ID: 1019812554

View in Genome Browser
Species Human (GRCh38)
Location 7:3175224-3175246
Sequence AAGACCCACCCTTGTGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019812554_1019812557 -3 Left 1019812554 7:3175224-3175246 CCTCTCACACAAGGGTGGGTCTT No data
Right 1019812557 7:3175244-3175266 CTTTAAATGTCACTCACATGGGG No data
1019812554_1019812556 -4 Left 1019812554 7:3175224-3175246 CCTCTCACACAAGGGTGGGTCTT No data
Right 1019812556 7:3175243-3175265 TCTTTAAATGTCACTCACATGGG No data
1019812554_1019812558 10 Left 1019812554 7:3175224-3175246 CCTCTCACACAAGGGTGGGTCTT No data
Right 1019812558 7:3175257-3175279 TCACATGGGGCGAAACACTTAGG No data
1019812554_1019812559 29 Left 1019812554 7:3175224-3175246 CCTCTCACACAAGGGTGGGTCTT No data
Right 1019812559 7:3175276-3175298 TAGGATCCTCATCATGAGAAAGG No data
1019812554_1019812555 -5 Left 1019812554 7:3175224-3175246 CCTCTCACACAAGGGTGGGTCTT No data
Right 1019812555 7:3175242-3175264 GTCTTTAAATGTCACTCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019812554 Original CRISPR AAGACCCACCCTTGTGTGAG AGG (reversed) Intergenic
No off target data available for this crispr