 X:129126894-129126916 GAGGTTAAGCAATTTGACCAAGG - Intergenic
1197717617 X:129720669-129720691 GAGGCCAAGTGACTTGCCCAAGG + Intergenic
1197718236 X:129725868-129725890 AAGGCTAAGCCACTTGCCCAAGG - Intergenic
1197721772 X:129750229-129750251 GGGGTTAGGTAATTTGCCCAAGG + Intronic
1197861772 X:130978708-130978730 GAAGCTAAGTAATTTGCCCACGG + Intergenic
1197896520 X:131321311-131321333 GAGGCTAAGTTATTTGCCTAAGG + Intronic
1198142598 X:133819709-133819731 GAGGCTAAGTAACTTGCCCAAGG - Intronic
1198273513 X:135078715-135078737 GTGGCTAAGTAATTTGCCCAAGG + Intergenic
1198383202 X:136103743-136103765 GAGGCTAAATGATTTGCCAAAGG - Intergenic
1198460882 X:136862072-136862094 GAGGTTAAGCAACTTGCCCAAGG + Intronic
1198551620 X:137751350-137751372 GAAGCTAAGTGATTTGCCCAAGG - Intergenic
1198713688 X:139533318-139533340 GAGGCTAAGGGCTTTGCCCAAGG - Intronic
1198762429 X:140046735-140046757 GAGGTTAAGCAACTTGCCCAAGG - Intergenic
1199501370 X:148510361-148510383 AGGGTTCAGCGACTTGCCCAAGG + Intronic
1199778827 X:151039445-151039467 GAGGTTAAGTAATTTGCCCAAGG - Intergenic
1199967598 X:152832732-152832754 GAGGTTAAGCGACTTGCCCAAGG - Intronic
1199978127 X:152906091-152906113 GGGGAGAAAGGATTTGCCCAGGG + Intergenic
1200479823 Y:3686808-3686830 GAGGTTAAGTGACTTGCCCAAGG - Intergenic