ID: 1019810899

View in Genome Browser
Species Human (GRCh38)
Location 7:3164495-3164517
Sequence CAGCCCGGAGACCTTTCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019810896_1019810899 -1 Left 1019810896 7:3164473-3164495 CCTATAATCAGATAACACATTCC 0: 1
1: 0
2: 0
3: 12
4: 172
Right 1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 139
1019810895_1019810899 8 Left 1019810895 7:3164464-3164486 CCAGGAAGGCCTATAATCAGATA 0: 1
1: 0
2: 0
3: 4
4: 97
Right 1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 139
1019810893_1019810899 20 Left 1019810893 7:3164452-3164474 CCGGGGAGCCTGCCAGGAAGGCC 0: 1
1: 0
2: 5
3: 60
4: 412
Right 1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 139
1019810894_1019810899 12 Left 1019810894 7:3164460-3164482 CCTGCCAGGAAGGCCTATAATCA 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG 0: 1
1: 0
2: 2
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019810899 Original CRISPR CAGCCCGGAGACCTTTCCAG AGG Intronic
902466224 1:16620313-16620335 CATCCTGTAGTCCTTTCCAGGGG - Intergenic
913084226 1:115420621-115420643 CAGCCCAGATACCTTTCAACAGG - Intergenic
917636934 1:176946050-176946072 CATCACGGAGACCTGTCCAGAGG - Exonic
919748215 1:201021669-201021691 CAGCCTGGAGACCTGAACAGAGG + Intronic
920735146 1:208526887-208526909 CAGCCCTGAGGCCTTTCTTGGGG + Intergenic
923453556 1:234142475-234142497 CACCCCGAAACCCTTTCCAGAGG - Intronic
923460309 1:234204461-234204483 CAGCCCAGAGTCCTTGGCAGGGG - Intronic
924325363 1:242890064-242890086 CAGCCTGGAAGACTTTCCAGGGG + Intergenic
924436294 1:244047228-244047250 CTGCCAGGAGACCTTTCAACTGG - Intergenic
1066402804 10:35091554-35091576 AATCCCTGAGACCTTTACAGAGG + Intergenic
1066694339 10:38064585-38064607 TAGCCCGGGGACCTTTCCTCTGG - Intronic
1067736553 10:48857539-48857561 GATTCCTGAGACCTTTCCAGAGG - Intronic
1069598406 10:69687476-69687498 CAGCCCAGAGACTAGTCCAGAGG + Intronic
1069695239 10:70381508-70381530 CAGTCCGGAGACCTCTGCAAAGG + Exonic
1070701591 10:78605601-78605623 CTGCCCTGAAACCCTTCCAGTGG + Intergenic
1071544738 10:86521103-86521125 CAGCCCCGAGTCCTTTCCCGTGG - Intronic
1072791557 10:98321649-98321671 CACCCGGGAGACCTCTCCTGTGG + Intergenic
1075077536 10:119360998-119361020 TAGCCAGGAGACCTTCCCAGAGG - Intronic
1075911163 10:126126896-126126918 CAGTCTGGAGACCTACCCAGAGG + Intronic
1076133146 10:128027648-128027670 ATGCCCGGATACCTTTCCAAAGG - Intronic
1077107192 11:847373-847395 CAGCCCAGGGGCCTTGCCAGCGG + Intronic
1085129438 11:74025587-74025609 CGGCCCAGAGACCTTTCCTGTGG + Intronic
1087935998 11:104035412-104035434 CAGTCAGGAGGCTTTTCCAGTGG - Intronic
1088313556 11:108485034-108485056 CAGCCCTGAGAAATTCCCAGAGG + Intronic
1089151061 11:116364754-116364776 CTGCCTGGACACCTTTTCAGAGG - Intergenic
1090985247 11:131760764-131760786 CACCCCGGCGACCCTTCCTGAGG - Intronic
1094318077 12:29153958-29153980 CAGCCAGTATACTTTTCCAGAGG - Intronic
1102999036 12:117371103-117371125 CTGTCCGGAGACCTTCCCTGTGG - Intronic
1104505483 12:129327988-129328010 CAGCCCTGAGTGCTTTCGAGTGG - Intronic
1106458190 13:29945731-29945753 CATCCTGGAAACCTTTCCCGGGG - Intergenic
1112238032 13:97653661-97653683 AAGCCCTGAGCCCTTTGCAGAGG - Intergenic
1114791935 14:25669273-25669295 GAGCCAGGAGAGCCTTCCAGAGG - Intergenic
1117339245 14:54779804-54779826 CAGCCAGGAGACCCTTCAGGTGG + Intronic
1120408893 14:84125492-84125514 CAGCCAGGCTACCTTCCCAGAGG + Intergenic
1121795869 14:96734964-96734986 CAGCATGCAGACCTTTCCAGAGG + Intergenic
1122273174 14:100577523-100577545 CAGCCCAGAGCCCTCTGCAGTGG - Intronic
1122633517 14:103119065-103119087 CAGCCCTGAGACTCTTCCTGGGG - Intergenic
1124014811 15:25865321-25865343 CAGCTTGGAGACCTTTCCAGAGG - Intergenic
1124138640 15:27057571-27057593 CAGCCCAGAGGCCTTTCCAGGGG - Intronic
1129350350 15:74952383-74952405 CAGCCCAGAAACCTATCCTGGGG - Intergenic
1130040913 15:80404579-80404601 CAGCCCGCAGGCCTTGCCCGGGG + Intronic
1136686190 16:31996206-31996228 CTGCCAGGACACCTCTCCAGGGG - Intergenic
1136786802 16:32939735-32939757 CTGCCAGGACACCTCTCCAGGGG - Intergenic
1136882970 16:33914055-33914077 CTGCCAGGACACCTCTCCAGGGG + Intergenic
1137349069 16:47694756-47694778 CAGACAGGAGGCCTTGCCAGAGG - Intronic
1137562941 16:49514597-49514619 CAACCCGGAGCCCTTTCGATAGG - Intronic
1137758857 16:50924561-50924583 CAGTTTGGAGACCCTTCCAGAGG + Intergenic
1138023347 16:53503582-53503604 CACCACGGAGACCTTCCCGGAGG + Intronic
1138135190 16:54515440-54515462 GAGCCTGCAGAACTTTCCAGTGG - Intergenic
1138491674 16:57380774-57380796 CAGCCCTGAGGCCTTTCCCCAGG + Intronic
1139911448 16:70399865-70399887 CAGCCCAGAGAAGATTCCAGGGG + Exonic
1140412606 16:74749908-74749930 CAGCACGGAGACTTTCCCTGGGG - Intronic
1141140318 16:81492999-81493021 CAGCCCAGAGTCCCTTCCAGGGG - Intronic
1141647934 16:85377436-85377458 CAGCCAGGAGAGGTTTCCATTGG - Intergenic
1142100926 16:88270669-88270691 CAGCCTGGAGAATTTTCCCGTGG - Intergenic
1142145672 16:88491958-88491980 CAGCCAGGTGACCGGTCCAGTGG + Intronic
1203089038 16_KI270728v1_random:1201405-1201427 CTGCCAGGACACCTCTCCAGGGG - Intergenic
1143582408 17:7834832-7834854 CGGCCCCGAGAGCTTCCCAGCGG + Intergenic
1145262599 17:21363835-21363857 AAGCCCAGAGATCTTCCCAGAGG - Intergenic
1147127750 17:38383940-38383962 AAGCCAGGAGTCCTTTCCTGGGG + Intronic
1147147151 17:38491874-38491896 CTGCCAGGACACCTCTCCAGGGG - Intronic
1147929351 17:43968000-43968022 CAGCCCCGAGACAATTCCATGGG + Intronic
1152717288 17:81906201-81906223 CAGCCCGGAGACTTTTTGGGGGG + Intronic
1160476399 18:79192909-79192931 CAGCCCCGGGGCCTGTCCAGGGG - Intronic
1160583718 18:79901446-79901468 CAGCCCTGTGCCCTTCCCAGGGG - Intergenic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161586967 19:5110895-5110917 CGGCCCGGAGCCCCTGCCAGTGG - Intronic
1168651932 19:58097444-58097466 CACCCCGGAGACCTCTCTCGTGG - Intronic
935261119 2:101356845-101356867 CTGCCAGGTGACCTTTACAGTGG - Intronic
936145210 2:109976118-109976140 CAGCCCGGAGAGCTTGCCCAAGG - Intergenic
936199475 2:110395360-110395382 CAGCCCGGAGAGCTTGCCCAAGG + Intergenic
937924599 2:127158037-127158059 CAGCCCCTAGTCCCTTCCAGGGG + Intergenic
938248342 2:129795970-129795992 CATCCCTGAGACCTCTCAAGGGG - Intergenic
938280723 2:130061905-130061927 CAGCCCGGATAACCATCCAGGGG - Intergenic
938280830 2:130062536-130062558 CAGCCCGGATAACCATCCAGGGG - Intergenic
938331475 2:130451373-130451395 CAGCCAGGATAACCTTCCAGGGG - Intergenic
938358477 2:130670131-130670153 CAGCCAGGATAACCTTCCAGGGG + Intergenic
938434868 2:131276796-131276818 CAGCCCGGATAACCATCCAGGGG + Intronic
947871980 2:233444343-233444365 CACCCAGGCGACCTTTCCCGGGG + Intronic
948756313 2:240161516-240161538 CAGCCTGCAGGCCTTTGCAGTGG - Intergenic
1169147652 20:3263979-3264001 CAGCCTGTGGACCTCTCCAGAGG - Intronic
1169291814 20:4359296-4359318 CAGCCCGGAGAAGTTTGCACAGG - Intergenic
1172444090 20:34984308-34984330 CAGCCAGGAGGCCTTCCTAGAGG + Intronic
1172671231 20:36635610-36635632 CAGCCTGGAGAGCTCCCCAGGGG + Intronic
1173544251 20:43881072-43881094 CAGCCATGAGACCCTTCCAGGGG - Intergenic
1173565286 20:44034251-44034273 CAGCCAGGAAGCCTTTCCACAGG - Intronic
1173815833 20:45987508-45987530 CGGGCTGGAGACCTGTCCAGTGG + Intergenic
1174048357 20:47749741-47749763 CAGCCTGGAGAACTGTCCAGTGG - Intronic
1176058264 20:63160390-63160412 CAGCCTGTAGACCCTACCAGTGG - Intergenic
1180169222 21:46049219-46049241 GAGCCAGGAAGCCTTTCCAGAGG - Intergenic
1180825122 22:18856402-18856424 CAAGCCGGAGACCTCTCCCGAGG + Intronic
1181187607 22:21118145-21118167 CAAGCCGGAGACCTCTCCCGAGG - Intergenic
1181211591 22:21292348-21292370 CAAGCCGGAGACCTCTCCCGAGG + Intergenic
1181397916 22:22634538-22634560 CAAGCCGGAGACCTCTCCCGAGG - Intergenic
1181651491 22:24261520-24261542 CAAGCCGGAGACCTCTCCCGAGG + Intergenic
1181705885 22:24649219-24649241 CAAGCCGGAGACCTCTCCCGAGG - Intergenic
1183072830 22:35408310-35408332 CAGCAAGGAGACGTTGCCAGCGG - Intronic
1183723825 22:39577658-39577680 CAGCCAGGAGACCCGTCGAGAGG + Intronic
1184571158 22:45325855-45325877 CATCCCTGAGACCCTTCCTGGGG - Intronic
1185214515 22:49590822-49590844 CAGCCCTGAGCTCTTCCCAGAGG - Intronic
1203215361 22_KI270731v1_random:3084-3106 CAAGCCGGAGACCTCTCCCGAGG - Intergenic
950498184 3:13346947-13346969 CAGCCCTGTGACCTTCCCAAGGG + Intronic
951728224 3:25783300-25783322 CACCCCGGAGACCTTTTTGGAGG - Exonic
951908086 3:27722774-27722796 CAGCCCGGAGACCCTCCTATTGG + Intergenic
952307008 3:32155451-32155473 CAGCCCATAGACATTTCCTGGGG + Intronic
953018344 3:39098693-39098715 CAACCCGGGGTCCTTCCCAGAGG + Intronic
960963513 3:123089190-123089212 GAGCGAGGAGACCTTTGCAGAGG - Exonic
962367891 3:134797758-134797780 CAGCCTGGAAACTTTGCCAGTGG + Intronic
963470904 3:145740588-145740610 CAGCCTGAAGACCTCACCAGAGG + Intergenic
966769388 3:183490881-183490903 CATCCCCCAGACCTTTCAAGTGG + Exonic
967741713 3:193010361-193010383 CAGCCAAGAGCCCATTCCAGAGG + Intergenic
967982152 3:195072117-195072139 CAGCCCTGTGATCTTTCCTGTGG - Intronic
968438714 4:610508-610530 CAGCCTGGAGGCCTTTCCTGGGG - Intergenic
971343544 4:25792006-25792028 AAGCCAGGGGTCCTTTCCAGGGG + Intronic
990492074 5:56312349-56312371 CAGCCCTGAGTCCTTGCCTGAGG + Intergenic
990901300 5:60752571-60752593 GAGTCCTGAGACCTTTCCAGTGG + Exonic
994356835 5:98802214-98802236 CAGCAGGGAGACCTTTCGAATGG - Intergenic
997973144 5:138420775-138420797 CAGCGGAGAGACCTTTGCAGTGG - Exonic
1003052556 6:2793075-2793097 CTGCCCGGCCACCTTGCCAGTGG + Intergenic
1012387256 6:98696619-98696641 CATTCCTGACACCTTTCCAGAGG + Intergenic
1013991038 6:116253831-116253853 CAGCCTGGAGACCGTTGCGGAGG - Exonic
1016838566 6:148504123-148504145 AAGCCAGGAGAGCTTTCCAGAGG + Intronic
1017334867 6:153244375-153244397 AAGCTCAGAGACCTTTCCACTGG + Intergenic
1017564428 6:155668811-155668833 GAGCCTGGAGAGCTTCCCAGAGG + Intergenic
1017767503 6:157618679-157618701 AAGCTCAGAGACCTCTCCAGTGG + Intronic
1019810899 7:3164495-3164517 CAGCCCGGAGACCTTTCCAGAGG + Intronic
1019898092 7:3998579-3998601 CAGCTCTGAAACCTGTCCAGGGG - Intronic
1023113769 7:36840428-36840450 CTGCCAGGAGGCTTTTCCAGAGG + Intergenic
1023890389 7:44387771-44387793 CAGCACTCAGACCTTTCCTGAGG + Intronic
1023998646 7:45177176-45177198 CAAGCCTGAGACCGTTCCAGCGG - Intronic
1026853067 7:73736857-73736879 CAGCCTGGGGACCCTACCAGGGG - Intronic
1028882925 7:95900196-95900218 CAGCTAGGATTCCTTTCCAGTGG - Intronic
1029379300 7:100202319-100202341 CAGCCGGGAGACCTGGGCAGTGG + Exonic
1032683805 7:134210561-134210583 CACCCGGGAGACCTCTCCAGAGG + Intronic
1034164548 7:149015264-149015286 CAGCCTGCAGACTTCTCCAGAGG + Intronic
1035284873 7:157799676-157799698 AAGCCAGCAGACATTTCCAGAGG - Intronic
1035645322 8:1214346-1214368 CAGCCCAGGGTGCTTTCCAGGGG + Intergenic
1036475495 8:9089400-9089422 CAGCCTGGATCTCTTTCCAGTGG + Intronic
1038176128 8:25183883-25183905 CAGCCCAGAGAGCATTCCCGTGG - Intergenic
1039014069 8:33126807-33126829 AAACCCCGAGACCTTTCTAGTGG + Intergenic
1041472404 8:58225365-58225387 CAGCCCTGAGACCTTGGCAGTGG - Intergenic
1048845859 8:138603166-138603188 CAGCCCTGAGACCTATGCAGAGG + Intronic
1049276231 8:141721416-141721438 CAGACGGGAGCCCTTTCCAGGGG + Intergenic
1051665529 9:19464430-19464452 CAGCCTGGAGACCTTTCCCCTGG - Intergenic
1053557236 9:39149917-39149939 CAGCCCTGAAACCCTCCCAGGGG + Exonic
1053821344 9:41970185-41970207 CAGCCCTGAAACCCTCCCAGGGG + Exonic
1054090221 9:60838337-60838359 CAGCCCTGAAACCCTCCCAGGGG + Intergenic
1054111632 9:61113894-61113916 CAGCCCTGAAACCCTCCCAGGGG + Intergenic
1054609225 9:67217231-67217253 CAGCCCTGAAACCCTCCCAGGGG - Intergenic
1056661824 9:88549294-88549316 CAGCCCGGGGATCATTCCAAAGG - Intronic
1058999819 9:110336883-110336905 CTCCCCAGGGACCTTTCCAGAGG - Intronic
1059694908 9:116721792-116721814 CTGCCTGGAGATCTTACCAGTGG + Intronic
1062325867 9:136012230-136012252 CAGGCCAGAGACTGTTCCAGAGG - Intronic
1186096561 X:6108831-6108853 CAGCCTGGAGGGCTTCCCAGGGG - Intronic
1190318576 X:49166195-49166217 CAGCCCGGAGCCTAGTCCAGAGG + Exonic
1190378159 X:49811578-49811600 CAGCCTGGAGATGGTTCCAGAGG - Intergenic
1192555976 X:72089601-72089623 CATCCCAGTGGCCTTTCCAGAGG + Intergenic
1195077478 X:101340890-101340912 CAGCCCAGACTCCTTTCCATTGG - Intergenic
1201222881 Y:11789061-11789083 CAGCCTGGAAGACTTTCCAGGGG + Intergenic