ID: 1019812559

View in Genome Browser
Species Human (GRCh38)
Location 7:3175276-3175298
Sequence TAGGATCCTCATCATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019812554_1019812559 29 Left 1019812554 7:3175224-3175246 CCTCTCACACAAGGGTGGGTCTT No data
Right 1019812559 7:3175276-3175298 TAGGATCCTCATCATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019812559 Original CRISPR TAGGATCCTCATCATGAGAA AGG Intergenic
No off target data available for this crispr